Endometrial organoid culture method

Abstract

The invention relates to the technical field of biology, and particularly provides an endometrial organ culture method. By optimizing the endometrial organoid differentiation culture system, compared with an existing culture mode, the optimized culture system is easy to operate, the organoid with more complete physiological functions can be prepared without co-culture with stromal cells, continuous culture can be conducted for at least one year or above, and the obtained organoid is complete in secretion function and free of secondary pollution. The phenotype of cilia cells is more obvious.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a method for culturing endometrial organoids. Background Art

[0002] Organoids refer to tissue analogs with a certain spatial structure formed by in vitro three-dimensional (3D) culture of adult stem cells or pluripotent stem cells. Although organoids are not real human organs, they can simulate real organs in terms of structure and function, can maximize the simulation of in vivo tissue structure and function, and can be stably passaged and cultured for a long time. Compared with traditional two-dimensional culture models, organoids represent an innovative technology that can generalize the physiological processes of the whole organism, and have advantages such as being closer to physiological cell composition and behavior, having a more stable genome, being more suitable for biological transfection and high-throughput screening, etc. Compared with animal models, the operation of the organoid model is simpler, and it can also be used to study the mechanisms of disease occurrence and development. Therefore, it has broad application prospects in the fields of organ development, precision medicine, regenerative medicine, drug screening, gene editing, disease modeling, etc. In 2013, organoids were named one of the top ten technologies of the year by the journal Science. At the beginning of 2018, organoids were named the Method of the Year 2017 by Nature Methods.

[0003] The uterus is an important organ for women to form menstruation and conceive a fetus. It provides a physiological microenvironment for embryo implantation, establishes a maternal / fetal functional connection, and ensures the growth and development of the fetus, and finally gives birth to healthy offspring. Different species of animals have their own unique reproductive characteristics, showing different uterine physiological structures. The female uterus shows the reproductive characteristics of the menstrual cycle, with its complexity and evolutionary uniqueness. Therefore, scientists have carried out a series of related research work on female uterine anatomy and physiology. However, due to the complexity of the female uterus and the lack of an easy-to-operate experimental system, many key physiological mechanism problems remain unsolved. The current development of organoid technology provides research possibilities and in vitro experimental paradigms for exploring human uterine tissues and organs in vitro.

[0004] In 2017, Turco MY reported the optimized establishment of uterine organoids derived from human adult stem cells, which advanced the scientific research on the physiological function mechanism of the human endometrium. The constructed endometrial organoids can simulate the glandular epithelium of the endometrium, have the phenotypes of ciliated cells and secretory cells, and can model the responses to estrogen and progesterone. However, there is still a certain gap between the phenotypes of the organoids constructed by this method and the endometrium in the physiological state. The secretory phenotype is not obvious, and the cell composition of ciliated cells and secretory cells and their respective physiological functions in reproduction have not been clearly elaborated. Therefore, there is no research on the mechanism of female reproductive disorders related to the endometrium using such organoid models. The present invention constructs a more mature culture method by optimizing the differentiation culture method of endometrial organoids, and for the first time establishes an aging endometrium model using this method and conducts research on the mechanism of reduced receptivity of the aging endometrium.

[0005] Currently, the research on the optimization of endometrial organoids focuses on co-culturing stromal cells with endometrial organoids to improve their physiological functions, that is, after collecting clinical endometrial samples, endometrial organoids and primary stromal cells are constructed simultaneously. Then, the stromal cells are mixed with the endometrial organoids for co-culture to improve the phenotype and function of the endometrium. However, the disadvantage of this method is that the stromal cells of the endometrium are primary cultured fibroblasts and cannot be continuously passaged, which affects the continuous use of the system. Moreover, the methods for identifying the secretory function and ciliated cell phenotype after co-culture are not mature, so it cannot be applied to the research on the mechanism of endometrial diseases. Summary of the Invention

[0006] In order to fill the gaps in the prior art, the present invention provides a culture method for endometrial organoids and provides the following technical solutions:

[0007] First, in the first aspect, the present invention provides a culture method for endometrial organoids, and the method includes the following steps:

[0008] (1) Digest endometrial tissue fragments with collagenase to obtain a single-cell suspension;

[0009] (2) Resuspend the cells with Matrigel, solidify to form colloidal particles, and add an endometrial organoid expansion medium for expansion culture;

[0010] (3) After passage, convert the endometrial organoid expansion medium into an endometrial epithelial organoid differentiation medium, and it can be differentiated into mature endometrial organoids. Among them, the composition of the endometrial epithelial organoid differentiation medium is:

[0011] Advanced F12 / DMEM

[0012] HEPES 1M 1%

[0013] GlutaMAX 1%

[0014] P / S 10%

[0015] N2 supplement 1X

[0016] B27 supplement 1X

[0017] N-acetylcysteine 1 mM

[0018] Noggin 100 ng / ml

[0019] Y-27632 10 μM

[0020] FGF10 100 ng / ml

[0021] A8301 500 nM Primocin 50 mg / ml。

[0022] In one embodiment, the components of the endometrial organoid expansion medium are:

[0023] Advanced F12 / DMEM

[0024] HEPES 1 M 1%

[0025] GlutaMAX 1%

[0026] P / S 1%

[0027] Rspondin, Noggin conditioned medium 10%

[0028] N2 supplement 1X

[0029] B27 supplement 1X

[0030] N-acetylcysteine 1 mM

[0031] Nicotinamide 10 nM

[0032] Y-27632 10 μM

[0033] A8301 500 nM

[0034] FGF10 100 ng / ml

[0035] EGF 50 ng / ml

[0036] Primocin 50 mg / ml。

[0037] In one embodiment, in step (3), the organoids are passaged at a ratio of 1:6 every 7 days, and the endometrial organoids after passage are cultured in the expansion medium for about 4 days and then changed to the endometrial epithelial organoid differentiation medium.

[0038] In a second aspect of the present invention, there is provided an endometrial organoid differentiation medium, which is obtained by removing the Rspondin I component from the organoid expansion medium, wherein the expansion medium comprises AdvancedF12 / DMEM, HEPES, GlutaMAX, P / S, N2 supplement, B27 supplement, N-acetylcysteine, Noggin, Y-27632, FGF10, A8301, Primocin, Rspondin I, Nicotinamide and EGF.

[0039] In one embodiment, the differentiation medium is obtained by removing two components, Rspondin I and Nicotinamide, from the organoid expansion medium.

[0040] In one embodiment, the differentiation medium is obtained by removing three components, Rspondin I, Nicotinamide and EGF, from the organoid expansion medium.

[0041] In a preferred embodiment, the endometrial organoid differentiation medium consists of AdvancedF12 / DMEM, HEPES, GlutaMAX, P / S, N2 supplement, B27 supplement, N-acetylcysteine, Noggin, Y-27632, FGF10, A8301, Primocin.

[0042] In a more preferred embodiment, the endometrial organoid differentiation medium is:

[0043] Advanced F12 / DMEM

[0044] HEPES 1M 1%

[0045] GlutaMAX 1%

[0046] P / S 10%

[0047] N2 supplement 1X

[0048] B27 supplement 1X

[0049] N-acetylcysteine 1mM

[0050] Noggin 100ng / ml

[0051] Y-27632 10uM

[0052] FGF10 100ng / ml

[0053] A83-01 500nM

[0054] Primocin 50mg / ml。

[0055] Compared with the prior art, the present invention has the following remarkable progress:

[0056] 1. Aiming at the disadvantages of the current endometrial organoid culture method, the present invention optimizes the composition and differentiation time of the endometrial organoid differentiation medium, making the function and cell composition of the endometrial organoids closer to the physiological state; compared with the existing culture methods, the optimized culture system is simple to operate, can be used continuously and stably, can be continuously cultured for at least one year or more, has a perfect secretory function, and the ciliated cell phenotype is more obvious.

[0057] 2. The present invention has established a mature method for detecting cell phenotypes and secretory functions;

[0058] 3. The present invention has established an aging endometrial organoid model for the first time, compared the aging endometrial organoids with young endometrium, discovered the key cell types and molecules potentially affecting the receptivity of aging endometrium, and realized the use of the organoid model for pathological mechanism research. Description of the Drawings

[0059] The drawings are used to provide a further understanding of the present invention, and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention, and do not constitute a limitation to the present invention. In the drawings:

[0060] Figure 1 Optimization of the differentiation medium: After differentiating and culturing by removing RspondinI, RspondinI and Nicotamide, and Rspondin I, Nicotamide and EGF respectively, A) cell morphology; B) spheroid formation rate; C) changes in cell viability.

[0061] Figure 2 It should be noted that in the original text, "FGF10100ng / ml" is likely a miswriting. I translated it as "FGF10 100ng / ml" according to the common sense. If there is an error in my understanding, please correct it according to the actual situation.For the response of optimized endometrial organoids to estrogen: Remove Rspondin I, Rspondin I and Nicotamide, and Rspondin I, Nicotamide and EGF respectively. After differentiation culture, add estrogen E2 to simulate the proliferative phase of the endometrium, and add E2, P4 and cAMP to simulate the secretory phase. A) Detect the induction of ER and PR in the proliferative phase and secretory phase by qPCR; B) Detect the expression of stem cell-related genes SOX9 and SOX17 in the secretory phase by qPCR; C) Detect the secretion of SSP1 in the secretory phase by ELISA. Detailed implementation mode

[0062] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0063] Example 1 Establishment of a differentiation culture system for endometrial organoids

[0064] The endometrial organoid expansion medium provided by the present invention is optimized based on the medium of Turco MY et al. in 2017. Specifically, on the basis of the expansion medium, Rspondin I, Nicotinamide and EGF are removed. The specific medium formula is as follows:

[0065] The components and usage concentrations of the organoid expansion medium disclosed in the prior art are:

[0066] Table 1

[0067] AdvancedF12 / DMEM - HEPES 1M 1％ GlutaMAX 1％ P / S 1％ Rspondin, Noggin conditioned medium 10％ N2 supplement 1X B27 supplement 1X N-acetylcysteine 1 mM Nicotinamide 10 nM Y-27632 10 μM A8301 500 nM FGF10 100 ng / ml EGF 50 ng / ml Primocin 50 mg / ml

[0068] The components and concentrations of the optimized organoid differentiation medium of this application are:

[0069] Table 2

[0070] AdvancedF12 / DMEM - HEPES 1M 1％ GlutaMAX 1％ P / S 10％ N2 supplement 1X B27 supplement 1X N-acetylcysteine 1 mM Noggin 100 ng / ml Y-27632 10 μM FGF10 100 ng / ml A8301 500 nM Primocin 50 mg / ml

[0071] Use the above medium for culturing endometrial epithelial cell organoids. The specific steps are as follows:

[0072] 1. Use a scalpel to cut the endometrial tissue (the discarded tissue after surgery from patients in the Third Hospital of Peking University, and all patients have signed informed consent forms) into small pieces, transfer them into a 15 ml centrifuge tube, add 10 ml of medium Advanced DMEM / F12 (Thermo Fisher Scientific, 12634010), and centrifuge at 300 g for 5 minutes, then remove the supernatant.

[0073] 2. Resuspend the tissue fragment pellet in 5 ml of collagenase (Sigma, C9407) solution at a concentration of 2 mg per ml and incubate at 37°C for 10 to 20 minutes.

[0074] 5. Add 2% FBS (Gibco, 10099141C) to the digested tissue suspension to stop digestion, then add 5 ml of Advanced DMEM / F12 culture medium (Thermo Fisher Scientific, 12634010) and pipette 20 times.

[0075] 6. Filter the cell suspension through a 100 μm cell strainer to remove incompletely digested tissue chunks.

[0076] Centrifuge at 7.300 g for 5 minutes to pellet the single cells separated from the tissue digestion and discard the supernatant.

[0077] 8. If there are a large number of red blood cells in the precipitated cells, add 1 ml of red blood cell lysis buffer to resuspend the cells and react at room temperature for 5 minutes.

[0078] 9. Add 10 ml of Advanced DMEM / F12 culture medium (Thermo Fisher Scientific, 12634010), mix well by pipetting, and centrifuge at 300 g for 5 minutes.

[0079] 10. Resuspend the cells in Matrigel and mix well.

[0080] 11. Carefully add the suspension as droplets to a preheated 24-well plate, 40 μl per well. Incubate in a 37°C cell culture incubator for 20 minutes to allow the Matrigel suspension to solidify into particles. At this point, add 500 μl per well of the optimized endometrial organoid expansion medium listed in Table 1. Incubate the 24-well plate in a 5% CO2 cell culture incubator at 37°C.

[0081] 12. Organoids are typically passaged every 7 days at a 1:6 ratio. After passage, endometrial organoids are cultured in expansion medium for approximately 4 days. The expansion medium is then transferred to the endometrial epithelial organoid differentiation medium shown in Table 2. The medium is changed every other day. After 10 days, mature endometrial organoids will be differentiated.

[0082] To compare the culture results of the optimized culture medium, after culturing the passaged endometrial organoids in the expansion medium for 4 days, the endometrial organoids were cultured in three optimized differentiation media: -RS1 (the expansion medium only removed Rspondin I), -RS1-NICO (the expansion medium only removed Rspondin I and Nicotinamide), and -RS1-NICO-EGF (the expansion medium removed Rspondin I, Nicotinamide, and EGF). The medium was changed every other day, and the organoids were collected after continuous culture for 10 days for downstream applications.

[0083] Among them, the -RS1 differentiation medium was:

[0084] Table 3

[0085]

[0086]

[0087] The -RS1-NICO differentiation medium was:

[0088] Table 4

[0089] AdvancedF12 / DMEM - HEPES 1M 1％ GlutaMAX 1％ P / S 1％ Noggin 100 ng / ml N2 supplement 1X B27 supplement 1X N-acetylcysteine 1 mM Y-27632 10 μM A8301 500 nM FGF10 100 ng / ml EGF 50 ng / ml Primocin 50 mg / ml

[0090] The -RS1-NICO-EGF differentiation medium was:

[0091] Table 5

[0092]

[0093]

[0094] The CellTiter-Glo 3D (G9683, Promega) was used to lyse the organoids to release ATP, and the value of ATP was detected by TECAN Infinite MPLEX to test the cell viability of the organoids.

[0095] The functions of the expansion medium and the three optimized differentiation media were compared by observing the morphology of the endometrial organoids under a light microscope.

[0096] The experimental results showed that compared with the endometrial organoids cultured in the expansion medium, for the organoids cultured in the optimized differentiation media, there were no obvious changes in the spheroid formation rate and cell viability of the endometrial organoids observed by light microscopy, but there were obvious differences in the morphology of the organoids (such as Figure 1As shown). The cell mass of vacuolar endometrial organoids cultured in the expansion medium increased significantly with the culture time, while the increase in the mass of the aggregates cultured with Rspondin I removed for differentiation was not significant. The cell aggregates cultured with Rspondin I and Nicotinamide removed or with Rspondin I, Nicotinamide, and EGF removed for differentiation formed glandular crypt structures similar to those of the endometrium in the physiological state, especially the organoids differentiated with all three components removed simultaneously.

[0097] Example 2 Establishment of an endometrial organoid model and model function testing (estrogen response)

[0098] After the passaged endometrial organoids grew in the expansion medium for 4 days, the expansion medium was replaced with the aforementioned different differentiation media, and 10 nM β-estradiol (E2, MCE HY-B0708) was added to each. After 2 days, the medium was replaced with the following conditions: the differentiation medium supplemented with 10 nM E2 to simulate the proliferative phase of the endometrium; or 10 nM E2 + 1 μM progesterone (P4, Sigma P7556) + 1 μM 8-bromo-adenosine 3,5-cyclic monophosphate (cAMP, MCE HY-B1511) to simulate the secretory phase of the endometrium; or 10 nM E2 + 1 μM P4 + 1 μM cAMP + 20 ng / ml PRL + 20 ng / ml hPL + 1 μg / ml hCG, and the organoids were collected after 8 days of treatment. The specific operations are as follows:

[0099] 1. Preliminary identification of the gene-level expression of endometrial organoids by qPCR

[0100] RNA was extracted using the RaPure Total RNA Kit (Magen, R4011-03), and reverse transcription was performed using the PrimeScript TM RT reagent Kit (Takara, RR037A). The upstream and downstream primers targeting different genes were designed by Primer3.0, and the specific sequence information is shown in the attached table in the appendix. Then, fluorescence quantitative PCR was performed using TB Premix Ex Taq (Takara, RR420A):

[0101] Primer name Forward primer Reverse primer ESR GCTTACTGACCAACCTGGCAGA GGATCTCTAGCCAGGCACATTC PR CCCAGCATGTCGCCTTAGAAA AGTGCTCTCACAACTCTGACTT SOX9 AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG SOX17 GTGGACCGCACGGAATTTG GGAGATTCACACCGGAGTCA

[0102] 2. Identification of the protein-level expression of endometrial organoids by immunofluorescence

[0103] Collect the organoids, add 1 ml of 4% PFA, incubate at room temperature for 15 minutes, and centrifuge at 700 rcf for 5 minutes. Discard the supernatant, add 0.5% TX100 in PBS for permeabilization for 10 minutes, wash twice with 2% FBS / PBS, incubate with 3% BSA / PBS at room temperature for 1 hour, stain overnight at 4 °C with Acetyl-alpha Tubulin (Lys40) Monoclonal Antibody (6-11B-1) (Thermo Fisher Scientific, 32-2700), wash 4 times with 2% FBS / PBS, stain with secondary antibody Goat anti-Rabbit IgG(H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific, A-11008) (1:200) at room temperature for 2 hours, wash 4 times with 2% FBS / PBS, DAPI (Sigma, D9542) and Alexa Fluor TM 633 Phalloidin (Invitrogen, A22284) for 1 hour at room temperature, wash with PBS, centrifuge at 300 rcf for 5 minutes, discard the supernatant, add approximately 40 μL of ProLong TM Glass Antifade Mountant (Invitrogen, P36984).

[0104] 3. Identify the secretory function of endometrial organoids by enzyme-linked immunosorbent assay

[0105] Collect the culture medium supernatant of endometrial organoids and use the Human Osteopontin / SPP1 ELISA Kit

[0106] (BOSTER, EK0482) to detect the concentration of SPP1 in the amplified medium and the optimized medium according to the kit instructions.

[0107] The results are as Figure 2 shown. After adding estrogen to the organoids differentiated by removing 3 components simultaneously, the estrogen receptor ER and progesterone receptor PR showed stronger induced expression, the expression of stem cell-related genes SOX9 and SOX17 decreased, and the secretion of SSP1 was more (as Figure 2 shown), indicating that the endometrial organoids were more maturely differentiated. Therefore, compared with the amplified medium, the endometrial organoids cultured in the optimized differentiation medium with RspondinI, Nicotinamide, and EGF removed had more mature functions.

[0108] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A method for culturing endometrial organoids, characterized in that, The method includes the following steps: (1) Digest endometrial tissue fragments with collagenase to obtain a single-cell suspension; (2) Resuspend the cells with Matrigel, solidify to form colloidal particles, and add an endometrial organoid expansion medium for expansion culture; (3) After passage, convert the endometrial organoid expansion medium into an endometrial epithelial organoid differentiation medium, and then it can be differentiated into mature endometrial organoids. Among them, the components of the endometrial epithelial organoid differentiation medium are: Advanced F12 / DMEM HEPES 1M 1% GlutaMAX 1% P / S 10% N2 supplement 1X B27 supplement 1X N-acetylcysteine 1mM Noggin 100ng / ml Y-27632 10uM FGF10 100ng / ml A8301 500nM Primocin 50mg / ml.

2. The cultivation method according to claim 1, characterized in that, The components of the endometrial organoid expansion medium are: Advanced F12 / DMEM HEPES1M 1% GlutaMAX 1% P / S 1% Rspondin, Noggin conditioned medium 10% N2 supplement 1X B27 supplement 1X N-acetylcysteine 1mM Nicotinamide 10nM Y-27632 10uM A8301 500nM FGF10 100ng / ml EGF 50ng / ml Primocin 50mg / ml.

3. The culturing method according to claim 1, wherein In the step (3), the organoids are passaged at a ratio of 1:6 every 7 days. After passage, the endometrial organoids are cultured in the expansion medium for about 4 days and then replaced with the endometrial epithelial organoid differentiation medium.

4. An endometrial organoid differentiation medium, characterized in that, The differentiation medium is obtained by removing the Rspondin I component from the organoid expansion medium. Among them, the expansion medium includes AdvancedF12 / DMEM, HEPES, GlutaMAX, P / S, N2 supplement, B27 supplement, N-acetylcysteine, Noggin, Y-27632, FGF10, A8301, Primocin, Rspondin I, Nicotinamide and EGF.

5. The endometrial organoid differentiation medium according to claim 4, wherein The differentiation medium is obtained by removing two components, Rspondin I and Nicotinamide, from the organoid expansion medium.

6. The endometrial organoid differentiation medium according to claim 4, wherein The differentiation medium is obtained by removing three components, Rspondin I, Nicotinamide and EGF, from the organoid expansion medium.

7. The endometrial organoid differentiation medium according to any one of claims 4-6, characterized in that, The endometrial organoid differentiation medium consists of Advanced F12 / DMEM, HEPES, GlutaMAX, P / S, N2 supplement, B27 supplement, N-acetylcysteine, Noggin, Y-27632, FGF10, A8301, and Primocin.

8. The endometrial organoid differentiation medium according to any one of claims 4-6, characterized in that, The endometrial organoid differentiation medium is as follows: Advanced F12 / DMEM HEPES 1M 1% GlutaMAX 1% P / S 10% N2 supplement 1X B27 supplement 1X N-acetylcysteine 1mM Noggin 100 ng / ml Y-27632 10 μM FGF10 100 ng / ml A8301 500 nM Primocin 50 mg / ml.

Images