Application of GmOSD1b protein and coding gene thereof in regulation and control of plant meiosis

Abstract

The invention relates to the technical field of plant genetic engineering, and discloses application of a GmOSD1b protein and a coding gene thereof in regulation and control of plant meiosis. According to the invention, the GmOSD1b gene is cloned in soybean, and the gene participates in the second meiosis process and affects the normal development of gametophytes. The GmOSD1b gene is subjected to targeted editing through the CRISPR / Cas9 technology, gene resources and theoretical support are provided for heterosis fixation of soybeans through apomixis, and the GmOSD1b gene has important application value in the aspects of promoting the soybean apomixis technology and cultivating new soybean varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and specifically, to the application of GmOSD1b protein and its encoding gene in regulating plant meiosis. Background Art

[0002] Meiosis is a special type of cell division that occurs during the formation of germ cells in sexually reproducing individuals, and is an essential process for gamete formation in the sexual reproduction of eukaryotes. During meiosis, according to chromosomal behavior changes, the meiotic process can be divided into the first meiotic division and the second meiotic division, and each stage includes four periods: prophase, metaphase, anaphase, and telophase, mainly involving a series of important biological events such as DNA replication, sister chromatid cohesion, homologous chromosome pairing, synapsis, recombination, and segregation. During the first meiotic division, the sex mother cell completes one round of homologous chromosome pairing and segregation, and during the second meiotic division, sister chromatids separate. The meiotic process provides an important material basis for maintaining the constancy of the chromosome number and genetic diversity of species.

[0003] In recent years, the research on the apomixis technology of rice has made it possible to apply it in the heterosis breeding of crops, bringing great production potential to crop breeding. The key to the apomixis technology is to transform the meiotic process into a mitotic process, specifically involving three key genes of meiosis: REC8, PAIR1 (SPO11-1), and OSD1. Therefore, the research and application of the above genes will have important significance for promoting the application of apomixis technology in the heterosis breeding of crops. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of GmOSD1b protein and its encoding gene in regulating plant meiosis.

[0005] To achieve the purpose of the present invention, in the first aspect, the present invention provides the application of a GmOSD1b protein, its encoding gene, or a biological material containing the gene in regulating plant meiosis.

[0006] In the present invention, the GmOSD1b protein is: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO:1; or (b) a protein derived from (a) with one or several amino acids substituted, deleted, or added in the sequence shown in SEQ ID NO:1 and having the same function.

[0007] The biomaterials include, but are not limited to, recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or transgenic cell lines.

[0008] In the present invention, the plant is a monocotyledon or a dicotyledon, including, but not limited to, soybean, Arabidopsis thaliana, wheat, rice, corn, cotton, and peanut.

[0009] In a second aspect, the present invention provides a method for affecting the normal development of soybean gametophytes or affecting the fertility (or viability) of soybean pollen. The method includes: using genetic engineering means to weaken or knockout a gene in soybean GmOSD1b ; wherein, the gene GmOSD1b encodes the GmOSD1b protein.

[0010] Furthermore, the method includes: using the gene GmOSD1b as a target, designing a sgRNA sequence based on CRISPR / Cas9, ligating a DNA fragment containing the DNA sequence encoding the sgRNA sequence to a vector carrying CRISPR / Cas9, transforming soybean, and thereby obtaining a transgenic soybean with a loss-of-function of this gene.

[0011] Preferably, the nucleotide sequence of the sgRNA action site is 5'-CCTTCGGTCGCGGAAGAGCTCGC-3' (SEQ ID NO: 3).

[0012] More preferably, the sgRNA is driven by the GmU6 promoter, and the Cas9 protein is driven by the GmUbi3 promoter.

[0013] In a third aspect, the present invention provides the application of the transgenic soybean obtained according to the method in plant breeding.

[0014] Furthermore, the breeding methods include, but are not limited to, transgenic, hybridization, backcross, self-cross, or asexual reproduction.

[0015] By means of the above technical solutions, the present invention has at least the following advantages and beneficial effects: Thereby, the present invention has at least the following advantages and beneficial effects: The present invention first cloned the GmOSD1b gene involved in the meiosis process in soybean. GmOSD1b The gene can regulate the meiosis process of plants and affect the fertility (or viability) of pollen. By targeting and editing the GmOSD1b gene by CRISPR / Cas9 technology, mutations of the GmOSD1b gene can be effectively induced, thereby affecting the second meiosis process of soybean. By targeting and editing the GmOSD1b gene by CRISPR / Cas9 technology to regulate the meiosis process of soybean, it provides an important technical basis and theoretical support for the utilization of apomixis in soybean. Description of the Drawings

[0016] Figure 1 For Example 1 of the present invention GmOSD1b Gene structure.

[0017] Figure 2 For Example 2 of the present invention, it is the CRISPR / Cas9 vector map.

[0018] Figure 3 For Example 3 of the present invention, it is the phenotypes of wild-type DN50 and CRISPR / Cas9-induced Gmosd1b mutant plants.

[0019] Figure 4 For Example 3 of the present invention, it is the Gmosd1b pollen potassium iodide staining of wild-type DN50.

[0020] Figure 5 For Example 3 of the present invention, it is the Gmosd1b chromosome behavior observation of wild-type DN50. Detailed implementation mode

[0021] The present invention aims to provide a soybean meiosis-related gene GmOSD1b protein, its coding gene, its inhibitor, and a method for regulating the soybean meiosis process.

[0022] Research has found that mutations in the GmOSD1b gene affect the second meiosis process in soybeans, leading to abnormal gamete development. The cloning of this gene provides a gene resource for soybeans to fix heterosis through apomixis and has important application value in plant genetic engineering breeding.

[0023] Furthermore, the present invention uses the CRISPR / Cas9 technology to target and edit genes that affect soybean meiosis GmOSD1b , providing germplasm resources for promoting the utilization of soybean apomixis.

[0024] The present invention adopts the following technical solutions: The present invention clones the soybean Glyma.19G144400 gene ， and names it GmOSD1b . The amino acid sequence of the encoded protein is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2. The present invention discovers that using the CRISPR / Cas9 technology to target and edit GmOSD1b can affect the soybean meiosis process, resulting in reduced pollen fertility.

[0025] In the first aspect, the present invention provides the application of soybean GmOSD1b protein or its coding gene or an inhibitor of the coding gene of soybean GmOSD1b protein in regulating the soybean meiosis process.

[0026] In a second aspect, the present invention provides a method for regulating the soybean multiple meiosis process using the CRISPR / Cas9 technology and its application in plant genetic breeding or the preparation of transgenic plants.

[0027] In the above application, through the CRISPR / Cas9 technology, target editing GmOSD1b the gene sequence to cause the loss of its gene function, affect the second meiosis of soybeans, and lead to a decrease in pollen fertility. Preferably, the present invention uses the CRISPR / Cas9 technology to target-edit the coding gene of the GmOSD1b protein in plants with the nucleotide sequence shown in SEQ ID NO:3 as the sgRNA, and obtain abnormal lines in the soybean meiosis process in a short time.

[0028] In the present invention, the soybean GmOSD1b protein has any one of the following amino acid sequences: (1) The amino acid sequence shown in SEQ ID NO:1; (2) An amino acid sequence obtained by substitution, insertion or deletion of one or more amino acids in the amino acid sequence shown in SEQ ID NO:1 and having the same functional protein; (3) An amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO:1; preferably, the homology is at least 90%; more preferably 95%.

[0029] In the present invention, the CDS of the soybean GmOSD1b protein has any one of the following nucleotide sequences: (1) The nucleotide sequence shown in SEQ ID NO:2; (2) A nucleotide sequence obtained by substitution, insertion or deletion of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO:2 and encoding the same functional protein.

[0030] The above amino acid sequence shown in SEQ ID NO:1 is the amino acid sequence of the soybean GmOSD1b protein. Those skilled in the art can, according to the amino acid sequence disclosed in the present invention and conventional technical means in the art such as conservative substitution of amino acids, replace, delete and / or add one or several amino acids without affecting its activity, and obtain mutants of the GmOSD1b protein having the same activity as the GmOSD1b protein disclosed in the present invention.

[0031] The nucleotide sequence shown as SEQ ID NO:2 above is the CDS sequence of the GmOSD1b protein in soybean. The coding gene of the GmOSD1b protein of the present invention can be any nucleotide sequence capable of encoding the above-mentioned GmOSD1b protein. Considering the degeneracy of codons and the codon preference of different species, those skilled in the art can use codons suitable for expression in a specific species as needed.

[0032] The present invention also provides an inhibitor of the above-mentioned coding gene. Preferably, the inhibitor of the coding gene of the soybean GmOSD1b protein includes interfering RNA or sgRNA capable of inhibiting the expression of the coding gene of the soybean GmOSD1b protein.

[0033] The present invention also provides the application of the GmOSD1b protein or its coding gene, the inhibitor of the coding gene in regulating plant meiosis.

[0034] The present invention also provides an expression cassette containing the coding gene of the GmOSD or its inhibitor.

[0035] The present invention also provides a vector containing the coding gene of the GmOSD1b protein or its inhibitor.

[0036] The present invention also provides a host cell containing the above-mentioned expression cassette or vector.

[0037] The application of the above-mentioned GmOSD1b protein or its coding gene or the inhibitor of the coding gene of the soybean GmOSD1b protein can be applied in the form of the GmOSD1b protein or its coding gene or the inhibitor of the coding gene of the soybean GmOSD1b protein itself, or in the form of an expression cassette, a vector containing the coding gene of the GmOSD1b protein or its inhibitor, and a host cell containing the expression cassette or the vector.

[0038] In the present invention, the plant is a monocotyledon or a dicotyledon. The plants include but are not limited to soybean, Arabidopsis thaliana, wheat, rice, corn, cotton, peanut, etc.

[0039] The present invention also provides a method for regulating the process of plant meiosis, using gene editing technology or transgenic technology to interfere with the GmOSD1b function of genes and affecting the process of the second meiosis of plants.

[0040] Preferably, the gene editing technology is CRISPR / Cas9 technology. The CRISPR / Cas9 technology targets and edits the coding gene of the GmOSD1b protein in plants to knockout the coding gene of the GmOSD1b protein; the sequence of the sgRNA is as shown in SEQ ID NO:3.

[0041] The present invention discovers for the first time GmOSD1b that the gene can affect the process of the second meiosis and pollen activity. By using the CRISPR / Cas9 technology to target and edit GmOSD1b the gene, mutants with reduced soybean fertility can be obtained in a short time. This technology provides theoretical and technical support for soybeans to utilize apomixis technology to fix heterosis and has important application value in soybean genetic engineering breeding.

[0042] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art, and the raw materials used are all commercially available products.

[0043] Example 1 Cloning of soybean GmOSD1b Clone the soybean gene and name it Glyma.19G144400 as GmOSD1b . GmOSD1b The gene is located on chromosome 19, with a full length of 3549 bp and a full length of CDS sequence of 663 bp ( Figure 1 ), GmOSD1b and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2.

[0044] Example 2 GmOSD1b Knockout of the gene Construct a CRISPR / cas9 recombinant plasmid pVK005-04-SoyU6-2-GmUbi3- GmOSD1b driven by the GmU6 promoter (SEQ ID NO:4) for sgRNA (the sgRNA sequence targeting the GmOSD1b gene is shown in SEQ ID NO:3: CCTTCGGTCGCGGAAGAGCTCGC) and the GmUbi3 promoter (LOC100799042, Glyma.20G141600v4) for driving the Cas9 protein Figure 2 ), and introduce the recombinant plasmid into the wild-type Dongnong 50 (DN50) soybean (provided by Northeast Agricultural University, national approval number: Hei Shen Dou 2007022) through the Agrobacterium-mediated cotyledon node infection method of soybeans. After soybean genetic transformation, a total of 200 GmOSD1b ko transgenic plants are obtained. Use the bar test strip to identify the T0 generation transgenic plants, and 57 T0 generation GmOSD1b ko positive transgenic plants are identified. Extract the positive transgenic DNA and perform sequencing analysis. Gene editing occurs at the targeting site in 8 GmOSD1a ko positive transgenic lines.GmOSD1b ko #18 is a T0 generation heterozygous mutant with 1 base inserted at the target site; GmOSD1b ko #25 is a heterozygous mutant obtained in the T0 generation, with 4 bases deleted at the target site; GmOSD1b ko #28 is a heterozygous mutant obtained in the T0 generation, with 1 base inserted at the target site; GmOSD1b ko #37 is a T0 generation heterozygous mutant, with 7 bases deleted at the target site; GmOSD1b ko # 45 is a heterozygous mutant obtained in the T0 generation, with 1 base deleted at the target site; GmOSD1b ko #60 is a T0 generation double - allele mutant, with 2 bases and 3 bases deleted at the target site respectively; GmOSD1b ko #62 is a heterozygous mutant obtained in the T0 generation, with 1 base deleted at the target site; GmOSD1b ko #174 is a T0 generation heterozygous mutant with 1 base inserted at the target site. Seeds of T0 generation positive plants were planted in an artificial climate chamber, and T1 generation plants were subjected to sequencing analysis and phenotypic observation.

[0045] The construction method of recombinant plasmid pVK005 - 04 - SoyU6 - 2 - GmUbi3 - GmOSD1b is as follows: Before using the kit (Plant Cas9 / gRNA Plasmid Construction Kit, Beijing Weishang Lide Biotechnology Co., Ltd., Catalog. No. VK005 - 04), design and synthesis of gRNA target primers: Design primers oligo (SEQ ID NO:5 - 6) in the following format: Target - Sense: 5’ - ATTTCGGTCGCGGAAGAGCTCGC - 3′ Target - Anti: 5’ - AACGCGAGCTCTTCCGCGACCGA - 3′ Usage method: Note: After receiving the kit, please centrifuge the test tube before use to avoid solution remaining on the tube wall.

[0046] Step 1: Formation of oligo dimer (oligoduplex) Dilute the synthesized oligo to 10μM respectively and mix them in the following ratio: Target - Sense: 5μL; Target - Anti: 5μL; H2O: 15 μL; The final system is 25 μL.

[0047] After mixing, process according to the following program: 95°C for 3 min; slowly cool from 95°C to 25°C, for example, -1°C / 20 s or place the sample tube in water at 95°C and let it cool naturally to room temperature of 16°C for 5 min.

[0048] Step 2: Insert the oligo dimer into the vector Cas9 / gRNA vector (from the plant Cas9 / gRNA plasmid construction kit): 2 μL; Oligo dimer from Step 1: 1 μL; Solution 1: 1 μL; Solution 2: 1 μL; H2O: 5 μL; The final system is 10 μL.

[0049] React at 16°C for 2 hours.

[0050] Step 3: Transformation Take 5 - 10 μL of the final product from Step 2 and add it to 50 μL of freshly thawed DH5a competent cells. Gently flick to mix, ice-bath for 30 minutes, heat-shock at 42°C for 90 seconds, let it stand on ice for 2 minutes, then add 500 μL of antibiotic-free LB, place it in a 37°C constant temperature shaker at 170 rpm, and after recovery for 1 hour, spread it on a kanamycin-resistant (Kan+) plate.

[0051] Identification of positive clones: Pick 3 to 5 white colonies for shaking culture and perform sequencing.

[0052] Example 3 GmOSD1b Observation of mutant phenotypes For the Gmosd1b homozygous mutants isolated in the T1 generation, during the vegetative growth stage, Gmosd1b there is no difference between the mutants and the wild type DN50; but during the pod-setting stage, compared with the wild type DN50, Gmosd1b the fertility of the mutants is lower and fewer pods are produced ( Figure 3 ). Subsequently, Gmosd1b the pollen of the mutants was observed by potassium iodide staining, and the results showed that Gmosd1b the pollen grains developed abnormally, some pollen grains were not stained, and some pollen grains were larger or smaller than those of the wild type DN50 ( Figure 4 ). The above experimental results indicate that Gmosd1b there are defects in pollen development in the mutants.

[0053] Example 4 GmOSD1b The gene affects the second meiotic process To clarify GmOSD1b how genes affect the process of meiosis, the chromosomal behavior changes of wild-type DN50 and Gmosd1b homozygous mutants at various stages were observed. The results are as Figure 5 shown. According to the morphology of chromosomes during meiosis, prophase I of meiosis can be subdivided into 5 stages: leptotene, zygotene, pachytene, diplotene, and diakinesis. During the pachytene stage, the chromosomes shorten and thicken, presenting a thick linear shape. During the diakinesis stage, the chromosomes further condense, and 20 bivalents can be clearly observed. When entering metaphase I, 20 bivalents are arranged on the equatorial plate. At the end of telophase I, after the dyads move to the two poles, the chromosomes unwind and stretch, the nucleolus reforms, the nuclear membrane is rebuilt, and at the same time, cytoplasmic division occurs to form two daughter cells. At the end of telophase II, after each chromosome moves to the two poles and unwinds and stretches, the nuclear membrane is reassembled and the nucleolus reappears. The spindle disappears and cytoplasmic division occurs. After the above two consecutive divisions, 4 daughter cells are formed. In Gmosd1b the mutant, the chromosomal behavior was specifically observed that during meiosis I, there was no obvious difference between the mutant chromosomes and the wild-type. However, at the end of meiosis II, sister chromosomes did not separate, and dimers with abnormal chromosome numbers were produced ( Figure 5 ). The above experimental data indicate that GmOSD1b plays an important role in controlling the separation of meiosis II chromosomes, providing valuable gene resources for apomictic breeding of soybeans.

[0054] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. Use of the GmOSD1b protein, its coding gene or biological material containing the gene in regulating plant meiosis; Among them, The GmOSD1b protein is: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or (b) a protein derived from (a) with one or several amino acids substituted, deleted or added in the sequence shown in SEQ ID NO: 1 and having the same function.

2. The application according to claim 1, wherein The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacterium.

3. The application according to claim 1 or 2, characterized in that, The plant is a monocotyledonous plant or a dicotyledonous plant.

4. The application according to claim 3, characterized in that The plant is selected from soybean, Arabidopsis thaliana, wheat, rice, corn, cotton, peanut.

5. A method for affecting the normal development of soybean gametophytes or affecting soybean pollen fertility, characterized in that, The method includes: using genetic engineering means to weaken or knockout a gene in soybean GmOSD1b ; wherein, the gene GmOSD1b encodes the GmOSD1b protein described in claim 1.

6. The method according to claim 5, wherein includes: Using the gene GmOSD1b as a target, designing sgRNA sequences based on CRISPR / Cas9, ligating the DNA fragment encoding the sgRNA sequences into a vector carrying CRISPR / Cas9, transforming soybean, and further obtaining transgenic soybean with the gene function knocked out.

7. The method according to claim 6, wherein The nucleotide sequence of the sgRNA action site is 5'-CCTTCGGTCGCGGAAGAGCTCGC-3'.

8. The method according to claim 6 or 7, characterized in that, The sgRNA is driven by the GmU6 promoter, and the Cas9 protein is driven by the GmUbi3 promoter.

9. Use of the transgenic soybean obtained by the method according to any one of claims 5-8 in plant breeding.

10. The application according to claim 9, wherein [[ID=

Images