Preparation method and application of Parasin I protein

Abstract

The invention relates to a preparation method of Parasin I protein or Parasin I fermentation liquor. The preparation method comprises the following steps: obtaining a yeast strain capable of secreting the Parasin I protein; inoculating the saccharomycetes strain into a specific liquid culture medium; fermenting the yeast strain and obtaining Parasin I fermentation liquor; the fermentation liquor comprises Parasin I protein; wherein the pH value of the specific culture medium is 6-9, the inoculum size of the saccharomycetes strain in the specific culture medium is 0.005-0.015 OD / mL, and the temperature of the fermentation saccharomycetes is 28-33 DEG C. The antibacterial peptide Parasin I protein or Parasin I fermentation liquor is simple in preparation method and high in yield, the immunity of fishes can be remarkably improved, and the survival rate of the fishes infected by pathogens is increased.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine or food additives, and particularly to a Parasin I protein and its applications. Background Art

[0002] With the widespread use of antibiotics, there have emerged an increasing number of multi-drug resistant bacteria, and the resulting medical and health problems have become increasingly serious. The potential of traditional antibiotics has been exhausted, and they are unable to overcome the continuously developing multi-drug resistance of pathogenic bacteria. Therefore, there is an urgent need to discover and develop new treatment methods to overcome the widely reported phenomenon of antibiotic tolerance.

[0003] Fish pathogen infection is a serious problem, and among them, zebrafish, as a model animal, its infection situation has attracted much attention. Fish pathogen infection is mainly divided into non-infectious diseases and infectious diseases. Infectious diseases pose a serious threat to the health of zebrafish and may trigger large-scale outbreaks or infections. Zebrafish may be infected by a variety of bacteria, such as Aeromonas veronii, Aeromonas hydrophila, Mycobacterium, etc. These bacteria can cause diseases such as fish tuberculosis and septicemia, causing serious harm to the health of zebrafish.

[0004] Antimicrobial peptides (AMPs) are a class of small peptides, most of which are composed of 10 - 50 amino acid residues, rich in arginine, lysine, and histidine residues, and overall show a net positive charge. They are amphiphilic, containing hydrophobic and hydrophilic regions, and they play a key role in the host's innate immunity against a variety of pathogens including bacteria and fungi.

[0005] Parasin I is an antimicrobial peptide isolated and identified from catfish by In Yup Park et al. in 1998. It is composed of 19 amino acids, has significant antibacterial activity against a variety of microorganisms, and has extremely low hemolytic activity.

[0006] However, at present, the main sources of the antimicrobial peptide Parasin I are natural extraction and chemical synthesis, which are costly and difficult to be put into practical applications. Summary of the Invention

[0007] In view of the technical problems existing in the prior art, the present invention provides a method for preparing Parasin I protein or Parasin I fermentation broth, comprising: obtaining a yeast strain capable of secreting Parasin I protein; inoculating the yeast strain into a specific liquid medium; and fermenting the yeast strain to obtain Parasin I fermentation broth; the fermentation broth contains Parasin I protein; wherein, the pH of the specific medium is 6-9, the inoculation amount of the yeast strain in the specific medium is 0.005-0.015 OD / mL, and the fermentation temperature of the yeast is 28-33 °C.

[0008] The preparation method as described above, wherein the pH of the specific medium is 7.9.

[0009] The preparation method as described above, wherein the inoculation amount of the yeast strain in the specific medium is 0.006 OD / mL.

[0010] The preparation method as described above, wherein the fermentation temperature of the yeast is 31.3 °C.

[0011] The preparation method as described above, wherein the fermentation time of the yeast is 1-7 days; preferably 2-6 days; more preferably 3-4 days; further preferably 3 days.

[0012] A method for activating and / or enhancing the immune system of fish, comprising: administering a certain amount of Parasin I protein or Parasin I fermentation broth obtained by any of the above-mentioned preparation methods to the fish.

[0013] A method for preventing and / or treating pathogen infections in fish, comprising: administering a certain amount of Parasin I protein or Parasin I fermentation broth obtained by any of the above-mentioned preparation methods to the fish.

[0014] The method as described above, wherein the pathogen is Aeromonas veronii, Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii or Pseudomonas aeruginosa.

[0015] A fish feed additive, comprising Parasin I protein or Parasin I fermentation broth prepared by the above-mentioned preparation method; wherein the amino acid sequence of the Parasin I protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added or deleted at the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or converted on the amino acid sequence shown in SEQ ID NO.1.

[0016] Use of the Parasin I protein or Parasin I fermentation broth prepared by the above-described preparation method as a fish feed additive, wherein the amino acid sequence of the Parasin I protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added or deleted at the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or converted on the amino acid sequence shown in SEQ ID NO.1.

[0017] In this application, a recombinant Pichia pastoris strain that can secrete the antibacterial peptide Parasin I is edited by genetic engineering. Subsequently, the antibacterial activity of the yeast fermentation broth containing the antibacterial peptide is detected, and the antibacterial spectrum of the antibacterial peptide fermentation broth is drawn. After determining its antibacterial effect, the fermentation conditions of the recombinant strain are optimized through response surface optimization experiments in order to obtain the best antibacterial effect. Then, through in-vivo experiments on zebrafish, a series of indexes such as immune-related enzyme activities are measured to identify the feasibility of using it as an antibacterial additive for fish feed. Finally, the antibacterial mechanism of the Parasin I fermentation broth of the antibacterial peptide is preliminarily explored by PI staining combined with fluorescence observation and transmission electron microscopy to observe cell morphology. This application provides a reference for the development of new feed antibacterial additives.

[0018] The preparation method of the antibacterial peptide Parasin I protein or Parasin I fermentation broth in this application is simple and has a high yield, which can significantly improve the immunity of fish and increase the survival rate of fish under pathogen infection. Brief Description of the Drawings

[0019] Next, the preferred embodiments of the present invention will be further described in detail with reference to the drawings, wherein:

[0020] Figure 1 It is an agarose gel electrophoresis diagram of PCR amplification of Parasin I according to an embodiment of the present invention; wherein, the M lane represents DL5000 DNA Marker; the 1 lane represents the Parasin I gene;

[0021] Figure 2 It is a map of the pGAPZαA empty vector (A) and the pGAPZαA-Parasin I recombinant vector (B) according to an embodiment of the present invention;

[0022] Figure 3 It is an agarose gel electrophoresis diagram of plasmid digestion verification according to an embodiment of the present invention, wherein the M lane represents DL5000 DNA Marker; the 1 lane represents the undigested plasmid; the 2 lane represents the digested plasmid;

[0023] Figure 4Agarose gel electrophoresis pattern of the recombinant strain of antibacterial peptide Parasin I identified by PCR according to an embodiment of the present invention; wherein, the M lane represents DL5000 DNA Marker; the 1st lane represents the positive control; the 2nd lane represents the negative control; the 3rd - 9th lanes represent the positive clones;

[0024] Figure 5 Agarose gel electrophoresis pattern of the recombinant yeast strain pGAPZαA - Parasin I identified by PCR according to an embodiment of the present invention; wherein, the M lane represents DL5000 DNA Marker; the 1st lane represents the positive control; the 2nd lane represents the positive clones;

[0025] Figure 6 Comparison diagram of sequencing results according to an embodiment of the present invention; wherein, Figure 6 A represents the start codon end of the open reading frame of the Parasin I gene; Figure 6 B represents the stop codon end of the open reading frame of the Parasin I gene;

[0026] Figure 7 Detection of the expression of excreted proteins in the fermentation broth by SDS - PAGE gel electrophoresis according to an embodiment of the present invention; wherein the M lane represents the small molecule protein Maker; the 1st lane represents the fermentation broth of the recombinant strain with empty plasmid; the 2nd lane represents the fermentation broth of the Parasin I recombinant strain; the 3rd lane represents the fermentation broth of the ParasinⅠ recombinant strain;

[0027] Figure 8 Results of Western Blot detection of the target excreted antibacterial peptide in the fermentation broth according to an embodiment of the present invention; wherein M: small molecule protein Maker; 1: fermentation broth of the recombinant strain with blank plasmid; 2: fermentation broth of the Parasin I recombinant strain; 3: fermentation broth of the ParasinⅠ recombinant strain;

[0028] Figure 9 Curve of the change in protein content of the fermentation broth at different fermentation times according to an embodiment of the present invention; different letters represent significant differences from each other (P < 0.05), the same below;

[0029] Figure 10 Histogram of the antibacterial activity of the fermentation broth at different fermentation times according to an embodiment of the present invention;

[0030] Figure 11 Antibacterial curve of the Parasin I fermentation broth against Aeromonas veronii according to an embodiment of the present invention;

[0031] Figure 12 Antibacterial curve of the Parasin I fermentation broth against Pseudomonas aeruginosa according to an embodiment of the present invention;

[0032] Figure 13 It is the antibacterial curve of Parasin I fermentation broth against Vibrio parahaemolyticus according to an embodiment of the present invention;

[0033] Figure 14 It is the antibacterial curve of Parasin I fermentation broth against pathogenic Escherichia coli according to an embodiment of the present invention;

[0034] Figure 15 It is the antibacterial curve of Parasin I fermentation broth against Vibrio alginolyticus according to an embodiment of the present invention;

[0035] Figure 16 It is the antibacterial curve of Parasin I fermentation broth against Rhodococcus schubertii according to an embodiment of the present invention;

[0036] Figure 17 It is the antibacterial curve of Parasin I fermentation broth against Salmonella according to an embodiment of the present invention;

[0037] Figure 18 It is the time-killing curve of different antimicrobial peptides and antibiotics according to an embodiment of the present invention;

[0038] Figure 19 It is the response surface diagram and contour map of the antibacterial activity of Parasin I fermentation broth according to an embodiment of the present invention. The functional relationship between antibacterial activity and pH and inoculum size (A); The functional relationship between antibacterial activity and inoculum size and temperature (B); The functional relationship between antibacterial activity and temperature and pH (C);

[0039] Figure 20 It is the optimization result of the response surface method for the antibacterial zone analysis of Parasin I fermentation broth optimized according to an embodiment of the present invention;

[0040] Figure 21 It is the optimization result of the response surface method for SDS-PAGE analysis according to an embodiment of the present invention; wherein, M: small molecule protein Maker; 1: Parasin I fermentation broth before optimization; 2: Parasin I fermentation broth after optimization; 3: Parasin Ⅰ fermentation broth before optimization; 4: Parasin Ⅰ fermentation broth after optimization;

[0041] Figure 22 It is the remaining antibacterial activity of the fermentation broth after simulated gastric juice treatment according to an embodiment of the present invention, wherein, "*": P<0.05; "**": P<0.01;

[0042] Figure 23 It is the survival curve of zebrafish under different treatments according to an embodiment of the present invention;

[0043] Figure 24 Bar chart of SOD(A) and AKP / ALP(B) enzyme activity detection according to an embodiment of the present invention; different letters represent significant differences from each other (P<0.05), the same hereinafter;

[0044] Figure 25 Bar chart of lysozyme enzyme activity detection according to an embodiment of the present invention;

[0045] Figure 26 Bar chart of IgM content detection according to an embodiment of the present invention; and

[0046] Figure 27 Observation of the cell membrane integrity of Aeromonas veronii after treatment with different fermentation broths by PI staining according to an embodiment of the present invention; wherein, A-B: the group treated with the empty vector fermentation broth; C-D: the group treated with the Parasin I fermentation broth;

[0047] Figure 28 Observation of the cell morphology of Aeromonas veronii after treatment with the fermentation broth by TEM according to an embodiment of the present invention; wherein, A-B: the group treated with the empty vector fermentation broth; C-D: the group treated with the Parasin I fermentation broth;

[0048] Figure 29 Effect of different volumes of fermentation broth on the biofilm formation of Aeromonas veronii according to an embodiment of the present invention; different letters represent significant differences from each other (P<0.05), the same hereinafter; and

[0049] Figure 30 Effect of different volumes of fermentation broth on the formed biofilm of Aeromonas veronii according to an embodiment of the present invention. Detailed implementation manners

[0050] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0051] In the following detailed description, reference may be made to the accompanying drawings that form a part hereof and that show, by way of illustration, specific embodiments in which the application may be practiced. In the drawings, like reference numerals describe substantially similar components in different views. The various specific embodiments of the present application have been described in sufficient detail below to enable those of ordinary skill in the art with relevant knowledge and technology to practice the technical solutions of the present application. It should be understood that other embodiments may be utilized or changes may be made to the embodiments of the present application.

[0052] As used herein, the "antimicrobial peptide" refers to antimicrobial peptide, also known as AMP. It originally referred to a class of basic polypeptide substances with antibacterial activity induced in insects, with a molecular weight of about 2000 - 7000 and consisting of 20 - 60 amino acid residues. Most of these active polypeptides have the characteristics of strong basicity, thermal stability, and broad-spectrum antibacterial activity. In the years following 1980, polypeptides with antibacterial activity were successively discovered and isolated from bacteria, fungi, amphibians, insects, higher plants, mammals, and even humans.

[0053] Antimicrobial peptides have the functions and effects of anti-infection, anti-inflammatory, immune regulation, promoting wound healing, and inhibiting the growth of tumor cells. Further, studies have shown that antimicrobial peptides play an anti-infection role by interfering with the synthesis of bacterial cell walls or destroying their structural integrity, thereby inhibiting the growth of pathogens. It is applicable to the treatment of infectious diseases caused by various bacteria. It can be administered by oral, injection, etc.; Antimicrobial peptides can directly neutralize endotoxins and induce macrophages to produce inflammatory mediators, thereby playing an anti-inflammatory role. It has a certain therapeutic effect on autoimmune diseases, etc.; Antimicrobial peptides can stimulate the body to produce natural killer cells and T lymphocytes, enhancing the body's immunity; Antimicrobial peptides can accelerate blood circulation around the wound, promote cell proliferation and tissue repair. It is applicable to improving the condition of chronic non-healing wounds complicated with infection; Antimicrobial peptides can interfere with the signal pathways of tumor cells, blocking their growth and spread. It may have an adjuvant therapeutic effect on certain types of cancer.

[0054] As used herein, "Parasin I" is an antimicrobial peptide isolated and identified from catfish by In Yup Park et al. in 1998. It consists of 19 amino acids, has significant antibacterial activity against a variety of microorganisms, and has extremely low hemolytic activity. In addition to its functions in inhibiting and killing the growth of microorganisms, people have also found that they participate in the immune regulation mechanism. Parasin I shows good antibacterial activity against fish-specific bacterial pathogens and participates in the innate host defense of fish against invading pathogenic microorganisms.

[0055] In some embodiments, the amino acid sequence of Parasin I is as shown in SEQ ID NO.1, or as follows: KGRGKQGGKVRAKAKTRSS;

[0056] The nucleotide sequence of Parasin I is as shown in SEQ ID NO.2, or as follows:

[0057] AAGGGCCGCGGAAAGCAAGGCGGCAAGGTTCGCGCTAAGGCCAAGA CACGCTCATCG.

[0058] In some embodiments, the gene primer sequences for cloning Parasin I contain specific restriction endonuclease sequences at both ends. Further,

[0059] The Parasin I-F sequence is as shown in SEQ ID NO.3 or as follows:

[0060] CCGGAATTCAAGGGCCGCGGAAAGC;

[0061] The Parasin I-R sequence is as shown in SEQ ID NO.4 or as follows:

[0062] TGCTCTAGAGCACCTTGAAAGTACAAGTTTTCCTTC.

[0063] "Cathelicidin-1" mentioned herein is another antimicrobial peptide discovered by the inventors. The activity of antimicrobial peptide Cathelicidin-1 was simultaneously verified in this application and can be used as a positive control for antimicrobial peptide Parasin I.

[0064] "Yeast" as mentioned herein refers to yeast, which is a eukaryotic cell and has the ability to serve as a heterologous system for recombinant protein expression. The yeast expression system includes two commonly used expression systems, namely the Saccharomyces cerevisiae expression system and the methylotrophic yeast expression system. Among them, the methylotrophic yeast expression system, as the most widely used yeast expression system currently, is most commonly used in the genus Pichia, which can use methanol as a carbon and energy source. In addition, there are also the genus Hansenula, the genus Torulopsis, etc.

[0065] "Pichia pastoris" as mentioned in this application is also called Pichia yeast. As an engineered methylotrophic microorganism, Pichia pastoris can use methanol as the sole carbon source. One of the main benefits of using Pichia pastoris as a protein production host is its ability to secrete a large amount of correctly folded, post-translationally modified, and biologically functional recombinant proteins into the culture medium.

[0066] All currently used Pichia pastoris strains are derived from the original Y-11430 strain, and the differences among the strains are mainly manifested in the differences in genotypes, including wild type, auxotrophy, and protease deficiency.

[0067] GS115 is an improved Pichia pastoris. Different from the Y-11430 strain (wild type) (not used for protein expression), GS115 is the most widely used yeast strain for protein expression. Since the GS115 strain has two alcohol oxidase-encoding genes (AOX1 and AOX2), when methanol is present in the environment, these two genes will be induced to express, synthesizing a large amount of AOX enzyme, so methanol can be utilized.

[0068] Although both AOX1 and AOX2 can express AOX enzyme, AOX1 can produce more AOX enzyme and has a higher translation level. Therefore, when AOX1 is knocked out or silenced, the yeast growth rate will slow down significantly, and this phenotype is the slow methanol utilization type (MutS, such as the Pichia pastoris strain KM71). On the contrary, knocking out AOX2 does not affect the growth of yeast, and the growth rate is comparable to that of the methanol utilization type (Mut+). However, if both genes are knocked out simultaneously, the strain cannot grow in the methanol medium (Mut-). Some Pichia pastoris strains, such as KM7121, MC100-3, and MC101-1, do not detect the AOX gene, and they cannot use methanol as a carbon source and cannot grow in the presence of methanol.

[0069] The "Escherichia coli" mentioned in this article refers to Escherichia coli (E. coli), also known as Escherichia coli, which is a species of the genus Escherichia in the family Enterobacteriaceae and was discovered by the German-Austrian pediatrician Theodor Escherich in 1885. Escherichia coli is a Gram-negative, facultative anaerobic, rod-shaped bacterium of the genus Escherichia coli with blunt ends at both ends, capable of movement, and without spores. It mainly parasitizes in the large intestine of humans and animals. Escherichia coli is a conditional pathogen that can cause gastrointestinal infections or various local tissue and organ infections such as the urinary tract in humans and various animals under certain conditions.

[0070] Researchers have improved Escherichia coli according to experimental needs and obtained various genotypes of Escherichia coli, such as those with basic functions, improved transformation efficiency of ultra-long plasmids, improved plasmid stability in cells, high-speed growth / division, and high-throughput cloning. The competent cells prepared from various Escherichia coli can be used interchangeably and can all be used in this application. Common genotypes of Escherichia coli or Escherichia coli competent cells include: DH5α, deoR, recA, endA, hsdR, supE, gyrA, relA, dam / dcm, mcrA / mcrBC / mrr, recBCD, laclq, DE3, pLysS, lon, ompT, gor, etc. In some embodiments, the Escherichia coli competent cells used in this application are DH5α.

[0071] "DH5α" as mentioned in this article refers to a mutagenized strain of Escherichia coli, which mainly shows a lack of immunity to exogenous DNA. It is a bacterial strain used in genetic engineering and lacks certain immune mechanisms compared to normal bacterial strains. For example, it is sensitive to Ampicillin, Zeocin, Kanamycin, etc. Its predecessor was the Escherichia coli cell line MG1655 isolated from a patient in 1920 and then modified.

[0072] "Competence" as mentioned in this article refers to competent cells, which are cells induced by physical and chemical methods to absorb DNA molecules in the surrounding environment and make them in a physiological state most suitable for taking up and accommodating foreign DNA. The main principle is to make the cell permeability larger through treatment. Intuitively, some pores appear on the cell membrane surface to facilitate the entry of foreign genes or vectors into the competent cells. Due to the fluidity of the cell membrane, these pores will be repaired by the cell itself. In this application, the cells can be Escherichia coli, yeast, etc. Correspondingly, the competent cells can be Escherichia coli competent cells, yeast competent cells, such as Pichia pastoris competent cells. Competent cells can be prepared by oneself or purchased directly.

[0073] "Inoculum size" as mentioned in this article refers to the amount of bacteria inoculated in a unit volume of culture medium. Among them, 0.01 OD / mL means that the optical density (OD) value of the bacteria inoculated in each milliliter of culture medium is 0.01.

[0074] According to an embodiment of the present application, the method for preparing Pichia pastoris competent cells includes:

[0075] ① Randomly pick single colonies from the YPD solid medium activated with Pichia pastoris into the liquid YPD medium, and place them in a constant temperature incubator at 150 rpm and 30 °C for about 24 h.

[0076] ② Pipette 1 mL of the bacterial solution into 100 mL of the liquid YPD medium and culture it under the same culture conditions for 3 - 5 h until the OD 600 is 0.6 - 0.8, and then incubate it on ice for 30 min.

[0077] ③ Divide 100 mL of the bacterial solution evenly into two pre-cooled 50 mL centrifuge tubes, centrifuge at 4000 rpm and 4 °C for 10 min. Discard the bacterial solution, retain the precipitate, add 20 mL of pre-cooled 1 mol / L sorbitol solution, gently pipette to completely dissolve the precipitate, and then centrifuge under the same conditions.

[0078] ④ Repeat step ③, completely discard all the bacterial liquid, add 200 μL of sorbitol solution and 60% glycerol in a 1:1 ratio, then resuspend the cells completely, aliquot into pre-cooled 1.5 mL centrifuge tubes, 60 μL per tube, and thus obtain Pichia pastoris competent cells.

[0079] In experiments or industrial applications, there are many methods to transform DNA into competent cells, such as electroporation, chemical transformation, heat shock transformation, etc. This application does not limit the transformation methods for Escherichia coli competent cells and yeast competent cells.

[0080] In some embodiments, electroporation means that when an electric current passes through the cell, temporary pores will be formed on the cell membrane, and the negatively charged plasmid DNA will be passively moved in this electric potential field, pass through the pores on the cell membrane, and enter the cell.

[0081] In some embodiments, chemical transformation means that after normal Escherichia coli cells are mixed with CaCl2 solution, many Ca 2+ (calcium ions) attach to the cell membrane surface, and the positively charged calcium ions help to guide and assist the negatively charged DNA plasmid to bind to the cell membrane. When the plasmid DNA penetrates the membrane and enters the cell, the positively charged calcium ions also well mask the negative charge of the DNA, making the process through the hydrophobic phospholipid layer easier. The method to make the plasmid enter the cell is a brief heat shock at 42 °C.

[0082] In some embodiments, the heat shock transformation method for Escherichia coli competent cells includes:

[0083] (1) Mix Escherichia coli DH5α competent cells with 3 μL of a specific plasmid solution or ligation product, and pipette to mix well.

[0084] (2) Place the competent cells mixed with the plasmid on a metal bath or water bath that has been preheated to 42 °C in advance, and treat for 40 - 50 s.

[0085] (3) After heat shock transformation, add 1 mL of antibiotic-free LB liquid medium to the 1.5 mL EP tube containing the competent cells, and pipette 2 - 3 times to mix well, then incubate at 37 °C for 1 h.

[0086] (4) Take out the EP tube containing the competent cells, centrifuge at 6000 rpm for 5 min, then discard the supernatant medium, and retain about 100 μL of the medium.

[0087] (5) Pipette the remaining medium repeatedly to resuspend all the bacteria evenly, then use a pipette to transfer the bacterial liquid to a solid LB medium plate containing 25 μg / mL bleomycin, spread evenly, and then incubate in an inverted position in a 37 °C constant temperature incubator for 12 - 18 h.

[0088] It should be noted that, except for the heat shock operation, all other steps of this experiment should be carried out in a laminar flow hood. To ensure the efficiency of heat shock transformation, the step of resuspending the cells after heat shock needs to be carried out rapidly.

[0089] In some embodiments, the method for electrotransformation of Pichia pastoris competent cells includes:

[0090] ① Mix 500 ng of a specific plasmid with Pichia pastoris competent cells, and then incubate on ice for 30 min.

[0091] ② Transfer the competent cells mixed with the plasmid into a pre-chilled electroporation cuvette, wipe off the water mist on the cuvette body, and quickly place it in the electroporator. Set the electroporator mode to "Fungi", press the electroporation button, and then quickly take out the electroporation cuvette and put it back on ice.

[0092] ③ Add 1 mL of antibiotic-free YPD liquid medium to the electroporation cuvette, gently pipette, aspirate all the liquid, and then incubate at 30 °C for 1 h.

[0093] ④ Centrifuge at 4000 rpm for 10 min, discard the supernatant, add 100 μL of YPD liquid medium to resuspend the cells, and then spread them on YPD solid medium containing 100 μg / mL bleomycin. After air-drying, place it in an incubator at 30 °C and culture for 48 h.

[0094] ⑤ Take out the solid medium, randomly pick several single colonies and add them to YPD liquid medium containing 100 μg / mL bleomycin, culture at 150 rpm and 30 °C for 48 h, extract the yeast genome, perform PCR verification, and sequence the PCR products. If the sequencing results are correct, it indicates that the specific plasmid has been transformed into Pichia pastoris.

[0095] The YPD liquid medium mentioned in this article is a medium containing 1% Yeast Extract, 2% Peptone, and 2% Dextrose (glucose).

[0096] The YPD solid medium mentioned in this article is a medium containing 1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose), and 2% agar powder.

[0097] The LB liquid medium mentioned in this article is prepared by adding 1.2 g of agar according to the ratio of containing 0.5 g of yeast extract, 1 g of NaCl, and 1 g of peptone in every 100 mL.

[0098] The LB solid medium mentioned in this article is prepared in a proportion of containing 0.5 g of yeast extract, 1 g of NaCl and 1 g of peptone per 100 mL.

[0099] The agarose gel mentioned in this article is about 1% agarose gel. The preparation method is to weigh 0.2 g of agarose using a weighing balance, add 20 mL of 0.5× (or 1×) TAE buffer solution to dissolve it, then heat it using an electric furnace to dissolve the agarose, and let it stand and cool for later use.

[0100] The Pichia pastoris GS115 and Escherichia coli DH5α mentioned in this article are bacteria self-preserved in the laboratory, and can also be directly purchased from the market.

[0101] The Aeromonas veronii, pathogenic Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii, Pseudomonas aeruginosa, etc. mentioned in this article are all common foodborne pathogenic bacteria. Some of these bacteria can cause diseases in humans, livestock and fish, and currently antibiotics are usually used for treatment. Of course, those skilled in the art should understand that there are far more pathogenic bacteria encountered in life than this. From the experimental data of this application, it can also be known that the antimicrobial peptide Parasin I of this application can inhibit or kill far more pathogenic bacteria than those listed. Therefore, the several pathogenic bacteria listed should not limit the scope of use of the antimicrobial peptide of this application.

[0102] Among them, foodborne pathogenic bacteria refer to a large group of bacteria that can cause diseases in humans with food as a carrier. These bacteria may directly or indirectly contaminate food and water sources, and after human oral infection, they may cause the prevalence of intestinal infectious diseases, food poisoning and livestock and poultry infectious diseases. In addition to those listed above, common foodborne pathogenic bacteria also include: Staphylococcus aureus, Cronobacter sakazakii, Shigella, etc.

[0103] Aeromonas veronii can infect aquatic animals including fish, causing symptoms such as skin ulcers, organ bleeding and severe ascites. For humans, it can cause gastroenteritis, peritonitis, sepsis and wound infections, etc., especially threatening the elderly, children and people with low immunity. Aeromonas veronii has strong pathogenicity and is mainly transmitted through water bodies, food and other channels. After infection, it can cause acute or chronic symptoms, and even lead to death in severe cases.

[0104] Pathogenic Escherichia coli (Escherichia coli, E. coli) is a common intestinal pathogen, initially considered to be a component of the normal intestinal flora. However, certain special serotypes of Escherichia coli are pathogenic to humans and animals, especially infants and young livestock. Pathogenic Escherichia coli is transmitted through contaminated drinking water, food and other channels, and its pathogenic substances include endotoxin, capsule, adhesin and exotoxin, etc., which can damage the intestinal mucosa and cause infection.

[0105] Vibrio parahaemolyticus is a Gram-negative bacterium belonging to the genus Vibrio. It is a halophilic bacterium widely present in seawater and is a common foodborne pathogen. The pathogenic substances of Vibrio parahaemolyticus mainly include thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH), which have hemolytic activity, enterotoxin, and lethal effects.

[0106] Salmonella is a common foodborne pathogen widely present in nature. It can cause various forms of salmonellosis, posing a threat to human and animal health. After Salmonella infection, symptoms such as diarrhea, fever, and abdominal colic may occur. In severe cases, complications such as septicemia and meningitis may result. Salmonella is mainly transmitted through contaminated food, water sources, etc. The feces of infected individuals can also become a source of infection.

[0107] Vibrio alginolyticus is a microorganism of the genus Vibrio, widely distributed in the natural environment. It is a Gram-negative bacterium with aerobic properties. Vibrio alginolyticus plays an important role in microbial classification and research. However, its pathogenicity is relatively low and usually does not directly cause human diseases.

[0108] Aeromonas schubertii is a pathogenic bacterium that causes fish diseases, especially with a relatively high incidence and lethality in snakehead fish (raw fish). Fish infected with Aeromonas schubertii will show symptoms such as body surface bleeding, swollen anus, and dark red gill filaments. In severe cases, a large number of white spots will appear on the liver and kidneys, the gallbladder will be enlarged, and the intestine will be empty. For the prevention and treatment of Aeromonas schubertii disease, measures mainly include reasonable feeding, regular disinfection, and timely treatment. By improving the aquaculture environment and management level, the incidence and mortality of this disease can be effectively reduced.

[0109] The zebrafish mentioned in this application was purchased from the Wenbifeng Aquaculture Base of Hainan Baolu Aquatic Science and Technology Co., Ltd., and its weight is about 0.3 g.

[0110] In some embodiments, the antibiotics involved in this application, such as ampicillin, bleomycin, and kanamycin, were all purchased from the Solarbio brand. The reagents for preparing the culture medium, such as yeast extract and peptone, were purchased from the Oxoid brand. Agar powder, etc. were purchased from the Biosharp brand. Other reagents, such as sorbitol, glucose, sodium chloride, sodium hydroxide, hydrochloric acid, isoamyl alcohol, trichloroacetic acid, absolute ethanol, etc. were purchased from Xilong Scientific.

[0111] In some embodiments, the enzymes and kits involved in the present application, namely Fast T4 DNA Ligase / Buffers, are produced by Monad; Restriction enzymes and / buffers are produced by NEB; 2×Phanta Max Master Mix, 2×Rapid Taq Master Mix, FastPure Gel DNA Extraction Mini Kit, and FastPure PlasmidMini Kit are produced by Vazyme; the fish lysozyme (LZM) ELISA kit is produced by Jiangsu Enzyme Label Bio Co., Ltd.; the Fish IgM ELISA KIT is produced by Shanghai Yuanju Biotechnology Center; the superoxide dismutase (SOD) test kit and alkaline phosphatase (AKP / ALP) test kit are produced by Suzhou Keming Biotechnology Co., Ltd.

[0112] As mentioned herein, SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) is a commonly used technique for separating proteins and polypeptides in a sample based on their molecular weight. SDS (sodium dodecyl sulfate) binds non-covalently to proteins, denaturing them and imparting a negative charge, thereby eliminating the original charge differences of the proteins and making their migration rate depend only on the molecular weight of the proteins.

[0113] As mentioned herein, the TCA (trichloroacetic acid) method refers to a commonly used chemical treatment method mainly used to remove proteins from samples and is often used in the pretreatment of biological samples, especially in the detection of activated sludge and metabolite analysis.

[0114] As mentioned herein, the "response surface method" is a method that uses a polynomial function to approximate an implicit limit state function through a series of deterministic experiments. Specifically, in the present application, it is used to optimize the relationship between multiple variables and responses in biological experiments through the combination of statistical methods and mathematical methods. Through reasonable experimental design and statistical analysis, the response surface method can establish a mathematical model to describe the functional relationship between factors and responses, thereby assisting in identifying and optimizing the settings of influencing factors to achieve the best experimental results.

[0115] Its principle is: by reasonably selecting experimental points and iteration strategies to ensure that the polynomial function can converge to the failure probability of the true implicit limit state function in terms of the failure probability. When the true limit state function has a low degree of non-linearity, the linear response surface has a high approximation accuracy.

[0116] This application relates to a method for preparing Parasin I protein or Parasin I fermentation broth, including: obtaining a yeast strain capable of secreting Parasin I protein; inoculating the yeast strain into a specific liquid medium; and fermenting the yeast strain to obtain Parasin I fermentation broth; the fermentation broth contains Parasin I protein; wherein, the pH of the specific medium is 6-9, the inoculation amount of the yeast strain in the specific medium is 0.005-0.015 OD / mL, and the temperature for fermenting the yeast is 28-33 °C.

[0117] In some embodiments, the pH of the specific medium is 7-8, preferably, the pH of the specific medium is 7.9.

[0118] In some embodiments, the inoculation amount of the yeast strain in the specific medium is preferably 0.005-0.009 OD / mL, preferably 0.005-0.007 OD / mL, and more preferably 0.006 OD / mL.

[0119] In some embodiments, the temperature for fermenting the yeast is preferably 27-33 °C, more preferably 28-32 °C, further preferably 29-32 °C, further preferably 30-32 °C, further preferably 31-32 °C, and even more preferably 31.3 °C.

[0120] In some embodiments, the fermentation time of the yeast is 1-7 days; preferably 2-6 days; more preferably 3-4 days; and further preferably 3 days.

[0121] This application relates to a method for activating and / or enhancing the immune system of fish, including: administering a certain amount of Parasin I protein or Parasin I fermentation broth obtained by any of the above preparation methods to the fish.

[0122] This application relates to a method for preventing and / or treating pathogen infections in fish, including: administering a certain amount of Parasin I protein or Parasin I fermentation broth obtained by any of the above preparation methods to the fish.

[0123] In some embodiments, the pathogen is Aeromonas veronii, Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii or Pseudomonas aeruginosa.

[0124] This application relates to a fish feed additive, comprising Parasin I protein or Parasin I fermentation broth prepared by the above preparation method; wherein the amino acid sequence of the Parasin I protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added or subtracted at the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or converted on the amino acid sequence shown in SEQ ID NO.1.

[0125] In this application, a recombinant Pichia pastoris strain capable of excreting the antimicrobial peptide Parasin I can be obtained through genetic engineering editing. Subsequently, the antibacterial activity of the yeast fermentation broth containing the antimicrobial peptide is detected, and the antibacterial spectrum of the antimicrobial peptide fermentation broth is drawn. After determining its antibacterial effect, the fermentation conditions of the recombinant strain are optimized through response surface optimization experiments in order to obtain the best antibacterial effect. Then, through in-vivo experiments on zebrafish, a series of indicators such as immune-related enzyme activities are measured to identify the feasibility of its use as an antibacterial additive for fish feed. Finally, the antibacterial mechanism of the Parasin I fermentation broth of the antimicrobial peptide is preliminarily explored by PI staining combined with fluorescence observation and transmission electron microscopy observation of cell morphology. This application provides a reference for the development of new feed antibacterial additives.

[0126] The technical solution of this application will be described in detail below through specific examples. Those skilled in the art should understand that the following description is only exemplary and does not limit the technical solution of this application.

[0127] Example 1 Construction of recombinant yeast strain and expression of antimicrobial peptide

[0128] 1. Amplification of target gene

[0129] First, the full-length sequence of the gene Parasin I is obtained by gene synthesis. Among them, the full-length sequence of Parasin I is shown in SEQ ID NO.2.

[0130] Subsequently, corresponding restriction enzyme sites are introduced at the 5' and 3' ends of the target gene Parasin I by PCR amplification. Among them, the 5' primer is shown in SEQ ID NO.3, and the 3' primer is shown in SEQ ID NO.4. The PCR product is separated by agarose gel electrophoresis, and it can be seen that there is a band corresponding to the full length of Parasin I at about 100bp, indicating that the Parasin I gene amplification is successful. Figure 1 It can be seen that there is a band corresponding to the full length of Parasin I at about 100bp, indicating that the Parasin I gene amplification is successful.

[0131] 2. Construction of recombinant vector

[0132] To facilitate the detection of the antimicrobial peptide expressed in Pichia pastoris (P. pastoris), pGAPZαA was selected as the vector. As shown in Figure 2 A, the protein expressed by it has an α-factor secretion signal peptide of Saccharomyces cerevisiae at the N-terminus, enabling the expressed antimicrobial peptide to be secreted into the fermentation broth. The GAP promoter of pGAPZαA is a constitutive promoter, different from the AOX promoter that requires methanol induction for expression. It can express foreign proteins without adding harmful inducers, ensuring the biosafety of the fermentation broth.

[0133] First, the pGAPZαA empty vector was double-digested with the restriction endonucleases XbaⅠ and EcoRⅠ, and the digested plasmid was purified and recovered. As shown in Figure 3 , the migration speed of the digested plasmid (lane 2) was lower than that of the undigested plasmid (lane 1), indicating that the vector had been successfully digested. Then, the target gene was also double-digested with the same endonucleases, and the digested product was purified and recovered. Subsequently, the digested plasmid and the digested target gene were ligated separately by ligase to construct the secretory expression vector pGAPZαA-Parasin I (as shown in Figure 2 B).

[0134] 3. Amplification of the recombinant plasmid

[0135] The obtained recombinant vectors were separately heat-shock transformed into E. coli DH5α competent cells. Positive clones were screened by resistance, and single colonies on the resistance plate were randomly selected for colony PCR verification. The electrophoresis results showed that the positive clones of the antimicrobial peptide ParasinI could amplify a band of approximately 100 bp (as shown in Figure 4 lanes 3-9), which was consistent with the size of the Parasin I gene, proving that the recombinant plasmid was successfully constructed and had been amplified in E. coli.

[0136] 4. Construction of recombinant yeast strains

[0137] In this example, the secretory expression vector pGAPZαA-Parasin I and the empty vector pGAPZαA were separately transformed into Pichia pastoris. Among them, the transformation method is not limited to the technical solution of this application. In this example, the expression vectors were separately introduced into Pichia pastoris by electroporation.

[0138] In Pichia pastoris, the two vectors will integrate into the yeast chromosome and replicate along with the replication of the yeast chromosome. Therefore, the recombinant strain has high genetic stability. However, when the circular plasmid integrates into the chromosome, it will break at random positions. Therefore, the circular recombinant plasmid needs to be linearized before transformation.

[0139] The recombinant vector was linearized using the restriction endonuclease BamH I, and then the linearized product was purified and recovered. Those skilled in the art should understand that the use of BamH I here is only an exemplary experimental method, rather than a limitation on the technical solution of this application, the method of linearizing the expression vector, and the specific restriction endonuclease.

[0140] The linearized recombinant vector was electrotransformed into P. pastoris GS115 competent cells respectively to obtain a control strain transformed with the empty vector pGAPZαA and a recombinant strain of Parasin I.

[0141] Through the resistance YPD solid medium containing 50 mg·L -1 bleomycin, positive clones of Parasin I recombinant strains were screened. Candidate positive clone colonies were picked and transferred to 5 mL of YPD liquid medium containing 50 mg·L -1 bleomycin and cultured for 24 h. The genomic DNA was extracted using a yeast genomic DNA extraction kit for PCR verification. The PCR results showed that using the extracted genomic DNA as a template, the genomic DNA of the recombinant strain of the antimicrobial peptide gene Parasin I could amplify a target product of approximately 500 bp (as Figure 5 shown).

[0142] The PCR product was purified and recovered and sent to Hainan Nanshan Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the nucleotide sequence of the amplified band was completely consistent with the nucleotide sequence of the target band, and there were no point mutations such as base substitutions in the coding region from the start codon to the stop codon, indicating that the recombinant vector had been integrated into the yeast genome (as Figure 6 A- Figure 6 B shown).

[0143] 5. Exogenous verification of exocrine antimicrobial peptides

[0144] The recombinant yeast was transferred to YPD medium for fermentation for 72 h. The fermentation broth was collected by centrifugation and concentrated by the TCA method. First, the overall protein expression in the secretion supernatant was detected by SDS-PAGE gel electrophoresis, and then the expression of the exocrine target antimicrobial peptide was detected by Western Blot. After the gel was stained with Coomassie Brilliant Blue, it was observed.

[0145] According to an embodiment of this application, the method for SDS-Page analysis includes: using the strain with successful sequencing at 0.015 OD 600Inoculate into YPD liquid medium at an initial concentration of / mL respectively, culture at 30 °C and 180 rpm for 48 h. Centrifuge at 5000 rpm for 10 min, filter the obtained fermentation broth through a 0.22 μm filter membrane, then concentrate the protein by the TCA method, and dissolve it with 20 μL of protein loading buffer. Prepare a 15%

[0146] SDS-Page gel, add samples into the loading wells in turn, perform electrophoresis at a constant voltage of 200 V for 40 min, put it into Coomassie Brilliant Blue staining solution and treat for 4 h, then put it into the decolorizing solution and decolorize for 12 h.

[0147] From Figure 7 it can be seen that compared with the recombinant strain transformed with the empty plasmid, there is an obvious protein enrichment band in the fermentation broth of the recombinant strain expressing the antimicrobial peptide at about 9 kDa, which is close to the expected size of the target antimicrobial peptide. Western Blot detection with an anti-His antibody shows that the antimicrobial peptide Parasin I is successfully expressed in the form of extracellular secretion ( Figure 8 ).

[0148] Example 2 Determination of the antibacterial activity of the Parasin I-Pichia pastoris fermentation broth

[0149] 1. Determination of the antibacterial spectrum

[0150] Using 0.3 g / mL commercial antimicrobial peptide cecropin as the positive control and the fermentation broth of the recombinant strain with the empty vector as the negative control, compare the antibacterial effects of each fermentation broth by the antibacterial zone determination method.

[0151] In some embodiments, the antibacterial zone determination method includes: inoculating the activated single colonies of different pathogenic bacteria into LB liquid medium at an initial concentration of 0.02 OD 600 / mL respectively, culturing at 37 °C and 150 rpm, spreading the initial bacterial amount of 5×10 6 CFU / mL on the plate, then placing the Oxford cup on the plate, setting three biological replicates, culturing upright for 12 h, and measuring the diameter of the antibacterial zone using a vernier caliper.

[0152] As can be seen from Table 1 below, for Vibrio alginolyticus and Pseudomonas aeruginosa, there is no significant difference in the inhibitory effects between the Parasin I antimicrobial peptide fermentation broth and cecropin; for Aeromonas veronii and Aeromonas schubertii, the antimicrobial peptide Parasin I shows better antibacterial effects than cecropin; for Escherichia coli, Vibrio parahaemolyticus and Salmonella, cecropin has the best antibacterial effect, which is better than the antimicrobial peptide Parasin I. Table 1 shows the antibacterial zone diameters of the Parasin I antimicrobial peptide fermentation broth against various indicator bacteria.

[0153] Table 1 Antibacterial spectrum table

[0154]

[0155]

[0156] Note: Through Tukey's test, the same letter in the same row indicates no significant difference (P>0.05).

[0157] In this example, it is found that it has the best inhibitory effect on Aeromonas veronii. Therefore, Aeromonas veronii is selected as the indicator bacterium for the subsequent experiments of this application.

[0158] 2. Determine the optimal fermentation time of the Parasin I-Pichia pastoris recombinant strain

[0159] In this example, the extracellular protein content at different fermentation times was determined by the BCA method, and the antibacterial effect of the fermentation broth on Aeromonas veronii was determined by the antibacterial circle method. From Figure 9 it can be seen that the extracellular protein content of the antibacterial peptide Parasin I recombinant strain is higher than that of the empty vector recombinant strain from the 2nd day to the 4.5th day, and the content is the highest on the 3rd day. From Figure 10 it can be seen that the antibacterial activity of the fermentation broth of the antibacterial peptide Parasin I recombinant strain also reaches the highest on the 3rd day. Therefore, the optimal fermentation time of the antibacterial peptide Parasin I recombinant strain is 3 days.

[0160] 3. Determine the antibacterial curve of the fermentation broth

[0161] In this example, different pathogenic bacteria at 10 7 CFU / ml were first added to a 96-well microplate, and then 50, 100, 150, and 200 μL of the Parasin I fermentation broth fermented for 3 days were added respectively, and then supplemented with LB liquid medium to 200 μL to make the volume fractions of the fermentation broth 25%, 50%, 75%, and 100% respectively. The fermentation broth of the empty vector recombinant strain with the same volume fraction was used as a control, cultured at 30 °C and 150 rpm. Three biological replicates were set for each sample, and the OD 600 was recorded every 3 h, observed for 24 h, and the antibacterial curve was drawn. When the OD 600 value increases, it indicates that the pathogenic bacteria are not completely inhibited and are still replicating and proliferating.

[0162] (1) Aeromonas veronii

[0163] From Figure 11 it can be seen that the antibacterial peptide Parasin I fermentation broth has a relatively significant inhibitory effect on the growth of Aeromonas veronii. As the volume fraction of the fermentation broth increases, the number of cells reaching the stationary phase of the bacteria also continuously decreases. When added at 100%, the growth of the bacteria can be completely inhibited.

[0164] (2) Pseudomonas aeruginosa

[0165] As can be seen from Figure 12 , compared with the blank fermentation broth, the addition of 25% antibacterial peptide ParasinⅠ fermentation broth does not inhibit the growth of Pseudomonas aeruginosa. With the increase of the volume fraction of the fermentation broth, the inhibitory effect exhibited by the antibacterial peptide fermentation broth gradually enhances. When the addition is 100%, the bacterial growth can be completely inhibited.

[0166] (3) Vibrio parahaemolyticus

[0167] As can be seen from Figure 13 , compared with the blank fermentation broth, the addition of 25% and 50% antibacterial peptide ParasinⅠ fermentation broth does not inhibit the growth of Vibrio parahaemolyticus. With the increase of the volume fraction of the fermentation broth, the inhibitory effect exhibited by the antibacterial peptide ParasinⅠ fermentation broth gradually enhances. When the addition is 100%, the bacterial growth can be completely inhibited.

[0168] (4) Pathogenic Escherichia coli

[0169] As can be seen from Figure 14 , compared with the blank fermentation broth, the addition of 25% antibacterial peptide ParasinⅠ fermentation broth does not inhibit the growth of pathogenic Escherichia coli. With the increase of the volume fraction of the fermentation broth, the inhibitory effect exhibited by the antibacterial peptide ParasinⅠ fermentation broth gradually enhances. When the addition is 100%, the bacterial growth can be completely inhibited.

[0170] (5) Vibrio alginolyticus

[0171] As can be seen from Figure 15 , compared with the blank fermentation broth, the addition of 25% and 50% antibacterial peptide ParasinⅠ fermentation broth does not inhibit the growth of Vibrio alginolyticus. With the increase of the volume fraction of the fermentation broth, the inhibitory effect exhibited by the antibacterial peptide ParasinⅠ fermentation broth gradually enhances. When the addition is 100%, the bacterial growth can be completely inhibited.

[0172] (6) Aeromonas schubertii

[0173] As can be seen from Figure 16 , compared with the blank fermentation broth, the addition of 25% and 50% antibacterial peptide ParasinⅠ fermentation broth does not inhibit the growth of Vibrio alginolyticus. With the increase of the volume fraction of the fermentation broth, the inhibitory effect exhibited by the antibacterial peptide ParasinⅠ fermentation broth gradually enhances. When the addition is 100%, the bacterial growth can be completely inhibited.

[0174] (7) Salmonella

[0175] As can be seen from Figure 17It can be seen that compared with the fermentation broth without load, the addition of 25% and 50% antibacterial peptide Parasin Ⅰ fermentation broth does not inhibit the growth of Vibrio alginolyticus. As the volume fraction of the fermentation broth increases, the inhibitory effect shown by the antibacterial peptide Parasin Ⅰ fermentation broth gradually enhances. When the addition is 100%, the bacterial growth can be completely inhibited.

[0176] 4. Determine the bactericidal curve of the fermentation broth

[0177] In this example, first mix 10 7 CFU / ml of Aeromonas veronii with the antibacterial peptide Parasin I fermentation broth and other auxiliary solutions, take samples for plate counting at 1, 2, 4, 8, and 16 h respectively, and finally draw the bactericidal curve.

[0178] It can be seen from Figure 18 that the antibacterial peptide Parasin Ⅰ fermentation broth has a better bactericidal effect on Aeromonas veronii compared with cecropin, and the fermentation broth of the recombinant strain with empty vector has no bactericidal effect.

[0179] Example 3 Optimization experiment by response surface methodology

[0180] 1. Optimize the fermentation conditions of the recombinant strain of antibacterial peptide Parasin I by response surface methodology

[0181] In this example, the effects of inoculum size, pH, and temperature on the antibacterial activity of the fermentation broth of the recombinant strain of antibacterial peptide Parasin I were investigated, and the obtained data were analyzed using software to obtain the following relationship model:

[0182] Y = 15.57 - 1.47X1 + 0.49X2 + 0.28X3 - 0.13X1X2 - 0.36X1X3 + 0.39X2X3 - 0.06X1 2 - 1.32X2 2 - 1.56X3 2 .

[0183] Among them, Y represents the diameter of the antibacterial circle of the fermentation broth against Aeromonas veronii; X1 represents the inoculum size, X2 represents the pH, and X3 represents the temperature.

[0184] Table 2 Box - Behnken variance analysis

[0185]

[0186]

[0187] *: P < 0.05; **: P < 0.01; NS: Lack of fit term (Not significant); R 2 = 0.96364, AdjR 2= 0.9168,

[0188] PredR 2 = 0.5457, C.V.% = 3.27, Adeq Precisior = 11.781.

[0189] As can be seen from Table 2, the P value of the lack-of-fit term > 0.05, which is not significant, indicating that the experimental error is small; the CV value is 3.27% < 10%, indicating that the model can predict the response value well. The results of variance analysis show that the first-order term of the inoculation amount, the second-order term of pH, and the second-order term of temperature have extremely significant effects on the antibacterial activity of the fermentation broth of antibacterial peptide Parasin Ⅰ (P < 0.01); the first-order term of pH has a significant effect on the antibacterial activity of the fermentation broth of antibacterial peptide Parasin Ⅰ (P < 0.05); other factors have no significant effect on the antibacterial activity of the fermentation broth.

[0190] From Figure 19 A, Figure 19 B, it can be seen that when pH and temperature are constant, as the inoculation amount increases, the antibacterial activity gradually decreases, and there is a maximum value at an inoculation amount of about 0.005 OD / mL; combining A and C, when temperature and inoculation amount are constant, as pH increases, the antibacterial activity shows a trend of first increasing and then decreasing, and when pH is about 7.9, the diameter of the antibacterial circle reaches the maximum value; finally, from B and C, it can be seen that when pH and inoculation amount are constant, the antibacterial activity also shows a trend of first increasing and then decreasing with the increase of temperature, indicating that when the temperature is about 27 - 33 °C, preferably 28 - 32 °C, more preferably 29 - 32 °C, more preferably 30 - 31 °C, and further preferably 31.3 °C, the antibacterial activity of the fermentation broth is the largest when culturing the strain.

[0191] 2. Verification of the response surface optimization results

[0192] In some embodiments, the process of optimizing the fermentation conditions by the response surface method includes: based on the Box - Behnken Design response surface method, the key factors that may affect the antibacterial activity of the fermentation broth: inoculation amount, temperature, pH. The inoculation amounts are 0.006 OD / mL, 0.005 OD / mL, 0.01 OD / mL, 0.015 OD / mL respectively, the temperatures are 25 °C, 30 °C, 31.3 °C, 35 °C respectively, and the pH is 5, 7, 7.9, 9. Multiple groups of experiments are generated according to the Box - Behnken method. The strain is cultured for 72 h under different culture conditions, then centrifuged to collect the supernatant fermentation broth and filtered through a membrane, and the obtained fermentation broth is subjected to an antibacterial circle experiment.

[0193] According to the optimization results of the response surface method, the antibacterial peptide Parasin Ⅰ fermentation broth showed the best antibacterial activity when the initial inoculum concentration was 0.006 OD / mL, pH = 7.9, and temperature was 31.3 °C. The optimal diameter of the antibacterial zone was 16.79 mm. After experimental verification, the diameter of the antibacterial zone was 16.69 mm (as Figure 20 shown), and the coincidence rate was 99.4%. Secondly, through SDS-PAGE, the concentration changes of the corresponding protein bands were observed (as Figure 21 shown), and Image J was used for gray-scale analysis. It was found that the expression level of antibacterial peptide Parasin Ⅰ increased significantly after optimized culture.

[0194] Example 4 Potential Application of Antibacterial Peptide Fermentation Broth as an Antibacterial Feed Additive

[0195] In this example, the potential application value of the antibacterial peptide fermentation broth as an antibacterial feed additive was explored through the following experiments.

[0196] First, the stability of the antibacterial activity of the antibacterial peptide fermentation broth in the gastric juice environment, that is, in the presence of low pH and protease, was verified.

[0197] In some embodiments, the method for treating the fermentation broth under simulated gastric juice conditions includes: inoculating the recombinant yeast strain into YPD liquid medium at an initial concentration of 0.015 OD 600 / mL, culturing at 30 °C and 180 rpm for 48 h. Centrifuge at 5000 rpm for 10 min, filter the obtained fermentation broth through a 0.22 μm filter membrane, transfer it to a 500 mL beaker, measure and record the initial pH value, then slowly add hydrochloric acid while stirring until the pH = 2, and then add pepsin at a mass fraction of 1 g / L and treat for 3 h. Use 1 mol / L NaOH solution to adjust the pH back to the initial value for subsequent experiments.

[0198] As can be seen from Figure 22 , in the simulated gastric juice environment, after treatment, the antibacterial activity of the antibacterial peptide Parasin I fermentation broth decreased extremely significantly, and the stability was 50%.

[0199] Secondly, through the zebrafish challenge protection experiment, the promoting effect of the antibacterial peptide fermentation broth as a potential antibacterial additive on enhancing the resistance of zebrafish to Aeromonas veronii infection was determined. When the antibacterial peptide fermentation broth was added or not added to the conventional feed of zebrafish, on the one hand, the mortality rates of zebrafish after being infected with Aeromonas veronii were compared.

[0200] In some embodiments, the experiment of infecting zebrafish with bacteria and detecting the immune enzyme activity of zebrafish after infection includes: selecting zebrafish with similar body sizes and dividing them into four groups, with 20 zebrafish in each group, namely the blank control group, the blank plasmid fermentation broth group, the antibacterial peptide I fermentation broth group, and the antibacterial peptide II fermentation broth group. The blank control group is fed with feed without any treatment, and the other three groups are fed with a mixed feed in which the fermentation broth and the feed are mixed at a ratio of 1:1 for 14 days. Subsequently, a single colony of wild-type Aeromonas veronii is picked and inoculated into LB liquid medium, cultured at 30 °C and 150 rpm for 12 h, and after calculating and collecting the bacterial cells according to 1 OD 600 the bacterial liquid contains 2×10 8 CFU, and after configuring it into a bacterial liquid of 2×10 7 CFU / mL, it is resuspended with sterilized 0.9% normal saline to configure an injection solution with a concentration of 5×10 7 CFU / mL, and the zebrafish are subjected to intraperitoneal injection infection experiment according to the injection amount of 10 μL / g body weight.

[0201] The zebrafish at 1 d, 3 d, 5 d, and 7 d after infection are homogenized using a homogenizer, and the enzyme activity is detected according to the instructions of the superoxide dismutase (SOD) test kit (Suzhou Keming Biotechnology Co., Ltd.) and the alkaline phosphatase (AKP / ALP) test kit (Suzhou Keming Biotechnology Co., Ltd.).

[0202] In some embodiments, the method for measuring the immune protection rate of the fermentation broth against zebrafish includes: when the zebrafish are cultured to about 0.3 g, they are grouped according to 20 in each group, namely the blank control group, the blank plasmid fermentation broth group, the antibacterial peptide I fermentation broth group, and the antibacterial peptide II fermentation broth group. The blank control group is fed with feed without any treatment, and the other three groups are fed with a mixed feed in which the fermentation broth and the feed are mixed at a ratio of 1:1 for 14 days. A single colony of wild-type Aeromonas veronii is picked and inoculated into liquid LB medium, cultured at 30 °C and 150 rpm for 12 h, and after calculating and collecting the bacterial cells according to 1 OD 600 the bacterial liquid contains 2×10 8 CFU, and after configuring it into a bacterial liquid of 2×10 7 CFU / mL, it is resuspended with sterilized 0.9% normal saline to configure an injection solution with a concentration of 5×10 7 CFU / mL, and the zebrafish are subjected to intraperitoneal injection infection experiment according to the injection amount of 10 μL / g body weight. Observe for 7 days, record the number of dead zebrafish in each group every day, and calculate the cumulative mortality rate.

[0203] It can be seen from Figure 23 that there is no obvious difference in the protection rate between the treatment group with the addition of the empty vector fermentation broth and the blank control group without any treatment; while the treatment group with the fermentation broth of the antibacterial peptide ParasinⅠ mixed in the feed can effectively improve the survival rate of zebrafish, and the survival rate reaches 90%.

[0204] On the other hand, comparing the immune responses of zebrafish after being infected with Aeromonas veronii, as can be seen from Figure 24 A, one day after the challenge, the SOD enzyme activity in the treatment group with the fermentation broth of antibacterial peptide ParasinⅠ was significantly higher than that in the treatment group with the empty vector fermentation broth and the blank control group, while there was no significant difference at the subsequent time points; as can be seen from Figure 24 B, the AKP / ALP enzyme activity was significantly increased on the 5th day by the fermentation broth of antibacterial peptide ParasinⅠ, indicating that the addition of the fermentation broth of antibacterial peptide could enhance the expression of SOD and AKP / ALP in zebrafish when facing pathogen invasion to promote the killing of pathogens.

[0205] As can be seen from Figure 25 , on the 1st and 7th days after the challenge, the lysozyme enzyme activity in the treatment group with the fermentation broth of antibacterial peptide Parasin I was higher than that in the treatment group with the empty vector fermentation broth and the blank control group, indicating that feeding the feed mixed with the fermentation broth of antibacterial peptide would accelerate the response of fish to pathogen infection.

[0206] In some embodiments, the method for detecting the IgM content of zebrafish includes: using a fish immunoglobulin M (IgM) enzyme-linked immunosorbent assay (ELISA) kit for determination. The specific operation steps refer to the instruction manual.

[0207] As can be seen from Figure 26 , on the 1st, 3rd, 5th, and 7th days after the challenge, the IgM in the treatment group with the fermentation broth of antibacterial peptide ParasinⅠ was significantly higher than that in the treatment group with the empty vector fermentation broth and the blank control group, indicating that after the challenge, adding the fermentation broth of antibacterial peptide to the feed would increase the response intensity of the innate immunity of fish, better play the role of clearing pathogens, and ultimately improve the survival rate of fish. Generally speaking, adding the fermentation broth of antibacterial peptide Parasin I to the feed may activate the immune system of fish, respond to pathogens faster when facing pathogen infection, and reduce the harm of pathogens to fish.

[0208] In summary, the fermentation broth of antibacterial peptide has great potential as an antibacterial feed additive.

[0209] Example 5 Bacteriostatic Mechanism of Fermentation Broth

[0210] 1. Destruction of Cell Membrane by Fermentation Broth

[0211] In this example, combined with the current research progress on antibacterial peptides, the bacteriostatic mechanism of the fermentation broth containing antibacterial peptide Parasin I was preliminarily explored, mainly divided into the following two aspects: on the one hand, it targets the cell membrane of the target pathogen, causing defects, and then leading to the leakage of cytoplasm, resulting in cell death; on the other hand, it acts on the biofilm of the pathogen, making it easier to be killed.

[0212] First, the cell membrane of Aeromonas veronii treated with the fermentation broth of antibacterial peptide Parasin I was preliminarily detected by PI staining to determine the possibility of cell membrane damage. PI dye will penetrate the damaged cell membrane and bind to deoxynucleotides, emitting red light under the excitation light. However, if the cell membrane is intact, the PI dye cannot enter the cell to bind to deoxynucleotides and thus cannot emit light.

[0213] In some embodiments, the method for observing cell membrane damage by PI staining includes: picking a single colony of wild-type Aeromonas veronii into LB liquid medium and culturing it at 30 °C and 150 rpm for 12 h. Transfer 10^8 bacteria into a 1.5 mL EP tube, centrifuge at 6000 rpm for 10 min, discard the supernatant, add different fermentation broths and treat for 1 h. Then, centrifuge at 6000 rpm for 10 min again, discard the supernatant, add 1 mL of 10 μg / mL PI dye, stain for 30 min, add 1 mL of sterile water to wash and resuspend, centrifuge at 6000 rpm for 10 min, add 1 mL of sterile water to wash and resuspend again. Take 20 μL and drop it onto a glass slide, place a coverslip, and observe using a fluorescence microscope.

[0214] It can be seen from Figure 27 that Aeromonas veronii treated with the fermentation broth of the empty plasmid recombinant strain was rarely stained by PI, indicating that the cell membrane of the bacteria was basically intact; while the bacteria treated with the fermentation broth of antibacterial peptide Parasin I showed cell membrane damage, and the extracellular structure of the bacteria was also damaged. It was also possible to observe cytoplasmic leakage. Based on the above experimental results, it shows that the fermentation broth of antibacterial peptide Parasin I did cause damage to the cell membrane of Aeromonas veronii.

[0215] To further clarify the damage of the antibacterial peptide fermentation broth to the cell membrane of Aeromonas veronii, the cell morphology of Aeromonas veronii treated with the fermentation broth of antibacterial peptide Parasin I was observed by TEM.

[0216] In some embodiments, the method for observing cell membrane damage by TEM includes: picking a single colony of wild-type Aeromonas veronii into liquid LB medium and culturing it at 30 °C and 150 rpm for 12 h. Transfer 10^8 bacteria into a 1.5 mL EP tube, then centrifuge at 6000 rpm for 10 min, discard the supernatant, add different fermentation broths and treat for 1 h. Then, centrifuge at 6000 rpm for 10 min again, discard the supernatant, add 1 mL of sterile water to wash and resuspend, centrifuge at 6000 rpm for 10 min, add 1 mL of sterile water to wash and resuspend again. Take 10 μL from it using a pipette and drop it onto a copper foil, let it air dry naturally, and load for observation.

[0217] It can be seen from Figure 28As can be seen in the results, the cell membrane of Aeromonas vermiformis treated with the fermentation broth of the empty vector recombinant strain was intact, and the flagella were clearly visible. However, the cell membrane of Aeromonas vermiformis treated with the fermentation broth of the antimicrobial peptide Parasin I was significantly damaged, and the bacterial extracellular structure was also destroyed. Taken together, these experimental results indicate that the fermentation broth of the antimicrobial peptide Parasin I does damage the cell membrane of Aeromonas vermiformis.

[0218] 2. Effect of fermentation broth on biofilm

[0219] Another aspect of the antimicrobial peptide's effect is its impact on biofilms. Biofilms are organized bacterial communities attached to surfaces and coated with extracellular macromolecules. They are also a key factor in bacterial resistance to antibiotics and inability to be completely killed. First, using Aeromonas vernix, a biofilm-forming bacterium, as the research object, the effect of Parasin I fermentation broth on the biofilm-forming ability of Aeromonas vernix was investigated. By adding different volumes of fermentation broth to achieve different volume fractions, the biofilms formed were examined after 24 hours of incubation.

[0220] In some embodiments, the biofilm assay method comprises: picking a single colony of wild-type Aeromonas wilkeri into LB liquid culture medium, culturing at 30°C and 150 rpm for 12 hours. 7 Add CFU / ml of bacteria to a 96-well microplate, add 100μL of fermentation liquid, use blank plasmid yeast fermentation liquid and 50μg / mL kanamycin as controls, and culture at 30℃ for 48h. Aspirate the culture medium, add 200μL 1×PBS and wash twice, then dry. Add 100μL of anhydrous methanol to each well for 20 minutes, then aspirate the methanol and let it air dry naturally. Add 100μL of 1% crystal violet and stain at room temperature for 15 minutes. Wash off the crystal violet staining solution and wash twice with clean water. Add 100μL of 33% glacial acetic acid solution to each well and incubate at 37℃ for 30 minutes to dissolve the crystal violet. Detect OD with an enzyme reader 590 Numerical values. Graphs were created using Graphpad.

[0221] from Figure 29 As can be seen in the results, when the volume fraction of the antimicrobial peptide Parasin I fermentation broth reaches 75%, it can significantly inhibit the formation of Aeromonas vernix biofilms. As the volume fraction of the fermentation broth increases, the inhibitory effect on biofilm formation becomes more pronounced. This experiment shows that the antimicrobial peptide fermentation broth can inhibit the formation of Aeromonas vernix biofilms.

[0222] Secondly, we explored whether Parasin I fermentation broth had an effect on the biofilm that had already formed by Aeromonas vernix. We first cultured Aeromonas vernix for 48 hours to allow it to form a sufficient amount of biofilm, then added fermentation broth of different volume fractions for treatment. After 24 hours, the biofilm content was detected.Figure 30 As can be seen, compared with the fermentation broth treatment group of the recombinant strain with empty plasmid, the fermentation broth of antibacterial peptide ParasinⅠ significantly damaged the biofilm. Based on the above experiments, it is proved that the mechanism of action of the antibacterial peptide fermentation broth is, on the one hand, the destruction of the bacterial cell membrane; on the other hand, the influence on the bacterial biofilm, which is manifested in both the inhibition of biofilm formation and the destruction of the formed biofilm.

[0223] The above embodiments are only for illustrating the present invention and are not intended to limit the present invention. Those of ordinary skill in the relevant technical field can also make various changes and modifications without departing from the scope of the present invention. Therefore, all equivalent technical solutions should also fall within the scope of the disclosure of the present invention.

Claims

1. Method for preparing Parasin I protein or Parasin I fermentation broth, comprising: Obtaining a yeast strain capable of secreting Parasin I protein; Inoculating the yeast strain into a specific liquid medium; And Fermenting the yeast strain and obtaining Parasin I fermentation broth; The fermentation broth contains Parasin I protein; Wherein, the pH of the specific medium is 6 - 9, the inoculation amount of the yeast strain in the specific medium is 0.005 - 0.015 OD / mL, and the temperature for fermenting the yeast is 28 - 33°C.

2. The preparation method according to claim 1, wherein the pH of the specific medium is 7.

9.

3. The preparation method according to claim 1, wherein the inoculation amount of the yeast strain in the specific medium is 0.006 OD / mL.

4. The preparation method according to claim 1, wherein the temperature for fermenting the yeast is 31.3°C.

5. The preparation method according to claim 1, wherein the fermentation time of the yeast is 1 - 7 days; preferably 2 - 6 days; more preferably 3 - 4 days; further preferably 3 days.

6. A method for activating and / or enhancing the immune system of fish, comprising: Administering a certain amount of Parasin I protein or Parasin I fermentation broth obtained by the preparation method according to any one of claims 1 - 5 to fish.

7. A method for preventing and / or treating pathogen infections in fish, comprising: Administering a certain amount of Parasin I protein or Parasin I fermentation broth obtained by the preparation method according to any one of claims 1 - 5 to fish.

8. According to the method of claim 7, the pathogen is Aeromonas veronii, Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii or Pseudomonas aeruginosa.

9. A fish feed additive, comprising Parasin I protein or Parasin I fermentation broth prepared by the preparation method according to claim 1; wherein the amino acid sequence of the Parasin I protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added and / or deleted at the N - terminus and / or P - terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or converted on the amino acid sequence shown in SEQ ID NO.

1.

10. Application of Parasin I protein or Parasin I fermentation broth prepared by the preparation method according to claim 1 as a fish feed additive, wherein the amino acid sequence of the Parasin I protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added and / or deleted at the N - terminus and / or P - terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or converted on the amino acid sequence shown in SEQ ID NO.1.

Images