Method for detecting corn leukoderma pathogenic bacteria based on RPA-LFD

Abstract

The invention relates to the technical field of biology, and particularly discloses a method for detecting corn leukoderma pathogenic bacteria based on RPA-LFD (Recombinase Polymerase Amplification-Lateral Flow Dipstick), which comprises the following steps: a recombinase polymerase amplification RPA reaction system comprising an upstream primer PA-F2, a biotin-labeled downstream primer PA-R3-biotin and an nfo probe PA3-nfo-2; the lateral flow chromatography analysis LFD test strip is used for detecting an amplification product; a reaction buffer solution and a dilution buffer solution; a rapid and visual corn leaf spot detection method is developed by using a recombinase-mediated isothermal amplification (PRA) technology and combining an nfo probe with a lateral flow chromatography analysis and diagnosis method, and finally, an efficient and rapid corn leaf spot detection, prevention and control system is established by popularizing and applying a novel visual detection method in a field.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a method for detecting the pathogen of maize white spot disease based on RPA-LFD. Background Art

[0002] Maize white spot disease widely occurs in South America, Asia and Africa. Cui et al. believe that the bacterium Pantoea ananatis is the main cause of white spot disease. This bacterium was only isolated from the disease spots of maize white spot disease in the field, and it was confirmed by Koch's method that Pantoea ananatis is the pathogenic bacterium of white spot disease.

[0003] At present, the methods for identifying the pathogen of maize white spot disease mainly include pathogen isolation and culture observation on leaves, etc. These traditional identification methods are time-consuming and have low accuracy. At the same time, the detection is carried out after the disease occurs, which is not conducive to early screening and prevention and control. The current relatively accurate molecular detection method is the PCR detection method, but this method has high requirements for the site, detection instrument and professional operation ability of personnel, and is not suitable for rapid detection in the field. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides a method for detecting the pathogen of maize white spot disease based on RPA-LFD, so as to solve the problems of low detection efficiency, poor accuracy, complex operation and inapplicability to rapid detection in the field in the prior art.

[0005] A kit for detecting the pathogen Pantoea ananatis of maize white spot disease, comprising: A recombinase polymerase amplification (RPA) reaction system, including an upstream primer PA-F2, a biotin-labeled downstream primer PA-R3-biotin, and an nfo probe PA3-nfo-2; A lateral flow dipstick (LFD) for detecting the amplification product; A reaction buffer and a dilution buffer; Wherein, the sequence of the upstream primer PA-F2 is as shown in SEQ ID NO: 1; the sequence of the downstream primer PA-R3-biotin is as shown in SEQ ID NO: 2; the sequence of the nfo probe PA3-nfo-2 is as shown in SEQ ID NO: 3; The primer and the probe specifically amplify and detect the target sequence of Pantoea ananatis.

[0006] Preferably, the recombinase polymerase amplification (RPA) reaction system is 20 μL and comprises: 0.84 μL of the upstream primer at a concentration of 10 μM, 0.84 μL of the downstream primer at a concentration of 10 μM, 0.6 μL of the probe at a concentration of 4 μM, 10 μL of 2× rehydration buffer, 1 μL of DNA template, 2 μL of 10× initiator, and the balance is deionized water.

[0007] Preferably, the reaction conditions of the recombinase polymerase amplification RPA reaction system are: isothermal amplification at 41 °C for 30 minutes.

[0008] Preferably, the sensitivity of the LFD test strip detection is 100 fg / μL of Pantoea ananatis genomic DNA.

[0009] A method for detecting the pathogen of maize white spot disease based on RPA-LFD includes the following steps: (a) Extract the genomic DNA of the sample to be tested; (b) Perform recombinase polymerase RPA isothermal amplification using the above kit to obtain an amplification product; (c) Mix the amplification product with the dilution buffer and then drop it onto the lateral flow chromatography analysis LFD test strip, and observe the result within 5 minutes; (d) If the test strip shows two purplish red bands of the quality control line and the test line, it is determined to be positive; if only the quality control line shows color, it is negative.

[0010] Preferably, the sample to be tested is a field maize leaf tissue or a pathogen isolate.

[0011] Preferably, the recombinase polymerase RPA isothermal amplification reaction is carried out under the constant temperature condition of 41 °C.

[0012] Preferably, the detection is specific for Pantoea ananatis and does not cross-react with other maize leaf spot disease pathogens.

[0013] Compared with the prior art, the present invention has the following beneficial effects: By using the recombinase-mediated isothermal amplification (PRA) technology and combining the nfo probe with the lateral flow chromatography analysis diagnostic method, a rapid and visual detection method for maize leaf spot disease is developed. Finally, by popularizing and applying the new visual detection method in the field, an efficient and rapid detection and prevention and control system for maize white spot disease is established; By verifying 7 common maize leaf spot disease pathogens (such as the pathogens of Exserohilum turcicum and Bipolaris maydis), it is confirmed that this method only produces a positive signal for Pantoea ananatis and has no cross-reaction, avoiding misjudgment; No complex equipment is required: RPA amplification is carried out under the constant temperature condition of 41 °C, without a thermal cycler, and is suitable for field operation.

[0014] Rapid interpretation: The whole process from DNA extraction to the result interpretation of the LFD test strip only takes 35 minutes, significantly shortening the detection time. The result is directly judged by the double-line color development of the LFD test strip, without the need for electrophoresis or fluorescence detection equipment, reducing the technical dependence on professionals. Brief Description of the Drawings

[0015] Figure 1 It is the flow chart of the detection method of the present invention. Figure 2 It is the schematic diagram of the feasibility detection of RPA-LFD of the present invention. Figure 3 It is the schematic diagram of the sensitivity detection of RPA-LFD of the present invention. Figure 4 It is the schematic diagram of the specificity detection of RPA-LFD of the present invention. Figure 5 It is the schematic diagram of the detection of bacteria-carrying leaves by RPA-LFD of the present invention. Detailed Embodiments

[0016] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0017] As Figure 1 shown:

[0018] Example 1:

[0019] Materials and Methods: Experimental materials: The test strains were all isolated and preserved by the Plant Protection Institute of Sichuan Academy of Agricultural Sciences. The specific information is shown in Table 1. The bacteria-carrying leaves were collected in Sichuan, Yunnan, Guizhou and other places in 2024. The collection locations are shown in Table 2 below. Main reagents: The DNA extraction kit (NuClean Plant Genomic DNA Kit) was purchased from CW Biotech, and the Taq enzyme was purchased from Novoprotein. The RPA-LFD isothermal amplification kit was purchased from Shenzhen EasyGene Biotechnology Co., Ltd. The DNA constant temperature amplification kit (test strip type).

[0020] Experimental instruments: NanoDrop 2000 ultra-micro ultraviolet spectrophotometer, Eppendorf ThermoMixer® C - mixer, agarose electrophoresis apparatus.

[0021] DNA extraction of the tested strains: All the tested strains were inoculated on PDA solid medium plates and cultured at 26 °C for 5 - 7 days. The genomic DNA of each tested strain was extracted using a plant genomic DNA extraction kit and dissolved in 80 μL of ddH₂O. The DNA concentration was measured using a spectrophotometer (NanaDrop 2000) and stored at -20 °C for later use.

[0022] Table 1 Information of the tested strains

[0023] Table 2 Information of the leaves with bacteria

[0024] Experimental results: Selection of specific sequences of the pathogen of maize white spot and design of primers and probes: Combining the published genomic sequence of the maize white spot pathogen and the published literature on Pantoea ananatis, the pathogen of white spot, the following specific genomic sequence fragments were selected as the target amplification fragments through homologous sequence comparison. Upstream and downstream primers were designed for the amplified fragment, and the position of the nfo detection probe was between the upstream and downstream primers. The upstream and downstream primers were used for fragment amplification, and the nfo probe and the downstream primer with Biotin added were used together for LFD detection.

[0025] >Pantoea ananatis PA13 CAGTTTGAGCAGGAGCAATCGACGGTATGGGGCTATGAAAGCCAGTACCGTGCGCTGTTACAGCAACAGTATGGTGCCCGCCAGCAGTTAAACGTTTTGAACGACCAACAGCTTCAAATACCGCTAGCCACATCCGTAAAGCTTAACGTCCTGCGTCGTCAGCTGGCGCAGGTGGATGAGAACCTGTCACAAAATGAAACTATCCTGCAGCAGGCGCTCTATATGCCTTCTGACGGTTCAGTGAAATCTGTTATCGCGAAGGCTGACAACAGGATGACAGGGGAGCAATCGAGTCAGGCTGGTGAAGCCAACAGTCAGCAAACCGCGACCACCAGATTGATATCCGATAAGCCAGTAGCCGGCATGCACAGAGACAACCCTGGCGGAGCGCATTTTCAGACCATAAATGCCCAGTCTGGTAATTCCTTCAACAGTGGGCATCATTCGGTATCAGCGCATAATGTGTAA Table 3: Primer and probe sequences

[0026] Using the primer-probe sequences in Table 3, the RPA-LFD reaction system was established and tested: RPA-LFD reaction system: A 20-μL reaction system, and in each reaction, add (note: operate on ice): upstream primer PA-F2 (10 μM) 0.84 μL, downstream primer PA-R3-biotin (10 μM) 0.84 μL, probe PA3-nfo-2 (4 μM) 0.6 μL, Rehydration Buffer (2X) 10 μL, DNA template 1 μL, Starter (10X) 2 μL, ddH2O 4.12 μL. For the negative control group, deionized water was used instead of the DNA template.

[0027] RPA reaction conditions and lateral flow dipstick (LFD) detection: Incubate the prepared RPA reaction solution in a ThermoMixer® C at 41 °C for 30 min. After incubation, take 10 μL of the amplification product, add 80 μL of Diluent Buffer, mix well, and add to the dipstick for detection within five minutes. Observe the results with the naked eye through the dipstick: If two purple-red bands appear on the dipstick, one is the control band and the other is the test band, the result is positive, indicating that the amplification product is positive; if only one purple-red band appears in the control area of the dipstick and no band appears in the test area, the result is negative. The band with the pathogen genomic DNA shows two bands, indicating a positive test result, while the negative control (sterilized ddH2O) only shows one band in the control area, indicating no amplification, which is the same result as the PCR reaction amplified only with the F2 / R3 primers.

[0028] As Figure 2 shown: a: RPA-LFD reaction result; b: PCR reaction result; C: Control band; M: DNA Marker; T: Test band; 1: Pantoea ananatis (pathogen of maize white spot); 2: Negative control; M: DL2000 DNA marker.

[0029] RPA-LFD sensitivity detection: The genomic DNA of Pantoea ananatis was serially diluted 10-fold with sterilized ddH2O, and eight concentrations of genomic DNA, namely 100 ng.μL-1, 10 ng.μL-1, 1 ng.μL-1, 100 μg.μL-1, 10 μg.μL-1, 1 μg.μL-1, 100 fg.μL-1, and 10 fg.μL-1, were selected as templates for the RPA-LFD reaction to detect the sensitivity of Pantoea ananatis genomic DNA. The detection sensitivity was evaluated based on the detection results. The results showed that the detection results of treatments with Pantoea ananatis genomic DNA concentrations higher than 100 fg.μL-1 were all positive, that is, the LFD test strip had clearly visible quality control lines and detection lines, indicating that the established RPA-LFD method had a detection sensitivity of 100 fg.μL-1 for Pantoea ananatis genomic DNA. The detection sensitivity of the PCR reaction using the same primers was lower than that of the RPA-LFD method, only 1 ng.μL-1, indicating that the RPA-LFD method had a high detection sensitivity.

[0030] As Figure 3 shown: a: Results of the RPA-LFD reaction; b: Results of the PCR reaction; C: Quality control band; T: Test band; M: DNA Marker; 1: 100 ng.μL-1; 2: 10 ng.μL-1; 3: 1 ng.μL-1; 4: 100 pg.μL-1; 5: 10 pg.μL-1; 6: 1 pg.μL-1; 7: 100 fg.μL-1; 8: 10 fg.μL-1. RPA-LFD specificity detection: To verify the specificity of RPA-LFD for Pantoea ananatis, the genomes of other common pathogens of maize leaf spot diseases (Table 1) were used as templates, and RPA-LFD was used for specificity verification. The genomic DNA of Pantoea ananatis was used as a positive control, and sterilized ddH2O was used as a negative control. The LFD test strip was used to detect the RPA amplification products. The detection results showed that only the genomic DNA of Pantoea ananatis showed a positive amplification result, and the LFD test strip had obvious quality control lines and detection lines, while no amplification products were produced by other pathogens and sterile water, all showing negative results, indicating that the established RPA-LFD had strong specificity for Pantoea ananatis.

[0031] As Figure 4 shown: a: RPA-LFD reaction result; b: PCR reaction result; C: Control band; T: Test band; M: DNA Marker; 1: Pantoea ananatis, the pathogen of maize white spot; 2: Exserohilum turcicum, the pathogen of northern leaf blight of maize; 3: Bipolaris maydis, the pathogen of southern leaf blight of maize; 4: Cercospora zeae-maydis, the pathogen of gray leaf spot of maize; 5: Cercospora zeina, the pathogen of gray leaf spot of maize; 6: Colletotrichum truncatum, the pathogen of anthracnose of maize; 7: Fusarium graminearum, the pathogen of Fusarium head blight of maize; M: DL2000 DNA marker.

[0032] Detection of bacteria in leaf tissues: Detection of bacteria in leaves: Genomic DNA was extracted from maize white spot leaf tissues collected from different fields using a plant genomic DNA extraction kit, and detected by the RPA-LFD method. Pantoea ananatis genomic DNA was used as a positive control, and sterilized ddH2O and healthy leaves were used as negative controls. Compared with the PCR detection results, all bacteria-infected leaves (PCR-positive samples) had positive RPA-LFD detection results, while PCR-negative maize leaves (healthy leaves) had negative RPA-LFD detection results, indicating that the established RPA-LFD can be used for the detection of Pantoea ananatis in plant leaves.

[0033] As Figure 5 shown: a: RPA-LFD reaction result; b: PCR reaction result; C: Control band; T: Test band; M: DNA Marker; 1: Positive control; 2: Negative control; 3: Healthy leaves; 4: B-01; 5: B-02; 6: B-03; 7: B-04; 8: B-05; 9: B-06; 10: B-07; 11: B-08; 12: B-09; 13: B-10; 14: B-11; M: DL2000 DNA marker.

[0034] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "examples", "specific examples", or "some examples" mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0035] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Kit for detecting Pantoea ananas, the pathogen of maize leaf spot disease, characterized in that Comprising: A recombinase polymerase amplification (RPA) reaction system, including an upstream primer PA-F2, a biotin-labeled downstream primer PA-R3-biotin, and an nfo probe PA3-nfo-2; A lateral flow dipstick (LFD) for detecting the amplification product; A reaction buffer and a dilution buffer; Wherein, the sequence of the upstream primer PA-F2 is as shown in SEQ ID NO: 1; the sequence of the downstream primer PA-R3-biotin is as shown in SEQ ID NO: 2; the sequence of the nfo probe PA3-nfo-2 is as shown in SEQ ID NO: 3; The primers and the probe specifically amplify and detect the target sequence of Pantoea ananas.

2. The kit according to claim 1, wherein The RPA reaction system is 20 μL and comprises: 0.84 μL of the upstream primer with a concentration of 10 μM, 0.84 μL of the downstream primer with a concentration of 10 μM, 0.6 μL of the probe with a concentration of 4 μM, 10 μL of 2× rehydration buffer, 1 μL of DNA template, 2 μL of 10× initiator, and the balance is deionized water.

3. The kit according to claim 1, characterized in that, The reaction conditions of the RPA reaction system are: isothermal amplification at 41°C for 30 minutes.

4. The kit according to claim 1, characterized in that, The sensitivity of the LFD detection is 100 fg / μL of Pantoea ananas genomic DNA.

5. A method for detecting the pathogen of maize white spot disease based on RPA-LFD, characterized in that, Including the following steps: (a) Extracting the genomic DNA of the sample to be tested; (b) Performing recombinase polymerase RPA isothermal amplification using the kit according to any one of claims 1-4 to obtain an amplification product; (c) Mixing the amplification product with the dilution buffer and then dropping it onto the LFD, and observing the result within 5 minutes; (d) If two magenta bands, namely the control line and the test line, appear on the dipstick, it is determined as positive; if only the control line shows color, it is negative.

6. The method according to claim 5, wherein The sample to be tested is a field corn leaf tissue or a pathogen isolate.

7. The method according to claim 6, characterized in that, The recombinase polymerase RPA isothermal amplification reaction is carried out under the constant temperature condition of 41°C.

8. The method according to claim 7, wherein The detection is specific for Pantoea ananas and does not cross-react with other pathogens of corn leaf spot diseases.

Images