Molecular marker for detecting leaf rust resistance gene Lr19 and application of molecular marker

Abstract

The invention discloses a molecular marker for detecting a leaf rust resistant gene Lr19 and application of the molecular marker, and belongs to the technical field of wheat molecular breeding. The molecular marker disclosed by the invention is at least one of a molecular marker Lsdau-7 and a molecular marker YXsdau-9; the nucleotide sequence of the molecular marker Lsdau-7 is as shown in SEQ ID NO. 1; the nucleotide sequence of the molecular marker YXsdau-9 is as shown in SEQ ID NO. 2. By utilizing the molecular marker disclosed by the invention, the specific detection of the leaf rust resistant gene Lr19 can be realized, and the leaf rust resistant breeding efficiency of wheat is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of wheat molecular breeding, and particularly relates to a molecular marker for detecting the leaf rust resistance gene Lr19 and its application. Background Art

[0002] Wheat leaf rust is a fungal disease caused by Puccinia triticina. It breaks out on a large scale in warm and humid regions, and is characterized by a wide distribution range, a fast transmission speed, and a great disease hazard, seriously threatening wheat production. Puccinia triticina mainly infects the leaves. At the initial stage of infection, chlorotic spots will form on the leaves, and uredinia will be produced at the chlorotic areas in the later stage, showing an irregular arrangement of orange-red uredinia; the uredinia often appear on the front side of the leaves, and a few can penetrate the leaves. In severely diseased wheat varieties, the leaf sheaths and glumes will also be affected to varying degrees.

[0003] Research shows that cultivating and planting disease-resistant varieties is the most economical and effective measure to solve the problem of wheat leaf rust. However, there are few effective resistance sources available in current production. Moreover, when Puccinia triticina coexists with wheat for a long time, its physiological races are constantly changing. Because the races are specific, once the resistance gene is broken through, the resistance of disease-resistant varieties will decline.

[0004] Thinopyrum ponticum is an important gene pool of wheat and an important resistance source for solving the problems of wheat breeding. The leaf rust resistance gene Lr19 is an effective disease-resistant gene with broad-spectrum resistance from the 7E chromosome of Thinopyrum ponticum. So far, only a few strains show virulence to it. It is a disease-resistant gene with great application potential that can mediate resistance throughout the growth period. Therefore, finding molecular markers closely linked to the leaf rust resistance gene Lr19 is of great significance for the cloning of this gene, molecular marker-assisted breeding, etc. Summary of the Invention

[0005] Aiming at the above-mentioned existing technologies, the purpose of the present invention is to provide a molecular marker for detecting the leaf rust resistance gene Lr19 and its application.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, there is provided a molecular marker for detecting the leaf rust resistance gene Lr19, and the molecular marker is at least one of the molecular marker Lsdau-7 and the molecular marker YXsdau-9;

[0008] The nucleotide sequence of the molecular marker Lsdau-7 is as shown in SEQ ID NO.1, specifically as follows:

[0009] TTGTTACGTTCGGATGTCCCGGCGTGCGTCCGTGCGATGTGTTGGATTTGGCAAACCAACGCCGTGCATGTGCGCGCACCACCACGATGCGGGCCCGTTGTTGGTCCGCGCGCCTCCGCTTCGGCTCTCCTTGGAAATCTTGTTAGGTTCCCCAGATCCCAAGTTGAGTTGCCACTTTTCCCGGCCGGGTATTCTCTCGCGCGTGCACCGCAATTTGCCTCTCGTTTCCCTGCCTTTCCGCGCCCGAGAACATTCGCTCGCTTCGTCCCCCTTGCTTGGGCAAGGCACAGTCGTGGACAGTTGTGGGGCGACCATGGTTCTCTCTGTGAGTCAGTGATGCATAGTTACATACTCTTCTTTTTGGAAAAACTTCCGATCTATTGATCGAACATCATGACAGTACAAAAAATCAGAAGTAACAAAAATTACATCCATGTTCATACACCACTCTACAAGCACTGGAGTGTTTTGACCTGCCTAAAATAATCGACCGGCAGATATATAACACTCACGAGTTGCTTCAAATTGGACTCGTACAAGTCCTGGAAAATACTAACCCCTCCATCAACAAATATAAGGCCTCACACGTTTCTTGAAATTCATCGAGAAATTATGCAATAATACATGTCTTTCGTGATTATTATTTTTGATAACGCTAGATCTGTATAGAAAAAACCACCAATAAGCTCTTTTCCTCCG。

[0010] The nucleotide sequence of the molecular marker YXsdau-9 is shown in SEQ ID NO.2 as follows:

[0011] GCTTCCTTAGAGAAGTTTGCCGTGATGCCGGAGATTGGCGAGATGCCGATGGGGTGTGTGCTACCGGCGCGAGCGAGCAGTGCTTGGTGGCCAGCGGCGATGCTTCTCCTGATGGTGGCGGCGTGTTGCCGGTTGCCGCAGGATGGGTTCTCGCTGGCATCCTCCCGAATAAATAAACTCGTTTTTGCCCTTGTTTTAGGGATTTCGATCTCTCCCCCGCAGCTCTCTTCATGCCTTCGAGCTGGAGGAAGAAGGGATGTAGTGGAGGTAAGATTGATCTCCAGTTATGCTGCTTCTGAGATCTCGGTCC。

[0012] The molecular markers Lsdau-7 and YXsdau-9 of the present invention are closely linked to the leaf rust resistance gene Lr19, and the fragment lengths of the two molecular markers are moderate, and the amplification specificity is good, which is conducive to the specific detection of the leaf rust resistance gene Lr19.

[0013] In the second aspect of the present invention, there is provided the use of the above molecular markers in the following (1) or (2):

[0014] (1) Identifying the resistance of plant planting resources to leaf rust;

[0015] (2) Molecular marker-assisted breeding of wheat resistant to leaf rust.

[0016] In the third aspect of the present invention, there is provided a primer combination for specifically detecting the leaf rust resistance gene Lr19, including: a first primer pair for amplifying the molecular marker Lsdau-7 and a second primer pair for amplifying the molecular marker YXsdau-9;

[0017] The nucleotide sequences of the first primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4, specifically as follows:

[0018] Lsdau-7F: TTGTTACGTTCGGATGTCCCG; (SEQ ID NO.3)

[0019] Lsdau-7R: CGGAGGAAAAGAGCTTATTGGTG. (SEQ ID NO.4)

[0020] The nucleotide sequences of the second primer pair are shown in SEQ ID NO.5 and SEQ ID NO.6, specifically as follows:

[0021] YXsdau-9F: GCTTCCTTAGAGAAGTTTGCCG; (SEQ ID NO.5)

[0022] YXsdau-9R: CTGCTTCTGAGATCTCGGTCC. (SEQ ID NO.6)

[0023] In the fourth aspect of the present invention, there is provided the use of the above primer combination in the following (1) or (2):

[0024] (1) Identifying the resistance of plant germplasm resources to leaf rust;

[0025] (2) Molecular marker-assisted breeding of wheat resistant to leaf rust.

[0026] In the fifth aspect of the present invention, there is provided a method for identifying or assisting in identifying the resistance of wheat to leaf rust, comprising the following steps:

[0027] Using the genomic DNA of the wheat to be tested as a template, performing PCR amplification using at least one of the first primer pair and the second primer pair, detecting the amplified product by gel electrophoresis, and identifying the leaf rust resistance of the wheat according to the size of the amplified band.

[0028] Specifically, if PCR amplification is performed using the first primer pair and the size of the amplified band is 699 bp, then the wheat has resistance to leaf rust; if PCR amplification is performed using the second primer pair and the size of the amplified band is 310 bp, then the wheat has resistance to leaf rust.

[0029] Preferably, the system for PCR amplification is: 1 μL of DNA template, 10 μL of 2×Taq Master Mix, 1 μL each of the forward primer and the reverse primer with a concentration of 10 μmol / L, and adding water to 20 μL.

[0030] Preferably, the reaction program for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 10 min.

[0031] Advantages of the present invention:

[0032] The present invention has developed and designed two molecular markers for specifically detecting the leaf rust resistance gene Lr19. According to the size of the target band of the amplified product, plant materials carrying the leaf rust resistance gene Lr19 can be accurately screened out, and the accuracy of identification can reach 100%. The molecular markers of the present invention improve the breeding efficiency of wheat resistant to leaf rust and have important practical application value. Description of the Drawings

[0033] Figure 1: Gel electrophoresis detection results of molecular marker Lsdau-7 in the BC1F2 population samples of wheat-Thinopyrum elongatum short fragment translocation lines; in the figure, M is DL2000 Marker; 1 is a decaploid Thinopyrum elongatum alien substitution line plant without the leaf rust resistance gene Lr19; 2 is a BC1F2 generation plant carrying the leaf rust resistance gene Lr19; 3 is a Fielder plant without the leaf rust resistance gene Lr19; CG is the blank control.

[0034] Figure 2 : Phenotypes of leaf rust resistance identification of molecular marker Lsdau-7 in the BC1F2 population of wheat-Thinopyrum elongatum short fragment translocation lines; in the figure, 1 is a decaploid Thinopyrum elongatum alien substitution line plant without the leaf rust resistance gene Lr19; 2 is a BC1F2 generation plant carrying the leaf rust resistance gene Lr19; 3 is a Fielder plant without the leaf rust resistance gene Lr19.

[0035] Figure 3 : Gel electrophoresis detection results of molecular marker YXsdau-9 in the BC1F2 population samples of wheat-Thinopyrum elongatum short fragment translocation lines; in the figure, M is DL2000 Marker; 1 is a decaploid Thinopyrum elongatum alien substitution line plant without the leaf rust resistance gene Lr19; 2 is a BC1F2 generation plant carrying the leaf rust resistance gene Lr19; 3 is a Fielder plant without the leaf rust resistance gene Lr19; CG is the blank control.

[0036] Figure 4 : Phenotypes of leaf rust resistance identification of molecular marker YXsdau-9 in the BC1F2 population of wheat-Thinopyrum elongatum short fragment translocation lines; in the figure, 1 is a decaploid Thinopyrum elongatum alien substitution line plant without the leaf rust resistance gene Lr19; 2 is a BC1F2 generation plant carrying the leaf rust resistance gene Lr19. 3 is a Fielder plant without the leaf rust resistance gene Lr19. Detailed implementation manners

[0037] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present application belongs.

[0038] As mentioned above, wheat leaf rust seriously threatens wheat production. The leaf rust resistance gene Lr19 is an effective disease resistance gene with broad-spectrum resistance from the 7E chromosome of Thinopyrum elongatum. So far, only a few strains show virulence to it, and it is a disease resistance gene with great application potential that can mediate resistance throughout the growth period. Finding molecular markers closely linked to the leaf rust resistance gene Lr19 is of great significance for the cloning of disease resistance genes, molecular marker-assisted breeding, etc.

[0039] Currently, there have been reports on different types of molecular markers such as RFLP markers, SSR markers, AFLP markers, etc. that are closely linked to Lr19; the inventors also developed a molecular marker Xsdau798 closely linked to Lr19 in previous studies; however, there is still a certain distance between these molecular markers and the target gene, and the specificity and accuracy of detection still need to be further improved.

[0040] In view of this, to further improve the accuracy of molecular-assisted breeding, the present invention uses the wheat-Thinopyrum ponticum disomic substitution line K11463[7el1(7D)] resistant to leaf rust as the experimental material, conducts whole-genome resequencing on it, randomly selects fragments with a length of 200 - 1000 bp from the whole-genome resequencing data, and conducts the first screening of the fragments by Blast alignment with the wheat genome; then conducts the second screening of the fragments under amplification conditions; and then conducts the third screening through agarose gel electrophoresis combined with the disease-resistant identification phenotype, excluding molecular markers whose results do not match the expectations, and finally obtains two molecular markers, Lsdau-7 and YXsdau-9.

[0041] The genetic distances of the two molecular markers, sdau-7 and YXsdau-9, developed by the present invention from Lr19 are both less than 0.19 cM. Compared with the reported molecular markers, their genetic distances are smaller and the tightness of linkage is higher. Using the molecular markers of the present invention to detect Lr19 in the material, the detection accuracy is higher.

[0042] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0043] The experimental materials used in the embodiments of the present invention are all conventional experimental materials in the art and can be obtained through commercial channels. The experimental methods without specific conditions are carried out according to conventional experimental methods or according to the operation manuals recommended by the suppliers. Among them:

[0044] The wheat-Thinopyrum ponticum disomic substitution lines K11463[7el1(7D)] and K2620[7el2(7D)] are materials reported in existing literature and are planted in the plant growth room of the National Key Laboratory of Wheat Breeding, Shandong Agricultural University.

[0045] Example 1: Development of Molecular Markers for Detecting the Leaf Rust Resistance Gene Lr19 and Detection Primers

[0046] 1. Development of molecular markers:

[0047] Using the wheat-Thinopyrum ponticum disomic substitution line K11463 [7el1(7D)] resistant to leaf rust as the experimental material, the genome was resequenced. Using the genome resequencing data, fragments of 200 - 1000 bp were selected and blasted against the wheat genome data in the NCBI database. Fragments located on chromosome 7D or with a Blast result of "none" were selected as candidate fragments.

[0048] Then, primers were designed using Snap Gene software to further screen the candidate fragments. The screening conditions were: CG content greater than 50%, and TM value at 60°C ± 2°C; a total of 13 fragments were screened out.

[0049] Finally, the 13 screened fragments were subjected to Touch Down program using PCR, followed by agarose gel electrophoresis. Combining with the disease resistance identification phenotypes, molecular markers with results inconsistent with the expectations were excluded, and finally two molecular markers were obtained, namely: molecular marker Lsdau-7 and molecular marker YXsdau-9; among them, the nucleotide sequence of molecular marker Lsdau-7 is shown in SEQ ID NO.1, and the nucleotide sequence of molecular marker YXsdau-9 is shown in SEQ ID NO.2. The genetic distances between molecular marker Lsdau-7 and molecular marker YXsdau-9 and the leaf rust resistance gene Lr19 are both less than 0.19 cM.

[0050] 2. Development of detection primers:

[0051] For molecular marker Lsdau-7 and molecular marker YXsdau-9, their corresponding detection primers were further developed. Among them, the detection primers (the first primer pair) for amplifying molecular marker Lsdau-7 are as follows:

[0052] Lsdau-7F: TTGTTACGTTCGGATGTCCCG; (SEQ ID NO.3)

[0053] Lsdau-7R: CGGAGGAAAAGAGCTTATTGGTG. (SEQ ID NO.4)

[0054] The detection primers (the second primer pair) for amplifying molecular marker YXsdau-9 are as follows:

[0055] YXsdau-9F: GCTTCCTTAGAGAAGTTTGCCG; (SEQ ID NO.5)

[0056] YXsdau-9R: CTGCTTCTGAGATCTCGGTCC. (SEQ ID NO.6)

[0057] A method for identifying wheat resistance to leaf rust using the above detection primers includes the following steps:

[0058] (1) Extract the genomic DNA of the sample using the CTAB method: Cut 2 - 3 cm of wheat leaves and put them into a 2 mL centrifuge tube. After freezing the leaves in liquid nitrogen, quickly grind them into powder. Add 400 μL of preheated CTAB extraction buffer at 65 °C and incubate in a water bath at 65 °C for 45 min. Then, add an equal volume of chloroform, mix well, let stand for 3 min, centrifuge at 12000 rpm for 10 min, and extract 350 μL of the supernatant. Add 350 μL of isopropanol and 35 μL of sodium acetate, mix well, and let stand for 15 min. Subsequently, centrifuge at 12000 rpm for 10 min, pour out the supernatant, and the precipitate is genomic DNA. Wash the precipitate twice with 500 μL of 70% ethanol.

[0059] (2) PCR amplification: Using the genomic DNA of the sample as a template, perform PCR amplification with at least one of the first primer pair and the second primer pair. The PCR amplification system is: 1 μL of DNA template, 10 μL of 2×Taq Master Mix, 1 μL each of the forward primer and reverse primer with a concentration of 10 μmol / L, and add water to 20 μL; The PCR amplification reaction program is: 95 °C for 5 min; 95 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, for 35 cycles; 72 °C for 10 min.

[0060] (3) Detect the PCR product by 1% agarose gel: Perform agarose gel electrophoresis on the PCR amplification product and identify the resistance of wheat to leaf rust according to the size of the electrophoresis band; specifically:

[0061] When performing PCR amplification with the first primer pair, if the size of the amplified band is 699 bp, then the wheat has resistance to leaf rust; if no band can be amplified, then the wheat is susceptible.

[0062] When performing PCR amplification with the second primer pair, if the size of the amplified band is 310 bp, then the wheat has resistance to leaf rust; if no band can be amplified, then the wheat is susceptible.

[0063] Example 2: Verification of the detection effect of molecular markers

[0064] Using Fielder, wheat - Thinopyrum ponticum disomic substitution lines K11463[7el1(7D)] and K2620[7el2(7D)] as experimental materials, verify the detection effect of the molecular markers and detection primers developed in Example 1, specifically as follows:

[0065] For each of the above three test materials, 360 plants were selected, and the molecular markers and detection primers in Example 1 were used to identify the test materials according to the method for identifying wheat resistance to leaf rust in Example 1. The results are shown in Table 1.

[0066] Table 1: Verification Results of Molecular Markers

[0067]

[0068] The above results indicate that: using the molecular markers and detection primers developed in Example 1 of the present invention, the anti-leaf rust gene Lr19 can be accurately identified, and the accuracy of the detection results can reach 100%.

[0069] Example 3: Transfer and Utilization of the Anti-Leaf Rust Gene Lr19 by Molecular Markers

[0070] Chinese Spring ph1b mutant was crossed with K11695 (7DS.7el1L) to obtain F1; F1 was backcrossed with Chinese Spring ph1b mutant to obtain BC1F1; the plants of BC1F1 were identified by molecular markers using the molecular markers and detection primers developed in Example 1. On the basis of molecular marker identification, BC1F1 carrying the anti-leaf rust gene Lr19 and foreign fragments was self-crossed to obtain BC1F2. The plants of BC1F2 were identified using the molecular markers and detection primers developed in Example 1, and the single plants retaining the anti-leaf rust gene Lr19 were selected for self-crossing, so as to realize the transfer and utilization of the anti-leaf rust gene Lr19.

[0071] The gel electrophoresis detection results of the molecular marker Lsdau-7 in the BC1F2 population samples are as Figure 1 shown, and the phenotypic identification of leaf rust resistance is as Figure 2 shown. The gel electrophoresis detection results of the molecular marker YXsdau-9 in the BC1F2 population samples are as Figure 3 shown, and the phenotypic identification of leaf rust resistance is as Figure 4 shown.

[0072] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A molecular marker for detecting the leaf rust resistance gene Lr19, characterized in that, The molecular marker is at least one of molecular marker Lsdau-7 and molecular marker YXsdau-9; The nucleotide sequence of molecular marker Lsdau-7 is shown in SEQ ID NO.1; the nucleotide sequence of molecular marker YXsdau-9 is shown in SEQ ID NO.

2.

2. Application of the molecular marker according to claim 1 in the following (1) or (2): (1) Identifying the resistance of plant planting resources to leaf rust; (2) Molecular marker-assisted breeding of wheat resistant to leaf rust.

3. A primer combination for specifically detecting the leaf rust resistance gene Lr19, characterized in that, Comprising: The first primer pair for amplifying molecular marker Lsdau-7 and the second primer pair for amplifying molecular marker YXsdau-9; The nucleotide sequences of the first primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequences of the second primer pair are shown in SEQ ID NO.5 and SEQ ID NO.

6.

4. Application of the primer combination according to claim 3 in the following (1) or (2): (1) Identifying the resistance of plant planting resources to leaf rust; (2) Molecular marker-assisted breeding of wheat resistant to leaf rust.

5. A method for identifying or assisting in the identification of wheat resistance to leaf rust, characterized in that, Comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, performing PCR amplification using at least one of the first primer pair and the second primer pair, detecting the amplification product by gel electrophoresis, and identifying the leaf rust resistance of the wheat according to the size of the amplification band.

6. The method according to claim 5, wherein The system for PCR amplification is: 1 μL of DNA template, 10 μL of 2×TaqMaster Mix, 1 μL each of the forward primer and the reverse primer with a concentration of 10 μmol / L, and adding water to 20 μL.

7. The method according to claim 6, wherein The reaction program for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 10 min.

Images