Molecular marker, primer pair, kit and method for identifying watermelon seed size character and application

Abstract

The invention discloses a molecular marker, a primer pair, a kit and a method for identifying the size character of watermelon seeds and application, and belongs to the technical field of molecular marker-assisted breeding. The invention provides a molecular marker (as shown in SEQ ID NO.1-2), a primer pair (as shown in SEQ ID NO.3-4) and a kit containing the primer pair for identifying the size character of watermelon seeds in order to identify the size character of the watermelon seeds more quickly and more accurately in the watermelon seedling stage and realize watermelon germplasm resource screening and molecular assisted selection breeding. According to the identification method provided by the invention, the to-be-detected watermelon genome DNA is extracted in the seedling stage, so that molecular marker-assisted selection can be performed on the watermelon seed size character, the operation is simple and convenient, the breeding accuracy and efficiency are improved, the variety breeding period is shortened, and the variety breeding process is accelerated.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular marker-assisted breeding, and specifically relates to a molecular marker, primer pair, kit, method and application for identifying the seed size trait of watermelon seeds. Background Art

[0002] Watermelon (Citrullus lanatus (Thunb.) Matsum & Nakai) is one of the main cucurbitaceous vegetable crops and is widely cultivated worldwide. Watermelon occupies an important position in the fruit and vegetable production in China. Seed size is an important agronomic trait during the domestication and reproduction of plants. Especially in crops where seeds are the main product organs, seed size is an important factor affecting plant adaptability, reproductive ability, crop yield, and fruit quality. Generally, large seeds can store more nutrients and endogenous hormones, which is beneficial to seed germination and seedling growth, forming strong plants, and thus improving fruit quality and yield; small seeds have more advantages in terms of reproduction and natural spread due to their small size and light weight.

[0003] According to the different edible organs, watermelons can be divided into seed watermelons and flesh watermelons; among them, seed watermelons aim at large seeds for breeding, and large seeds are beneficial for planting, rich in nutrients and can meet the demand for eating seed kernels; flesh watermelons aim at small seeds or seedless for breeding. The smaller the seeds, the larger the proportion of edible pulp; therefore, regardless of the use of watermelons, seed size is an extremely important breeding goal. Exploring the key major loci of watermelon seed size traits and applying them to germplasm resource screening and molecular breeding processes is of great significance.

[0004] Compared with model crops and field crops, the map-based cloning of genes regulating watermelon seed size traits and the research on their action mechanisms are still in the primary stage. Although domestic and foreign scholars have carried out a large number of genetic analyses of seed size and gene / QTL mapping, etc., due to the rich variation in watermelon seed size, different regulatory genes / QTLs are screened under different genetic backgrounds. Therefore, those skilled in the art are eager to develop a molecular marker for identifying watermelon seed size traits and use the molecular marker to achieve watermelon germplasm resource screening and molecular-assisted selection breeding. Summary of the Invention

[0005] In order to more quickly and accurately identify the seed size trait of watermelon at the seedling stage, the present invention provides a molecular marker, primer pair, kit, method and application for identifying the seed size trait of watermelon seeds.

[0006] One of the objectives of the present invention is to provide a molecular marker for identifying the size trait of watermelon seeds. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2, and the genotype at the 105th base of the nucleotide sequence of the molecular marker is T or C.

[0007] Another objective of the present invention is to provide a primer pair for amplifying and identifying the size trait of watermelon seeds. The nucleotide sequence of the primer pair is shown as SEQ ID NO.3 and SEQ ID NO.4.

[0008] A further objective of the present invention is to provide a kit for identifying the size trait of watermelon seeds, and the kit includes the above primer pair.

[0009] Another objective of the present invention is to provide the application of the above molecular marker, primer pair or kit in identifying the size trait of watermelon seeds.

[0010] Another objective of the present invention is to provide the application of the above molecular marker, primer pair or kit in the auxiliary identification, auxiliary breeding and screening of the size trait of watermelon seeds.

[0011] In a preferred embodiment of the present invention, in the size trait of watermelon seeds, the seed length range of the large-seed trait is 9.11 - 13.04 mm, and the seed length range of the small-seed trait is 6.42 - 8.76 mm.

[0012] Another objective of the present invention is to provide a method for identifying the size trait of watermelon seeds. The method includes the following steps:

[0013] S1: Using the young and tender leaves of the watermelon to be detected as the material, extracting the genomic DNA of the watermelon;

[0014] S2: Using the DNA obtained in S1 as the template, performing PCR amplification with the above primer pair to obtain a PCR amplification product;

[0015] S3: Purifying the PCR amplification product obtained in S2, performing Sanger sequencing on the purified PCR amplification product, and judging the size trait of the watermelon seeds according to the sequencing results.

[0016] In a preferred embodiment of the present invention, the PCR amplification system in S2 is as follows: 1 μL of each of the upstream and downstream primers, the primer concentration is 10 μM, 1 μL of the DNA template, the DNA template concentration is 50 ng / μL, 4 μL of 2×Taq MasterMix, and 3 μL of sterile deionized water; the PCR amplification program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 56°C for 45 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min, and preservation at 4°C.

[0017] In a preferred embodiment of the present invention, the sequencing result judgment criterion in S3 is as follows: if the sequencing result of the amplification product is the nucleotide sequence fragment shown in SEQ ID NO.1, it is determined that the watermelon variety to be tested is the small-seed type; if the sequencing result of the amplification product is the nucleotide sequence fragment shown in SEQ ID NO.2, it is determined that the watermelon variety to be tested is the large-seed type.

[0018] In a preferred embodiment of the present invention, the seed length range of the small-seed type is 6.42 - 8.76 mm, and the seed length range of the large-seed type is 9.11 - 13.04 mm.

[0019] Beneficial effects of the present invention: The present invention uses watermelon lines K2 and L1 as parents, hybridizes to obtain F1, and constructs a genetic population; uses the whole-genome resequencing technology combined with the F2 population to construct a high-density genetic map, and obtains a chromosome segment closely linked to the watermelon seed size trait; through phenotypic identification and QTL (Quantitative Trait Loci) analysis in the genetic population, and expanding the F2 population for recombinant single-plant screening, a QTL locus closely related to the watermelon seed size trait is mapped on chromosome 2 of watermelon, and the candidate interval of the above QTL locus is mapped within a segment of 91.4 kb (33,387,525 - 33,478,951 bp) on chromosome 2.

[0020] Based on the watermelon genome 97103V2, the present invention discovers a C / T mutation at the 115th base in the 8th exon region of the Cla97C02G045370 gene (the 2042nd base of the Cla97C02G045370 gene has an SNP mutation) by comparing the parental sequences of K2 and L1; develops a molecular marker using the above C / T SNP mutation, names the molecular marker ClSS, and the nucleotide sequence of the ClSS molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2; the present invention also provides a primer pair (the nucleotide sequence is shown as SEQ ID NO.3 - 4) for amplifying and identifying the watermelon seed size trait and a kit containing the above primer pair.

[0021] Through the ClSS molecular marker, primer pair or kit provided by the present invention, genomic DNA of the sample to be tested can be extracted at the seedling stage of watermelon to perform molecular marker-assisted selection on the watermelon seed size trait, improving the accuracy and efficiency of breeding. The molecular marker, primer pair and kit provided by the present invention can be applied to the screening of the watermelon seed size trait, improving the accuracy of selective breeding, shortening the variety breeding cycle, and accelerating the variety cultivation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1Phenotype diagrams of the parental, F1, and F2 genetic populations in Example 1; A is the phenotype diagram of the parents; B is the phenotype diagram of the seeds of the parental, F1, and F2 genetic populations;

[0023] Figure 2 Gene mapping results of watermelon seed size traits in Example 1; A is the Join Map result of the preliminary gene mapping; B is the result of the preliminary gene mapping; C is the result of the fine gene mapping;

[0024] Figure 3 Alignment diagram of the nucleotide polymorphisms of the Cla97C02G045370 gene in Example 1; among them, Exon is the exon, the Eighth exon is the eighth exon, Single base mutation is the single-base mutation, and Intron is the intron;

[0025] Figure 4 Sanger sequencing alignment result diagram of SNP mutation sites in the watermelon natural population in Example 4, where the red box is the C / T SNP mutation site. Detailed implementation manners

[0026] Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate changes and combinations to the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0027] In order to make the purpose, technical solutions, and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in combination with specific implementation manners. The experimental methods used in the following examples are all conventional methods unless otherwise specified, and the materials, reagents, methods, and instruments used are all conventional materials, reagents, methods, and instruments in this field unless otherwise specified, and those skilled in the art can obtain them through commercial channels.

[0028] The steps of extracting DNA by the improved CTAB method in the following examples are as follows:

[0029] S1: Take the young and tender leaves of the watermelon to be tested at the two-leaf and one-heart stage as materials, place them in a 2 mL centrifuge tube, bring them back to the laboratory using an ice pack, and dry them using a vacuum freeze-drying machine. After drying, use a grinder to grind them into a powder;

[0030] S2: Add 1000 μL of CTAB solution (added with 2% β-mercaptoethanol) preheated in a 65 °C water bath for 1 h to the ground centrifuge tube in S1, shake it to ensure full contact between the powder and the liquid, place it in a 65 °C water bath for 1 h, and mix it up and down 3 - 4 times during this period;

[0031] S3: After cooling to room temperature, centrifuge at 4 °C and 12000 r / min for 20 min, transfer the supernatant to a new 2 mL centrifuge tube, add 900 μL of the mixture (chloroform and isoamyl alcohol are mixed according to a volume ratio of 24:1), shake well, centrifuge at 4 °C and 12000 r / min for 30 min, and repeat this step 2 more times;

[0032] S4: Pipette 600 - 700 μL of the supernatant after centrifugation in S3 into a 1.5 mL centrifuge tube, add 700 μL of anhydrous ethanol pre-cooled at 4 °C, shake well, precipitate at 4 °C for 1 h; centrifuge at 4 °C and 12000 r / min for 30 min, aspirate the supernatant, and retain the precipitate;

[0033] S5: Wash the precipitate obtained in S4 2 - 3 times with 75% ethanol, air-dry at room temperature, add distilled water to make up the volume to 50 μL to obtain the watermelon DNA sample to be tested.

[0034] Example 1: A molecular marker for identifying the size traits of watermelon seeds

[0035] (1) Selection of test materials:

[0036] The test materials described include female parent, male parent, F1 generation and F2 generation populations;

[0037] The male parent material is: K2, and the seed length range is 8.13 ± 0.10 mm;

[0038] The female parent material is: L1, and the seed length range is 9.11 ± 0.27 mm;

[0039] The above female parent and male parent materials are both publicly available in Liang XX, Gao ML*, Amanullah S, Guo Y, Liu XJ, Xu HG, Liu JX, Gao Y, Yuan CZ, Luan FS (2022) Identification of QTLs linked with watermelon fruit and seed traits using GBS-based high-resolution genetic mapping. Scientia Horticulturae 303:111237.

[0040] The F1 generation population is as follows: 120 F1 generation plants were obtained by crossing the above-mentioned K2 and L1 as parents.

[0041] The F2 generation population is as follows: The F2 generation population obtained by self-crossing the above-mentioned F1 generation, and 1249 F2 generation plants were sown in greenhouses and open fields in the spring of 2016 respectively.

[0042] (2) Phenotypic identification of the seed size of the test materials: Seeds in mature watermelon fruits were collected, dried, and 20 plump seeds were selected from each fruit. The length of the seeds was measured using a vernier caliper, and the phenotypes of the parents K2 and L1, and the F1 and F2 genetic populations were statistically analyzed. The results are as Figure 1 shown.

[0043] (3) By re-sequencing the whole genomes of the two parents and constructing a high-density genetic map using the F2 generation population, chromosomal segments tightly linked to the watermelon seed size trait were obtained. Through phenotypic identification and QTL (Quantitative Trait Loci) analysis in the genetic population, and expanding the F2 population for screening of recombinant individuals, a QTL locus closely related to the watermelon seed size trait was mapped on chromosome 2 of watermelon. The candidate interval of the above QTL locus was mapped to a segment of 91.4 kb (33,387,525 - 33,478,951 bp) on chromosome 2. The gene mapping results are as Figure 2 shown.

[0044] A total of 11 annotated genes are included in the above 91.4 kb candidate segment. Based on the watermelon genome 97103V2, genotyping of each individual plant was performed in the parents K2 and L1, and the watermelon natural population (as shown in Table 1). Combining with the phenotypic data, it was found that there was only one SNP mutation (C / T mutation) at the locus Chr 02 - 33,429,760 on chromosome 2 of the watermelon genome, which was tightly linked to the seed size trait. This SNP mutation site was located at the 115th base in the 8th exon region of the Cla97C02G045370 gene (the 2042nd base of the Cla97C02G045370 gene). The alignment results of the nucleotide polymorphisms of the Cla97C02G045370 gene are as Figure 3 shown.

[0045] Table 1

[0046] Number Source Seed length (mm) Chr2: 33,429,760 (C / T) GWAS-12 Hungary 6.42 T GWAS-18 China 6.75 T GWAS-25 China 7.94 T GWAS-27 China 8.58 T GWAS-28 Spain 8.18 T GWAS-32 China 8.76 T GWAS-42 Italy 8.56 T GWAS-43 United States 8.23 T GWAS-157 China 8.62 T GWAS-161 China 8.44 T GWAS-113 Tunisia 12.4 C GWAS-114 China 12.36 C GWAS-116 China 12.43 C GWAS-117 China 12.2 C GWAS-120 China 12.64 C GWAS-121 China 12.94 C GWAS-124 China 12.48 C GWAS-125 United States 12.24 C GWAS-128 Syria 13.04 C GWAS-132 China 12.82 C

[0047] (4) Development of candidate molecular markers

[0048] A SNP mutation (C / T mutation) exists at the locus of Chr 02-33,429,760 on chromosome 2 of the above-mentioned watermelon genome. A molecular marker closely linked to watermelon seed size is developed and named ClSS. The ClSS molecular marker includes: a nucleotide fragment with the nucleotide sequence shown in SEQ ID NO.1 and the 105th base being T, and a nucleotide fragment with the nucleotide sequence shown in SEQ ID NO.2 and the 105th base being C; SEQ ID NO.1 is closely linked to the small-seed type trait, and SEQ ID NO.2 is closely linked to the large-seed type; the seed length range of the small-seed type is 6.42 - 8.76 mm, and the seed length range of the large-seed type is 9.11 - 13.04 mm.

[0049] SEQ ID NO.1:

[0050] TGTCGAGGGTGAACCACAAG AACTTCGTCAGTCTTATCGGTTTTTGTGAAGA AGCACAACCATTCACTAGGATGATGGTTTTTGAATATGCTCCAAATGGAACT

T

[0051] SEO ID NO.2:

[0052] TGTCGAGGGTGAACCACAAG AACTTCGTCAGTCTTATCGGTTTTTGTGAAGA AGCACAACCATTCACTAGGATGATGGTTTTTGAATATGCTCCAAATGGAACT

C

[0053] Example 2: A primer pair for amplifying and identifying watermelon seed size traits

[0054] According to the ClSS molecular marker closely linked to watermelon seed size obtained in Example 1, a primer pair for amplifying and identifying the watermelon seed size trait was designed. Specifically, a SNP mutation (C / T mutation) existing at the locus Chr02-33,429,760 on chromosome 2 of the watermelon genome screened in Example 1 was used for primer design, obtaining an upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and a downstream primer with the nucleotide sequence shown in SEQ ID NO.4;

[0055] SEQ ID NO.3: TGTCGAGGGTGAACCACAAG;

[0056] SEQ ID NO.4: CTCCCAGTCCAAGTGCTCAG.

[0057] Example 3: A method for identifying the watermelon seed size trait

[0058] S1: Take the young and tender leaves of the watermelon to be tested at the two-leaf and one-heart stage as materials, and extract the watermelon genomic DNA by the modified CTAB method;

[0059] S2: Using the DNA obtained in S1 as a template, perform PCR amplification with the upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.4 obtained in Example 2 to obtain a PCR product; the PCR amplification system is: 1 μL of each upstream and downstream primer, primer concentration of 10 μM, 1 μL of DNA template, DNA template concentration of 50 ng / μL, 4 μL of 2×Taq MasterMix, and 3 μL of sterile deionized water; the PCR amplification program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 56°C for 45 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min, and preservation at 4°C;

[0060] S3: Use 2% agarose gel electrophoresis to detect the PCR product obtained in S2, confirm whether the target band (237 bp) appears in the PCR product, purify the PCR product with the target band, send the purified PCR product to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing, and judge the watermelon seed size trait to be tested according to the sequencing results;

[0061] The judgment standard for the sequencing results is: if the sequencing result of the amplification product contains the fragment shown in SEQ ID NO.1 (the 105th base is T), it is determined that the watermelon variety to be tested is a small-seed type; if the sequencing result of the amplification product contains the fragment shown in SEQ ID NO.2 (the 105th base is C), it is determined that the watermelon variety to be tested is a large-seed type.

[0062] The identification method provided by the present invention can be used to judge the seed size trait of watermelon at the seedling stage, and the sampling time is the stage of two leaves and one heart; while conventional breeding requires measuring the seed size after the fruit matures. It can be seen that the identification method provided by the present invention can effectively shorten the breeding time and accelerate the breeding speed.

[0063] Example 4:

[0064] To judge the accuracy of the ClSS molecular marker obtained in Example 1, the primer pair obtained in Example 2, and the identification method obtained in Example 3 for watermelon seed size identification, 20 watermelon varieties were randomly selected from the watermelon natural population as test samples in this example; among them, 20 watermelon varieties consisted of 10 watermelon materials with seed length less than 9 mm (small seed type) and 10 watermelon materials with seed length greater than 9 mm (large seed type).

[0065] The method described in Example 3 was used to identify the seed size of each sample, and at the fruit maturity stage, the field phenotypic data of the seed size were measured, including the seed length (as shown in Table 1).

[0066] In this example, the genomic DNA of 20 watermelon varieties in the above-mentioned watermelon natural population was extracted respectively. The primer pair obtained in Example 2 was used to perform PCR amplification on the genomic DNA of the above samples respectively to obtain PCR products; 2% agarose gel electrophoresis was used to detect the obtained PCR products respectively, and the PCR products showing the target band (237 bp) were purified. The purified PCR products were sent to Sangon Biotech Co., Ltd. for Sanger sequencing, and the seed size traits of the watermelons to be detected were judged according to the sequencing results.

[0067] The natural population materials are publicly available in the following article: Liang XX, Gao ML*, Amanullah S, Guo Y, Xu HG, Liu XS, Liu XJ, Liu JX, Gao Y, Yuan CZ, Wang XZ, Luan FS (2022) Molecular mapping of candidate gene regulating fruit stripe trait in watermelon. Euphytica 218, 174.

[0068] The results are as Figure 4As shown, among the 20 watermelon natural populations, the 105th base of the Sanger sequencing results of GWAS-12, GWAS-18, GWAS-25, GWAS-27, GWAS-28, GWAS-32, GWAS-42, GWAS-43, GWAS-157, and GWAS-161 is T. According to the Sanger sequencing results, the above watermelon varieties are determined to be small-seed types; the 105th base of the Sanger sequencing results of GWAS-113, GWAS-114, GWAS-116, GWAS-117, GWAS-120, GWAS-121, GWAS-124, GWAS-125, GWAS-128, and GWAS-132 is C. According to the Sanger sequencing results, the above watermelon varieties are determined to be large-seed types.

[0069] According to the actual measurement of the seed size of the watermelon natural population, the variation range of the seed length of the GWAS-12, GWAS-18, GWAS-25, GWAS-27, GWAS-28, GWAS-32, GWAS-42, GWAS-43, GWAS-157, and GWAS-161 watermelon natural populations is 6.42 - 8.76 mm; the variation range of the seed length of the GWAS-113, GWAS-114, GWAS-116, GWAS-117, GWAS-120, GWAS-121, GWAS-124, GWAS-125, GWAS-128, and GWAS-132 watermelon natural populations is 12.2 - 13.04 mm.

[0070] Therefore, the watermelon seed size traits determined according to the Sanger sequencing results are highly consistent with the actual seed sizes of the 20 watermelon natural populations, and the molecular marker identification results are consistent with the actual seed size trait results. Furthermore, it is proved that the ClSS molecular marker provided in Example 1, the primer pair provided in Example 2, and the method provided in Example 3 are feasible and accurate, and can be applied to the molecular identification of watermelon seed size properties at the seedling stage.

[0071] Example 5: A kit for identifying watermelon seed size traits

[0072] A kit for identifying watermelon seed size traits includes the following reagents: the upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.4 described in Example 2 (primer concentration is 10 μM), 2×Taq MasterMix, and sterile deionized water.

[0073] The content not described in detail in the specification of the present invention is well-known technology to those skilled in the art. Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and decorations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A molecular marker for identifying the size trait of watermelon seeds, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2, and the genotype at the 105th base of the nucleotide sequence of the molecular marker is T or C.

2. A primer pair for amplifying and identifying watermelon seed size traits, characterized in that, The nucleotide sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.

4.

3. A kit for identifying the size trait of watermelon seeds, characterized in that, The kit includes the primer pair described in claim 2.

4. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in identifying the watermelon seed size trait.

5. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in the auxiliary identification, auxiliary breeding, and screening of the watermelon seed size trait.

6. The application according to any one of claims 4 or 5, characterized in that In the watermelon seed size trait, the seed length range of the large seed trait is 9.11 - 13.04 mm, and the seed length range of the small seed trait is 6.42 - 8.76 mm.

7. A method for identifying the size trait of watermelon seeds, characterized in that, The method includes the following steps: S1: Using the young leaves of the watermelon to be detected as the material, extract the genomic DNA of the watermelon; S2: Using the DNA obtained in S1 as the template, perform PCR amplification with the primer pair described in claim 2 to obtain a PCR amplification product; S3: Purify the PCR amplification product obtained in S2, perform Sanger sequencing on the purified PCR amplification product, and judge the watermelon seed size trait according to the sequencing results.

8. The method according to claim 7, characterized in that, The PCR amplification system in S2 is as follows: 1 μL of each of the upstream and downstream primers, the primer concentration is 10 μM, 1 μL of the DNA template, the DNA template concentration is 50 ng / μL, 4 μL of 2×Taq MasterMix, and 3 μL of sterile deionized water; the PCR amplification program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 56°C for 45 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min, and store at 4°C.

9. The method according to claim 7, wherein The sequencing result judgment criteria in S3 are as follows: If the sequencing result of the amplification product is the nucleotide sequence fragment shown as SEQ ID NO.1, it is determined that the watermelon variety to be detected is of the small seed type; If the sequencing result of the amplification product is the nucleotide sequence fragment shown as SEQ ID NO.2, it is determined that the watermelon variety to be detected is of the large seed type.

10. The method according to claim 9, characterized in that, The seed length range of the small seed type is 6.42 - 8.76 mm, and the seed length range of the large seed type is 9.11 - 13.04 mm.

Images