Kit for detecting S gene mutation of feline infectious peritonitis virus and use method

Abstract

The invention discloses a detection kit for S gene mutation of feline infectious peritonitis virus and a use method. A primer for detecting S gene mutation adopts ARMS-PCR combined with an LNA technology, a mutation primer is designed aiming at a mutation basic group, and the mutation primer is completely matched with a mutation sequence and is mismatched with the 3'tail end of a wild type template; the 3'terminal basic group of the mutation primer is modified by LNA, and the specificity level of the primer is improved, so that the mutation primer only amplifies the corresponding mutation type template, and if the mutation primer is combined with the wild type template, the amplification efficiency is extremely low or the amplification cannot be realized, thereby realizing the detection of the low-content mutation sequence under the background of the high wild type gene. Due to the fact that the mutation rate of the base in the S region is high, the Taqman-MGB probe is adopted, the length of the probe sequence is shortened, the specificity of the Taqman-MGB probe is increased, hypoxanthine modification is conducted on the base with high SNP in the probe sequence, mutation of the base with the high SNP in the probe sequence is reduced, and missing detection is avoided. The ARMS-PCR technology is combined with the Taq-MGB real-time fluorescence PCR method, so that the result can be judged according to a real-time fluorescence amplification curve, and subsequent operation is not needed.

Description

Technical Field

[0001] The present application relates to a kit for detecting mutations in the S gene of feline infectious peritonitis virus and a method for use thereof, belonging to the technical field of gene detection. Background Art

[0002] Feline coronavirus (FCoV) has two biotypes: feline enteric coronavirus (FECV) and feline infectious peritonitis virus (FIPV). FECV causes subclinical infection, while FIPV causes feline infectious peritonitis (FIP), a systemic and fatal disease. This disease is one of the most concerning infectious diseases for cats, especially young cats, with a high mortality rate.

[0003] Feline coronavirus (FCoV) infection occurs frequently in cats worldwide. Despite its high infection rate, only a subset of infected cats develop symptoms of FIP. Studies have shown that mutations in FECV can lead to macrophage infection, resulting in FIP. While FIPV is morphologically and serologically similar to FECV, its high virulence leads to the development of the fatal feline infectious peritonitis disease, causing infected cats to display the characteristic symptoms of fibrinous peritonitis: the accumulation of large amounts of ascites.

[0004] The main reason for the change from the harmless enteric biotype (FECV) to the pathogenic variant (FIPV) is mutations that lead to a change in the tropism of enterocytes towards macrophages, enabling infection and efficient replication within the macrophage cell lineage. Studies have found that two mutations in the S gene, at nucleotides 23531 and 23537, result in the substitution of a methionine codon at position 1058 (M1058L) of the spike protein with a leucine codon, and a serine codon at position 1060 (S1060A) with an alanine codon, respectively, and are believed to be the cause of genotype conversion and enhanced macrophage tropism. These two mutations are associated with the FIP phenotype in more than 95% of cases, and given the importance of the coronavirus S protein fusion peptide in cell entry, these findings can reasonably explain the change in viral tropism.

[0005] Currently, sequencing is the primary method for detecting mutations in the S gene of feline infectious peritonitis virus (FIPV). This method is complex, time-consuming, has low sensitivity, and is expensive, which has certain limitations in clinical testing.

[0006] In view of this, this application is filed. Summary of the Invention

[0007] The purpose of the present application is to provide a kit and method for detecting S gene mutations of feline infectious peritonitis virus, so as to accurately, effectively, simply and efficiently detect the S gene mutation sites of feline infectious peritonitis virus.

[0008] To achieve the above object, the present invention provides the following technical solutions: In a first aspect, the present application provides a kit for detecting S gene mutations of feline infectious peritonitis virus, comprising: PCR amplification reaction solution A, PCR amplification reaction solution B and RNA extraction reagent; The PCR amplification reaction solution A includes a first primer-probe group, a second primer-probe group and a third primer-probe group for detecting a first target fragment; wherein, the first target fragment is the S gene 23537 site (c.23537T>G); The PCR amplification reaction solution B includes a fourth primer-probe group for amplifying a second target fragment-containing fragment and a fifth primer-probe group for amplifying a third target fragment-containing fragment; wherein, the second target fragment is the S gene 23531 site (c.23531A>T) of the mutation site, and the third target fragment is the S gene 23531 site (c. 23531A>C) of the mutation site.

[0009] In one or more feasible embodiments, the first primer-probe group includes: a universal upstream primer SEQ ID No.1, a downstream primer SEQ ID No.2 and a probe SEQ ID No.3 for specifically amplifying feline infectious peritonitis virus; and / or, The second primer-probe group includes: an internal reference gene upstream primer SEQ ID No.4, a downstream primer SEQ ID No.5 and a probe SEQ ID No.6; and / or, The third primer-probe group includes: an amplification upstream primer SEQ ID No.7, a downstream primer SEQ ID No.8 for detecting the first target fragment, and a probe SEQ ID No.9 specific to the first target fragment.

[0010] In one or more feasible embodiments, the fourth primer-probe group includes: an amplification upstream primer SEQ ID No.10, a downstream primer SEQ ID No.11 and the probe SEQ ID No.12 for specifically amplifying the second target fragment-containing fragment; and / or, The fifth primer-probe group includes: an amplification upstream primer SEQ ID No.13, a downstream primer SEQ ID No.11 and the probe SEQ ID No.14 for specifically amplifying the third target fragment-containing fragment.

[0011] In one or more feasible embodiments, one end of the probe SEQ ID No.3, the probe SEQ ID No.6, the probe SEQ ID No.9, SEQ ID No.12, and SEQ ID No.14 is labeled with a fluorescent group, and the other end is labeled with a quenching group corresponding to the fluorescent group.

[0012] In one or more feasible embodiments, the fluorescent group is selected from at least one of Cy5, CY5.5, Cy7, 6-FAM, HEX, ROX, and VIC, and the quenching group is selected from at least one of DABCYL, BHQ quenching agents, MGB, and MGB-SQ.

[0013] In one or more feasible embodiments, the PCR amplification reaction solution A and the PCR amplification reaction solution B further include Tris-HCl, MgCl2, KCl, hot start Taq enzyme, UNG enzyme, reverse transcriptase, dNTPs, dUTP, and PCR enhancer.

[0014] In one or more feasible embodiments, the PCR enhancer is selected from at least one of 0.1-2% Tween, 1-5% Ficoll 400, and 0.5-2% BSA.

[0015] In one or more feasible embodiments, the kit further includes a positive control solution containing S gene mutant sequence pseudovirus; and / or, the kit further includes a negative control solution containing S gene wild-type sequence pseudovirus; and / or, the RNA extraction reagent includes an RNA nucleic acid release agent.

[0016] In one or more feasible embodiments, the components of the RNA nucleic acid release agent include 5-10% EDTA-2Na, 5-50% PEG, 0.05-0.2% Triton-X100, and 0.05-0.4M NaOH.

[0017] In a second aspect, the present application provides a method for using the kit according to the first aspect. When detecting using the kit as described above, the method includes the following steps: Take the sample to be tested, add it to the RNA extraction reagent, mix well, perform instantaneous centrifugation, and let it stand to obtain the extracted sample; Add the extracted sample to the PCR amplification reaction solution A and the PCR amplification reaction solution B respectively for fluorescence quantitative PCR amplification to obtain the amplification result; Judgment is made based on the amplification result. If the Ct value of the internal reference detection is ≤ 40, then the negative and positive of the sample to be tested and the negative and positive of the S gene mutation are judged; if the Ct value of the universal primer probe amplification is ≤ 40, it is positive for FIPV; if the Ct value of the c.23537T>G primer probe and / or c.23531A>T and / or c.23531A>C primer amplification is ≤ 40, it means carrying the c.23537T>G and / or c.23531A>T and / or c.23531A>C mutation; otherwise, it does not carry the c.23537T>G and / or c.23531A>T and / or c.23531A>C mutation; if the Ct value of the universal primer probe amplification is > 40, it is negative for FIPV.

[0018] According to one or more embodiments of the present application, the beneficial effects of the present application are as follows: Simple and fast operation: The detection method of the present application only requires two steps of operation: First, use an RNA nucleic acid release agent to perform one-step nucleic acid extraction on the sample, and then directly add the extracted sample to the amplification reaction solution for closed-tube amplification, and judge the negative and positive according to the Ct value of the amplification result. There is no need to perform post-treatment on the amplification product, and there is no need to sequence to verify the result. The detection can be completed within only 40 minutes, significantly shortening the detection time.

[0019] Comprehensive detection of mutation sites: Three mutations, c.23531A>T, c.23531A>C, and c.23537T>G in the S gene, can be detected simultaneously in one experiment.

[0020] High specificity and easy result interpretation: The primers of the present invention adopt the ARMS-PCR combined with the LNA technology. The helical structure stability of the LNA enhances the affinity between the primer and the mutant sequence, making the primer bind more tightly to the template, reducing the probability of mismatch extension, and inhibiting non-specific amplification; at the same time, due to the poor base conservation of the FIPV S region, the Taqman-MGB probe is used to shorten the probe sequence length and increase its specificity. The detection result is automatically interpreted by the instrument, and the result is objective.

[0021] High sensitivity: When detecting the S mutation in the present invention, mutant samples with a concentration of 5 pg / μL, a mutation rate of 1% or even lower content can be detected, which is superior to the sensitivity of direct sequencing by 20%.

[0022] Low cost: In terms of detection equipment, only a small real-time fluorescence quantitative PCR instrument is required, and the cost is about 5,000 yuan. In terms of reagents, the operations of DNA extraction and purification are saved, and only one-step operation with an RNA nucleic acid release agent is adopted, correspondingly saving costs.

[0023] The above description is only an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and be implemented in accordance with the content of the specification, the following describes in detail with reference to the preferred embodiments of the present invention and the accompanying drawings. Description of the Drawings

[0024] Figure 1 It is an amplification result diagram of detecting a sample carrying the S gene c.23531A>T mutation using the kit of the present application in an embodiment of the present application; Figure 2 It is an amplification result diagram of detecting a sample carrying the S gene c. 23531A>C mutation using the kit of the present application in an embodiment of the present application; Figure 3 It is an amplification result diagram of detecting a sample carrying the S gene c.23537T>G and c.23531A>T mutations using the kit of the present application in an embodiment of the present application; Figure 4 It is an amplification result diagram of detecting a sample that is FIPV positive but does not carry the S gene mutation using the kit of the present application in an embodiment of the present application; Figure 5 It is an amplification result diagram of detecting a FIPV negative sample using the kit of the present application in an embodiment of the present application.

[0025] Figure 6 It is a sequencing result diagram of detecting a sample carrying the S gene c.23531A>T mutation using the kit of the present application in an embodiment of the present application.

[0026] Figure 7 It is a sequencing result diagram of detecting a sample carrying the S gene c.23531A>C mutation using the kit of the present application in an embodiment of the present application.

[0027] Figure 8 It is a sequencing result diagram of detecting a sample carrying the S gene c.23537T>G mutation using the kit of the present application in an embodiment of the present application. Detailed Embodiments

[0028] The following illustrates the embodiments of the present invention through specific specific examples. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, without conflict, the following embodiments and the features in the embodiments can be combined with each other.

[0029] It should be noted that in this application, "precision" refers to the degree of conformity between the measured or calculated quantity (test report value) and its actual (or true) value. Clinical precision refers to the ratio of true outputs (true positive (TP) or true negative (TN)) to misclassified outputs (false positive (FP) or false negative (FN)), and in addition to other measurements, can be expressed as sensitivity, specificity, positive predictive value (PPV) or negative predictive value (NPV), Matheus correlation coefficient (MCC), or likelihood ratio, odds ratio, receiver operating characteristic (ROC) curve, area under the curve (AUC).

[0030] For the diagnostic (or prognostic) interventions of this application, since each output (which may be TP, FP, TN, or FN in a disease classification diagnostic test) incurs different costs, the health economic utility function may be based on the clinical situation and individual output costs and values, preferably favoring sensitivity over specificity, or PPV over NPV, thus providing another measurement of the health economic performance and value, which may be different from the more direct clinical or analytical performance measurements. These different measurements and relative trade - offs will generally converge only in the case of a perfect test with a zero error rate (also known as zero misclassification of predicted object outputs or FP and FN), and all performance measurements will tend to be imperfect, but to different degrees.

[0031] "Measurement", "determination", "detection", or "examination" refers to evaluating the presence, absence, quantity, or amount (which can be an effective amount) of a given substance or a sample derived from an object in a clinical setting (including the derivative of the qualitative or quantitative concentration level of this substance), or otherwise evaluating the value or classification of a non - analyte clinical parameter or clinical - determinant of an object.

[0032] The term "mutation" in the context of this application refers to a change in the polynucleotide sequence of the wild - type, referring to the addition, deletion, and / or substitution of one or several (e.g., several) bases in the gene sequence or DNA sequence, resulting in a variant, which can be naturally occurring or non - naturally occurring. When the term "mutation" is used to describe the product or protein encoded by a gene, "mutation" refers to the addition, deletion, and / or substitution of one or several (e.g., several) amino acid residues in the said protein or encoded product.

[0033] The data in the context of this application all meet the statistical requirements (statistically significant). The so - called "statistically significant" means that the change is greater than what can be expected by chance alone (which can be a "false positive"). Statistical significance can be determined by any method known in the art. Commonly used measures of significance include the p - value, which represents the probability of obtaining at least the extreme value of the result at a given data point, assuming that the data point is a result of chance alone. When the p - value is 0.05 or less, the result is usually considered highly significant.

[0034] It should be noted that for those not specifying specific technologies or conditions in the following embodiments, they shall be in accordance with the technologies or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments not indicating the manufacturer, they are all conventional products that can be obtained by purchasing through regular channels.

[0035] In order to enable those in the technical field to better understand the solution of this application, the technical solutions in the embodiments of this application will be clearly and completely described below in conjunction with the accompanying drawings.

[0036] This application provides a kit for detecting S gene mutations of feline infectious peritonitis virus, including: PCR amplification reaction solution A, PCR amplification reaction solution B, and RNA extraction reagent; The PCR amplification reaction solution A includes a first primer-probe group, a second primer-probe group, and a third primer-probe group for detecting a first target fragment; wherein, the first target fragment is the 23537th site of the S gene (c.23537T>G); The PCR amplification reaction solution B includes a fourth primer-probe group for amplifying a second target fragment-containing fragment and a fifth primer-probe group for amplifying a third target fragment-containing fragment; wherein, the second target fragment is the 23531st site of the mutant S gene (c.23531A>T), and the third target fragment is the 23531st site of the mutant S gene (c. 23531A>C).

[0037] Optionally, the first primer-probe group includes: a universal upstream primer SEQ ID No.1, a downstream primer SEQ ID No.2, and a probe SEQ ID No.3 for specifically amplifying feline infectious peritonitis virus; and / or, The second primer-probe group includes: an internal reference gene upstream primer SEQ ID No.4, a downstream primer SEQ IDNo.5, and a probe SEQ ID No.6; and / or, The third primer-probe group includes: an amplification upstream primer SEQ ID No.7, a downstream primer SEQ ID No.8 for detecting the first target fragment, and a probe SEQ ID No.9 specific to the first target fragment.

[0038] Optionally, the fourth primer-probe group includes: an amplification upstream primer SEQ ID No.10, a downstream primer SEQ ID No.11, and the probe SEQ ID No.12 for specifically amplifying the second target fragment-containing fragment; and / or, The fifth primer-probe group includes: an amplification upstream primer SEQ ID No.13, a downstream primer SEQ ID No.11, and the probe SEQ ID No.14 for specifically amplifying the third target fragment-containing fragment.

[0039] Optionally, one end of the probe SEQ ID No.3, the probe SEQ ID No.6, the probe SEQ ID No.9, SEQ ID No.12, and SEQ ID No.14 is labeled with a fluorophore, and the other end is labeled with a quenching group corresponding to the fluorophore.

[0040] Optionally, the fluorophore is selected from at least one of Cy5, CY5.5, Cy7, 6-FAM, HEX, ROX, and VIC, and the quenching group is selected from at least one of DABCYL, BHQ quenching agents, MGB, and MGB-SQ.

[0041] Optionally, the PCR amplification reaction solution A and the PCR amplification reaction solution B further include Tris-HCl, MgCl2, KCl, hot start Taq enzyme, UNG enzyme, reverse transcriptase, dNTPs, dUTP, and a PCR enhancer.

[0042] Optionally, the PCR enhancer is selected from at least one of 0.1-2% Tween, 1-5% Ficoll 400, and 0.5-2% BSA.

[0043] Optionally, the kit further includes a positive control solution containing an S gene mutant sequence pseudovirus; and / or, the kit further includes a negative control solution containing an S gene wild-type sequence pseudovirus; and / or, the RNA extraction reagent includes an RNA nucleic acid release agent.

[0044] Optionally, the components of the RNA nucleic acid release agent include 5-10% EDTA-2Na, 5-50% PEG, 0.05-0.2% Triton-X100, and 0.05-0.4M NaOH.

[0045] It should be noted that the kit of the present application combines ARMS-PCR technology, Taq-MGB probe and LNA technology in its design, and can detect whether the S gene of feline infectious peritonitis virus carries M1058L and S1060A mutations. Specifically, ARMS-PCR is a commonly used gene mutation detection method in laboratories at present, which has the advantage of high detection sensitivity and can detect mutant genes with a mutation ratio of 1% or even lower in tumor cells. Using this method, mutant primers are designed for mutant bases. The mutant primers are completely matched with the mutant sequence and mismatched with the 3'-end of the wild-type template. Therefore, the mutant primers only amplify the corresponding mutant template, and the amplification efficiency is extremely low or no amplification occurs when combined with the wild-type template. In addition, the bases at the 3'-end of the mutant primers are modified with locked nucleic acid, which further improves the specificity level of the primers, thus realizing the detection of low-content mutant sequences under a high wild-type gene background. By using Taq-MGB probe, the specificity can be increased by shortening the probe sequence length, and hypoxanthine modification is carried out on the bases with high SNPs in the probe sequence, reducing the mutation of the bases with high SNPs in the probe sequence during the amplification process. In addition, the helical structure stability of LNA enhances the affinity between the primer and the mutant sequence, makes the primer bind more tightly to the template, reduces the probability of mismatch extension, and inhibits non-specific amplification. By combining ARMS-PCR technology, Taq-MGB probe and LNA technology, it is beneficial to directly judge the result according to the real-time fluorescence amplification curve without subsequent operations, and the result is easy to interpret, and the detection process is more simple and fast.

[0046] The kit for detecting S gene mutations of feline infectious peritonitis virus provided by the present application has optimized the specificity of primers and probes, and has carried out rigorous comparative tests in many aspects such as design, screening, and combination. Finally, a combination that does not interfere with each other and has high amplification efficiency is selected, ensuring accurate, sensitive and comprehensive detection of samples under a multiplex system. At the same time, it is simple and fast in operation, and the result is easy to interpret, so as to accurately, effectively, simply and efficiently detect the S gene mutation site of feline infectious peritonitis virus.

[0047] Based on the above situation, the present application also provides a method for detecting S gene mutations of feline infectious peritonitis virus, which is detected by using the kit as described above. The method includes the following steps: Take the sample to be tested, add it to the RNA extraction reagent and mix well, perform instantaneous centrifugation, and let it stand to obtain the extracted sample; Add the extracted sample to PCR amplification reaction solution A and PCR amplification reaction solution B respectively for fluorescence quantitative PCR amplification to obtain the amplification result; Judgment is made according to the amplification result. If the Ct value of the internal reference detection is ≤ 40, then the negativity and positivity of the sample to be tested and the negativity and positivity of the S gene mutation are judged; if the Ct value of the universal primer-probe amplification is ≤ 40, it is positive for FIPV; if the Ct value of the primer-probe of c.23537T>G and / or c.23531A>T and / or c.23531A>C primer amplification is ≤ 40, it carries the mutation of c.23537T>G and / or c.23531A>T and / or c.23531A>C; otherwise, it does not carry the mutation of c.23537T>G and / or c.23531A>T and / or c.23531A>C; if the Ct value of the universal primer-probe amplification is > 40, it is negative for FIPV.

[0048] Optionally, in the step of analyzing according to the amplification result to obtain the detection result corresponding to the ascites sample, the amplification result includes the Ct value during the fluorescence quantitative PCR amplification, and the detection result can be directly obtained by analyzing according to the Ct value during the fluorescence quantitative PCR amplification. The analysis process includes: when the Ct value of the internal reference detection is ≤ 40, the negativity and positivity of the sample to be tested and the negativity and positivity of the S gene mutation can be judged; if the Ct value of the universal primer-probe amplification is ≤ 40, it is positive for FIPV; meanwhile, if the Ct value of the primer-probe of c.23537T>G and / or c.23531A>T and / or c.23531A>C primer amplification is ≤ 40, it carries the mutation of c.23537T>G and / or c.23531A>T and / or c.23531A>C; otherwise, it does not carry the mutation; if the Ct value of the universal primer-probe amplification is > 40, it is negative for FIPV.

[0049] This application uses a small real-time fluorescence quantitative PCR instrument. Through the Ct value during the fluorescence quantitative PCR amplification, the mutations of c.23531A>T, c.23531A>C, and c.23537T>G in the S gene can be detected simultaneously, and mutant samples with a concentration of 5 pg / μL, a mutation rate of 1% or even lower content can be detected. Compared with the traditional sequencing method, the detection of mutation sites is more comprehensive, the sensitivity is higher, and the detection cost is lower.

[0050] The present application will be further described in detail below with specific embodiments. Example 1:

[0051] Kit composition: (1) The kit of the present invention is a kit for detecting the S gene mutation of feline infectious peritonitis virus, including PCR amplification reaction solution A, PCR amplification reaction solution B, RNA nucleic acid release agent, positive control solution, and negative control solution. The specific components are shown in Table 1 below: Table 1: Kit components Component Specification Quantity Main component PCR Amplification Reaction Solution A 20 μL / tube 4 Primer probe for detecting FIPV universal type and S gene c.23537T>G mutation, Taq DNA polymerase, reverse transcriptase, UNG enzyme, dNTPs, dUTP, PCR amplification buffer, Mg2+, PCR enhancer, DEPC Water PCR Amplification Reaction Solution B 20 μL / tube 4 Primer probe for detecting S gene c.23531A>T, c.23531A>C mutations, Taq DNA polymerase, reverse transcriptase, UNG enzyme, dNTPs, dUTP, PCR amplification buffer, Mg2+, PCR enhancer, DEPC Water Positive control 50 μL / tube 1 Pseudovirus containing S gene c.23537T>G, c.23531A>T, c.23531A>C mutant sequences Negative control 50 μL / tube 1 Pseudovirus containing c.23537T>G, c.23531A>T, c.23531A>C wild-type sequences RNA Nucleic Acid Release Agent 1 mL / tube 1 EDTA-2Na, PEG, Triton-X100 and NaOH Specifically, the sequences and uses of each primer and probe are shown in Table 2 below: Table 2: Primer and Probe Sequences SEQ ID NO Sequence 5’-3’ Modification 1 ACAACACCTAAGAATGCCAACA 2 CTAGCACCATAGAAAGTTGTCACATCT 3 ACACACCTGGAAGAAAACTGCAGG 4 5`6-FAM, 3`DBQ1 5 TATGGCCGAGCAGATGC 6 CATGCGTTTGAGTTGGTGAG ACAACCGCATTGGAGACGTAGGCT 7 5`HEX, 3`DBQ1 TAGGTGGTATGGCTATGGGC / iXNA_G / 8 XNA 9 AGCCTAGCCTGCACTTGCATAG CTATTAC / ideoxyI / TC / ideoxyI / GCTGT / ideoxyI / GC 10 5`ROX-3`MGB TC / ideoxyI / TTAATAGG / ideoxyI / GGTATGGC / ideoxyI / / iXNA_T / 11 XNA 12 GCTATGCAAGTTCAGGCTAGAC CTATTAC / ideoxyI / TC / ideoxyI / GCTGT / ideoxyI / GC 13 5`6-FAM, 3`MGB GCATCCTTAATAGGAGGCATGGCT / iXNA_C / 14 XNA CTATTACATCAGCTGTCGCCG The above sequences 7, 10, and 13 further include non-standard DNA or RNA analogs, namely LNA, also known as "Locked nucleic acid" (LNA), which is a modified oligonucleotide derivative including six bases: A, C, G, T, U, and mC. Specifically, / iXNA_T / refers to the modification of base T; / iXNA_G / refers to the modification of base G; / iXNA_C / refers to the modification of base C, where XNA is a non-standard DNA and RNA analog. Due to the addition of XNA bases, its Tm value is increased, mismatch recognition is enhanced, and detection specificity is improved.

[0052] Among them, the above sequences 9, 10, and 12 further include / ideoxyI / , representing deoxyInosine, deoxyhypoxanthine. Replacing high degeneracy sites with deoxyhypoxanthine can reduce degeneracy, reduce the complexity of the primer mixture, thereby reducing non-specific amplification and improving amplification efficiency and specificity.

[0053] (2) The positive control solution is prepared as follows: Pseudoviruses containing the mutant sequences of S gene c.23537T>G, c.23531A>T, and c.23531A>C are dissolved in TE buffer and serially diluted to a total pseudovirus concentration of 5 pg / μL; (3) The negative control solution is prepared as follows: Pseudoviruses containing the mutant sequences of S gene c.23537T>G, c.23531A>T, and c.23531A>C are dissolved in TE buffer and serially diluted to a total pseudovirus concentration of 5 pg / μL.

[0054] Detection method: RNA extraction: Collect 20 ascites samples from pet hospitals. Add 100 μL of each sample to the RNA nucleic acid release agent, mix well, centrifuge instantaneously, and let stand for 5 min; this is the prepared sample for use.

[0055] PCR amplification: Add the above-prepared sample to PCR reaction solution A and PCR reaction solution B, with a loading volume of 2 μL. After loading, cover the tube cap and place it in a PCR amplifier to run the PCR amplification program; The PCR amplification conditions are shown in Table 3 below: Table 3: PCR Amplification Conditions

[0056] Selection of detection channels for real-time fluorescence quantitative PCR instrument: the fluorescence selected for tube A is FAM, VIC and ROX; the fluorescence selected for tube B is FAM and ROX.

[0057] Test results: The test results were judged based on the Ct value. Tube A detected the amplification of the internal reference using the VIC signal, the FIPV amplification using the FAM signal, and the FIPV S gene c.23537T>G mutation using the ROX signal. Tube B detected the amplification of the FIPV S gene c.23531A>T mutation using the FAM signal, and the FIPV S gene c.23531A>C mutation using the ROX signal. The role of the internal reference VIC signal in the reaction system of tube A: When the Ct of the internal reference amplification curve in the reaction system of tube A is greater than 40, it means that the added template contains PCR inhibitors or the concentration is insufficient. It is necessary to re-extract the template and repeat the experiment; 5`ROX-3`MGB The amplification results of different samples in the embodiment of the present application are shown in FIG. Figures 1 to 5 Figures 1 to 5 It can be seen that: When the internal reference amplification curve Ct in the reaction system of tube A is less than or equal to 40 and the FAM signal Ct is greater than 40, the sample to be tested can be judged to be FIPV negative; When the FAM signal in the reaction system of tube A presents an "S" curve and the internal reference amplification curve Ct≤40, the negative or positive of the FIPV S gene mutation in the sample can be judged: when the ROX signal Ct in the reaction system of tube A is ≤40, the FIPV S gene c.23537T>G mutation is positive; when the ROX signal Ct in the reaction system of tube A is >40, the FIPV S gene c.23537T>G mutation is negative; when the FAM signal Ct in the reaction system of tube B is ≤40, the FIPV S gene c.23531A>T mutation is positive; when the FAM signal Ct in the reaction system of tube B is >40, the FIPV S gene c.23531A>T mutation is negative; when the ROX signal Ct in the reaction system of tube B is ≤40, the FIPV S gene c.23531A>C mutation is positive; when the ROX signal Ct in the reaction system of tube A is >40, the FIPV S gene c.23531A>C mutation is negative.

[0058] Clinical sample testing: The primer and probe system designed in this invention was used to detect mutations in the feline FIPV S gene. The amplification results were sequenced and compared with standard sequences in a database to determine the gene mutation detection results. The detection results using this technology were completely consistent with those obtained through sequencing.

[0059] Example 2: Sensitivity analysis: The pseudoviruses of the FIPV S gene c.23537T>G, c.23531A>T, c.23531A>C 1% mutant samples with a concentration of 5 ng / μL after quantitative determination were diluted to concentrations of 500 pg / μL, 50 pg / μL, and 5 pg / μL respectively, and detected according to the detection method in Example 1. Three parallels were set in each reaction system. The results showed that the sensitivity of the present invention could detect the FIPV S gene c.23537T>G, c.23531A>T, c.23531A>C 1% mutant samples with a concentration of 5 pg / μL.

[0060] It can be seen from this that the present application provides a kit and method for detecting mutations in the S gene of feline infectious peritonitis virus. The primers and probes have been specifically optimized, and rigorous comparative tests have been carried out in many aspects such as design, screening, and combination. Finally, a combination that does not interfere with each other and has high amplification efficiency has been selected to ensure accurate, sensitive, and comprehensive detection of samples under a multiplex system. At the same time, it is simple, fast in operation, and the results are easy to interpret, so as to accurately, effectively, simply, and efficiently detect the mutation sites of the S gene of feline infectious peritonitis virus.

[0061] In practical applications, the kit of the present application combines the ARMS-PCR technology, Taq-MGB probe, and LNA technology in the design, and can detect whether the S gene of feline infectious peritonitis virus carries the M1058L and S1060A mutations. Specifically, ARMS-PCR is a commonly used method for detecting gene mutations in laboratories at present, which has the advantage of high detection sensitivity and can detect mutant genes with a mutation ratio of 1% or even lower in tumor cells. Using this method, mutant primers are designed for mutant bases. The mutant primers are completely matched with the mutant sequence and mismatched with the 3' end of the wild-type template. Therefore, the mutant primers only amplify the corresponding mutant template, and the amplification efficiency is extremely low or unable to amplify when combined with the wild-type template. In addition, the 3' end base of the mutant primer is modified with locked nucleic acid, which further improves the specificity level of the primer, thus realizing the detection of low-content mutant sequences under a high wild-type gene background. By using the Taq-MGB probe, the specificity can be increased by shortening the probe sequence length, and hypoxanthine modification is carried out on the bases with high SNPs in the probe sequence, reducing the mutation of the bases with high SNPs in the probe sequence during the amplification process. In addition, the helical structure stability of LNA enhances the affinity between the primer and the mutant sequence, makes the primer bind more tightly to the template, reduces the probability of mismatch extension, and inhibits non-specific amplification. By combining the ARMS-PCR technology, Taq-MGB probe, and LNA technology, it is beneficial to directly judge the results according to the real-time fluorescence amplification curve without subsequent operations, and the results are easy to interpret, and the detection process is more simple and fast.

[0062] Meanwhile, this application uses a small real-time fluorescence quantitative PCR instrument. By the Ct value during fluorescence quantitative PCR amplification, it can simultaneously detect the mutations of S gene c.23531A>T, c. 23531A>C and c.23537T>G, and can detect mutant samples with a concentration of 5 pg / μL, a mutation rate of 1% or even lower content. Compared with the traditional sequencing method, the detection of mutation sites is more comprehensive, the sensitivity is higher, and the detection cost is lower.

[0063] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of concise description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0064] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A kit for detecting S gene mutations of feline infectious peritonitis virus, characterized in that, Comprising: PCR amplification reaction solution A, PCR amplification reaction solution B, and RNA extraction reagent; The PCR amplification reaction solution A includes a first primer-probe group, a second primer-probe group, and a third primer-probe group for detecting a first target fragment; wherein, the first target fragment is the 23537th site of the S gene (c.23537T>G); The PCR amplification reaction solution B includes a fourth primer-probe group for amplifying a second target fragment-containing fragment and a fifth primer-probe group for amplifying a third target fragment-containing fragment; wherein, the second target fragment is the 23531st site of the mutant S gene (c.23531A>T), and the third target fragment is the 23531st site of the mutant S gene (c. 23531A>C).

2. The kit according to claim 1, wherein The first primer-probe group includes: a universal upstream primer SEQ ID No.1 for specifically amplifying feline infectious peritonitis virus, a downstream primer SEQ ID No.2, and a probe SEQ ID No.3; and / or, The second primer-probe group includes: an internal reference gene upstream primer SEQ ID No.4, a downstream primer SEQ ID No.5, and a probe SEQ ID No.6; and / or, The third primer-probe group includes: an amplification upstream primer SEQ ID No.7 for detecting the first target fragment, a downstream primer SEQ ID No.8, and a probe SEQ ID No.9 specific to the first target fragment.

3. The kit according to claim 2, wherein The fourth primer-probe group includes: an amplification upstream primer SEQ ID No.10 for specifically amplifying a fragment containing the second target fragment, a downstream primer SEQ ID No.11, and the probe SEQ ID No.12; and / or, The fifth primer-probe group includes: an amplification upstream primer SEQ ID No.13 for specifically amplifying a fragment containing the third target fragment, a downstream primer SEQ ID No.11, and the probe SEQ ID No.

14.

4. The kit according to claim 3, wherein One end of the probe SEQ ID No.3, the probe SEQ ID No.6, the probe SEQ ID No.9, SEQ ID No.12, and SEQ ID No.14 is labeled with a fluorophore, and the other end is labeled with a quenching group corresponding to the fluorophore.

5. The kit according to claim 4, wherein The fluorophore is selected from at least one of Cy5, CY5.5, Cy7, 6-FAM, HEX, ROX, and VIC, and the quenching group is selected from at least one of DABCYL, BHQ quenching agents, MGB, and MGB-SQ.

6. The kit according to claim 1, characterized in that, The PCR amplification reaction solution A and the PCR amplification reaction solution B further include Tris-HCl, MgCl2, KCl, hot start Taq enzyme, UNG enzyme, reverse transcriptase, dNTPs, dUTP, and PCR enhancer.

7. The kit according to claim 6, wherein The PCR enhancer is selected from at least one of 0.1-2% Tween, 1-5% Ficoll 400, and 0.5-2% BSA.

8. The kit according to claim 1, wherein The kit further includes a positive control solution, which contains a pseudovirus with an S gene mutant sequence; and / or, the kit further includes a negative control solution, which contains a pseudovirus with a wild-type S gene sequence; and / or, the RNA extraction reagent includes an RNA nucleic acid releasing agent.

9. The kit according to claim 8, wherein The components of the RNA nucleic acid releasing agent include 5-10% EDTA-2Na, 5-50% PEG, 0.05-0.2% Triton-X100, and 0.05-0.4 M NaOH.

10. A method for using the kit according to any one of claims 1 to 9, characterized in that, When detecting using the kit according to any one of claims 1 to 9, the method of use includes the following steps: Take the sample to be tested, add it to the RNA extraction reagent, mix well, perform transient centrifugation, and let it stand to obtain the extracted sample. Add the extracted sample to PCR amplification reaction solution A and PCR amplification reaction solution B respectively for fluorescence quantitative PCR amplification to obtain an amplification result. Make a judgment based on the amplification result. If the Ct value of the internal reference detection is ≤ 40, then judge the negative and positive of the sample to be tested and the negative and positive of the S gene mutation; if the Ct value of the universal primer probe amplification is ≤ 40, it is positive for FIPV; if the Ct value of the c.23537T>G primer probe and / or c.23531A>T and / or c.23531A>C primer amplification is ≤ 40, it carries the c.23537T>G and / or c.23531A>T and / or c.23531A>C mutation; otherwise, it does not carry the c.23537T>G and / or c.23531A>T and / or c.23531A>C mutation; if the Ct value of the universal primer probe amplification is > 40, it is negative for FIPV.

Images