Application of knockout PEP4 and BAR1 genes in reduction of lactoferrin degradation of kluyveromyces marxianus
By knocking out the PEP4 and BAR1 genes, CRISPR/Cas9 gene editing technology was used to inhibit protein degradation in Max Cluvia yeast, and the yield of lactoferrin was improved, solving the problem of high degradation of lactoferrin in the yeast expression system.
Patent Information
- Application Number
- CN202510546405.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-28
- Publication Date
- 2025-08-05
AI Technical Summary
In the prior art, when Max Kluvier is expressed, there is a problem that the amount of lactoferrin is degraded by high lactoferrin, resulting in a significant reduction in yield and cannot meet the demand for large-scale production.
By knocking out the PEP4 and BAR1 genes, CRISPR/Cas9 gene editing technology is used to inhibit the expression of PEP4 and BAR1 proteins and reduce the degradation of lactoferrin by yeast.
It significantly increased the complete protein amount of lactoferrin, increased the secretion and expression yield of lactoferrin in Max Kluvier, and solved the problem of lactoferrin degradation.
Smart Images

Figure HDA0005380869380000011 
Figure HDA0005380869380000012 
Figure HDA0005380869380000013
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to application of knocking out PEP4 and BAR1 genes in reducing the degradation of lactoferrin by Kluyveromyces marxianus. Background Art
[0002] Lactoferrin (LF) is a non-heme iron-binding glycoprotein widely distributed in mammalian milk, particularly colostrum, as well as in various other tissues and secretions, including tears, semen, bile, synovial fluid, and other endocrine and exocrine fluids, as well as neutrophils. Lactoferrin is a multifunctional protein with iron-binding / transferring, antibacterial, antiviral, antifungal, anti-inflammatory, and anticancer properties. This allows it to regulate cell growth, scavenge harmful free radicals, and inhibit the formation of several toxic compounds. These functional properties are closely dependent on the structural integrity of human lactoferrin, particularly its higher-order conformation. Lactoferrin also has the ability to regulate lipid metabolism, which not only enhances satiety mechanisms but also helps counteract the tendency for adipose tissue accumulation. Therefore, lactoferrin is considered a novel antibacterial and anticancer agent. Currently, lactoferrin is added to many commercial products, such as infant formula and nutritional supplements. Furthermore, due to its antioxidant activity, lactoferrin is often used as a key ingredient in cosmetics. As people pay more attention to health, scientific researchers have become increasingly interested in studying the functional activity of lactoferrin.
[0003] Currently, the most direct way to obtain lactoferrin is to isolate and extract it from cow's milk, but the lactoferrin content in cow's milk is low. Furthermore, the digestion and absorption of heterologous proteins by the human body may lead to certain negative effects, such as allergic reactions. To address these issues, researchers have used genetic engineering to construct engineered strains that can then ferment and produce large quantities of lactoferrin. Current host cells used for lactoferrin production include Escherichia coli, yeast, mammalian cells, and plant cells. As a prokaryotic model organism, E. coli has the advantages of low nutritional requirements, easy growth, and a short production cycle. However, it lacks well-formed organelles and a complete glycosylation modification system, making it incapable of producing biologically active target proteins. Mammalian and plant cells are also unsuitable as substrates for large-scale lactoferrin production due to their propensity to contamination, strict growth environment requirements, and long growth cycles.
[0004] Yeast cells can largely circumvent the aforementioned shortcomings. As the simplest eukaryotic organism, they possess the essential production conditions. After optimizing key components in the expression system, researchers discovered that as target protein expression levels increase, the cells secrete large amounts of proteases, which cause target protein degradation and significantly reduce its yield. Therefore, to increase target protein yield, the primary goal is to reduce target protein degradation and increase the yield of intact target protein. Summary of the Invention
[0005] In order to solve the above technical problems and alleviate the degradation of lactoferrin in Kluyveromyces marxianus, the present invention provides a method for knocking out the PEP4 and BAR1 genes, thereby achieving the purpose of reducing the degradation of lactoferrin by Kluyveromyces marxianus.
[0006] In a first aspect, the present invention claims the use of inhibiting the expression of PEP4 protein and BAR1 protein in any of the following:
[0007] (A1) reducing the degradation of lactoferrin by Kluyveromyces marxianus;
[0008] (A2) Reducing the degradation of lactoferrin by the fermentation supernatant of Kluyveromyces marxianus.
[0009] In a second aspect, the present invention claims the use of a substance capable of reducing the expression of PEP4 protein and BAR1 protein in Kluyveromyces marxianus in any of the following:
[0010] (A1) reducing the degradation of lactoferrin by Kluyveromyces marxianus;
[0011] (A2) Reducing the degradation of lactoferrin by the fermentation supernatant of Kluyveromyces marxianus.
[0012] Among them, the substance can be shRNA targeting the genes encoding the PEP4 protein and the BAR1 protein or a chemical modification of the shRNA, siRNA targeting the genes encoding the PEP4 protein and the BAR1 protein or a chemical modification of the siRNA, an expression vector or recombinant microorganism capable of expressing the shRNA or the siRNA, a gene editing tool targeting the genes encoding the PEP4 protein and the BAR1 protein (such as CRISPR / Cas technology, TALEN technology, etc.), etc.
[0013] In one embodiment of the present invention, the substance includes (or is) a CRISPR / Cas9 editing tool 1 targeting the gene encoding the PEP4 protein in the genome of the Kluyveromyces marxianus receptor bacteria, and a CRISPR / Cas9 editing tool 2 targeting the gene encoding the BAR1 protein in the genome of the Kluyveromyces marxianus receptor bacteria.
[0014] Furthermore, the target sequence of the CRISPR / Cas9 editing tool 1 is shown as SEQ ID No. 5; the target sequence of the CRISPR / Cas9 editing tool 2 is shown as SEQ ID No. 10.
[0015] More specifically, the CRISPR / Cas9 editing tool 1 specifically includes a recombinant vector 1 and a homologous recombination fragment 1; the recombinant vector 1 is capable of expressing Cas9 protein and a gRNA targeting the gene encoding the PEP4 protein in the genome of the Kluyveromyces marxianus recipient bacteria; the homologous recombination fragment 1 is composed of an upstream homology arm 1 and a downstream homology arm 1 from the 5' end to the 3' end. Furthermore, in the recombinant vector 1, the coding sequence of the spacer for expressing the gRNA is CCCACAAGAAACATTCTCCA (SEQ ID No. 5). Furthermore, the nucleotide sequence of the upstream homology arm 1 is shown in SEQ ID No. 3; the nucleotide sequence of the downstream homology arm 1 is shown in SEQ ID No. 4. The CRISPR / Cas9 editing tool 2 specifically includes a recombinant vector 2 and a homologous recombination fragment 2; the recombinant vector 2 is capable of expressing Cas9 protein and a gRNA targeting the gene encoding the BAR1 protein in the genome of the Kluyveromyces marxianus recipient bacteria; the homologous recombination fragment 2 is composed of an upstream homology arm 2 and a downstream homology arm 2 from the 5' end to the 3' end. Furthermore, in the recombinant vector 2, the coding sequence of the spacer for expressing the gRNA is AGTTTGCCACCTCTACGTCA (SEQ ID No. 10). Furthermore, the nucleotide sequence of the upstream homology arm 2 is shown in SEQ ID No. 8; the nucleotide sequence of the downstream homology arm 2 is shown in SEQ ID No. 9.
[0016] In a third aspect, the present invention claims a method for reducing the ability of Kluyveromyces marxianus or its fermentation supernatant to degrade lactoferrin.
[0017] The method claimed in the present invention for reducing the ability of Kluyveromyces marxianus or its fermentation supernatant to degrade lactoferrin may include the following steps: inhibiting the expression of genes encoding PEP4 protein and BAR1 protein in the Kluyveromyces marxianus recipient bacteria, thereby reducing the ability of Kluyveromyces marxianus or its fermentation supernatant to degrade lactoferrin.
[0018] In the method, inhibiting the expression of the gene encoding the PEP4 protein in the Kluyveromyces marxianus recipient strain can be achieved by CRISPR / Cas9 gene editing technology. Inhibiting the expression of the gene encoding the BAR1 protein in the Kluyveromyces marxianus recipient strain can be achieved by CRISPR / Cas9 gene editing technology.
[0019] Furthermore, the expression of the gene encoding the PEP4 protein in the Kluyveromyces marxianus recipient bacteria is inhibited by introducing the CRISPR / Cas9 editing tool 1 into the Kluyveromyces marxianus recipient bacteria. In one embodiment of the present invention, the target sequence of the CRISPR / Cas9 editing tool 1 is shown in SEQ ID No. 5. Specifically, the CRISPR / Cas9 editing tool 1 specifically includes a recombinant vector 1 and a homologous recombination fragment 1; the recombinant vector 1 is capable of expressing the Cas9 protein and a gRNA targeting the gene encoding the PEP4 protein in the genome of the Kluyveromyces marxianus recipient bacteria; the homologous recombination fragment 1 is composed of an upstream homology arm 1 and a downstream homology arm 1 from the 5' end to the 3' end. Furthermore, in the recombinant vector 1, the coding sequence of the spacer for expressing the gRNA is CCCACAAGAAACATTCTCCA (SEQ ID No. 5). Furthermore, the nucleotide sequence of the upstream homology arm 1 is shown in SEQ ID No. 3; the nucleotide sequence of the downstream homology arm 1 is shown in SEQ ID No. 4.
[0020] Furthermore, the expression of the gene encoding the BAR1 protein in the Kluyveromyces marxianus recipient bacteria is inhibited by introducing a CRISPR / Cas9 editing tool 2 into the Kluyveromyces marxianus recipient bacteria. In one embodiment of the present invention, the target sequence of the CRISPR / Cas9 editing tool 2 is shown in SEQ ID No. 10. Specifically, the CRISPR / Cas9 editing tool 2 specifically includes a recombinant vector 2 and a homologous recombination fragment 2; the recombinant vector 2 is capable of expressing the Cas9 protein and a gRNA targeting the gene encoding the BAR1 protein in the genome of the Kluyveromyces marxianus recipient bacteria; the homologous recombination fragment 2 is composed of an upstream homology arm 2 and a downstream homology arm 2 from the 5' end to the 3' end. Furthermore, in the recombinant vector 2, the coding sequence of the spacer for expressing the gRNA is AGTTTGCCACCTCTACGTCA (SEQ ID No. 10). Furthermore, the nucleotide sequence of the upstream homology arm 2 is shown in SEQ ID No. 8; the nucleotide sequence of the downstream homology arm 2 is shown in SEQ ID No. 9.
[0021] In a fourth aspect, the present invention claims the use of the method described in the third aspect above in increasing the yield of lactoferrin secreted by Kluyveromyces marxianus;
[0022] Furthermore, the application includes the step of introducing a gene encoding lactoferrin into the Kluyveromyces marxianus recipient bacteria to enable secretory expression in the Kluyveromyces marxianus.
[0023] In a fifth aspect, the present invention claims a method for constructing a recombinant Kluyveromyces marxianus strain with reduced lactoferrin degradation ability.
[0024] The method for constructing a recombinant Kluyveromyces marxianus strain with reduced lactoferrin degradation ability claimed in the present invention may include the steps described in the third aspect above.
[0025] In a sixth aspect, the present invention claims protection for a recombinant Kluyveromyces marxianus strain having reduced lactoferrin degradation ability.
[0026] The recombinant Kluyveromyces marxianus with reduced lactoferrin degradation ability claimed in the present invention is constructed using the method described in the fifth aspect above.
[0027] In a seventh aspect, the present invention claims protection for any of the following applications:
[0028] (C1) Use of the recombinant Kluyveromyces marxianus described in the sixth aspect above in the preparation of a compound formulation; the compound formulation contains: a1) the recombinant Kluyveromyces marxianus and / or its fermentation product (fermentation supernatant); and a2) lactoferrin;
[0029] (C2) Use of the recombinant Kluyveromyces marxianus and lactoferrin described in the sixth aspect above in the preparation of a compound preparation; the compound preparation contains: a1) the recombinant Kluyveromyces marxianus and / or its fermentation product (fermentation supernatant); and, a2) lactoferrin.
[0030] In an eighth aspect, the present invention claims protection for a compound preparation.
[0031] The composite preparation claimed in the present invention contains: a1) the recombinant Kluyveromyces marxianus and / or its fermentation product (fermentation supernatant) described in the sixth aspect above; and a2) lactoferrin.
[0032] In the above-mentioned related aspects, the PEP4 protein may be any one of the following proteins:
[0033] (D1) a protein having an amino acid sequence of SEQ ID No. 1;
[0034] (D2) a protein derived from Kluyveromyces marxianus having the same function as the amino acid sequence shown in SEQ ID No. 1, through substitution and / or deletion and / or addition of one or more amino acid residues;
[0035] (D3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (D1) to (D2) and having the same function as that of Kluyveromyces marxianus;
[0036] (D4) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein defined in any one of (D1) to (D3).
[0037] In the above-mentioned related aspects, the BAR1 protein may be any one of the following proteins:
[0038] (E1) a protein having an amino acid sequence of SEQ ID No. 6;
[0039] (E2) a protein derived from Kluyveromyces marxianus having the same function as the amino acid sequence of SEQ ID No. 6, with one or more amino acid residues substituted and / or deleted and / or added;
[0040] (E3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (E1) to (E2) and having the same function as that of Kluyveromyces marxianus;
[0041] (E4) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein defined in any one of (E1) to (E3).
[0042] In the above-mentioned proteins, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using an identity search site on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, blastp can be used as the program, with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated and the identity value (%) can be obtained.
[0043] The 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or greater identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The greater than 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.
[0044] In the above-mentioned related aspects, the gene encoding the PEP4 protein may be any one of the following DNA molecules:
[0045] (F1) the DNA molecule shown in SEQ ID No. 2;
[0046] (F2) a DNA molecule that hybridizes with the DNA molecule defined in (F1) under stringent conditions and encodes the PEP4 protein;
[0047] (F3) A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with any of the DNA sequences defined in (F1) to (F2) and encodes the PEP4 protein.
[0048] In the above-mentioned related aspects, the gene encoding the BAR1 protein is any one of the following DNA molecules:
[0049] (G1) DNA molecule represented by SEQ ID No. 7;
[0050] (G2) a DNA molecule that hybridizes with the DNA molecule defined in (G1) under stringent conditions and encodes the BAR1 protein;
[0051] (G3) A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with any of the DNA sequences defined in (G1) to (G2) and encodes the BAR1 protein.
[0052] In the above-mentioned gene, the stringent conditions may be as follows: 50°C, hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 2×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 1×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 0.5×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 0.5×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM The membrane can be hybridized in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA at 50°C and rinsed in 0.1×SSC, 0.1% SDS. The membrane can also be hybridized in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA at 50°C and rinsed in 0.1×SSC, 0.1% SDS at 65°C. The membrane can also be hybridized in a solution of 6×SSC, 0.5% SDS at 65°C and then washed once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.
[0053] For the above genes, the identity of the nucleotide sequences can be determined using an identity search site on the Internet, such as the BLAST page on the NCBI homepage. For example, the identity of a pair of nucleotide sequences can be calculated by searching in Advanced BLAST 2.1 using blastn as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained.
[0054] In the above genes, the 95% or greater identity may be at least 96%, 97%, 98%, or 99% identity. The 90% or greater identity may be at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or greater identity may be at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 80% or greater identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0055] In the above-mentioned related aspects, the Kluyveromyces marxianus recipient strain is a Kluyveromyces marxianus strain with a Ura3 gene deleted. Due to production requirements, a resistance selection marker cannot be introduced, so the genomic Ura3 gene is knocked out.
[0056] In one embodiment of the present invention, the Kluyveromyces marxianus recipient strain is obtained by knocking out the Ura3 gene in the Kluyveromyces marxianus CS-01 genome; the Kluyveromyces marxianus CS-01 is deposited in the General Microbiology Center of the China Culture Collection Administration under the CGMCC No. 30573.
[0057] Experiments have shown that knocking out the genes encoding the PEP4 and BAR1 proteins in yeast cells can reduce lactoferrin degradation and significantly increase the amount of intact protein. By fermenting the strain in shake flasks and obtaining the supernatant, it was found that knocking out the genes encoding the PEP4 and BAR1 proteins significantly alleviated lactoferrin degradation. This invention is of great significance for increasing the secretory expression yield of lactoferrin in Kluyveromyces marxianus.
[0058] Preservation Instructions
[0059] Classification and nomenclature: Kluyveromyces marxianus;
[0060] Reference biological material: CS-01;
[0061] Depository: General Microbiology Center of China Culture Collection Administration of Microorganisms;
[0062] Abbreviation of depository institution: CGMCC;
[0063] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;
[0064] Deposit date: May 9, 2024;
[0065] The registration number of the CGMCC Collection Center is: CGMCC No.30573. BRIEF DESCRIPTION OF THE DRAWINGS
[0066] Figure 1 The figure shows the microscopic examination (40 times) of Kluyveromyces marxianus CS-01.
[0067] Figure 2 Colony PCR verification results of the strain cloned for screening purposes (PEP4 knockout electrophoresis). The arrow indicates the homozygous strain K. marxianus Δura3, ΔPEP4 obtained.
[0068] Figure 3Colony PCR verification results of the strain cloned for screening purposes (BAR1 knockout electrophoresis). The arrows indicate the homozygous strains K. marxianus Δura3, ΔPEP4, ΔBAR1.
[0069] Figure 4 This is an SDS-PAGE image of lactoferrin quantitative analysis. Figure 1 represents a lactoferrin standard; 2 represents lactoferrin added to the supernatant of K. marxianus Δura3 fermentation broth; 3 represents lactoferrin added to the supernatant of K. marxianus Δura3, ΔPEP4, and ΔBAR1 fermentation broth; and 4 represents lactoferrin added to YG liquid culture medium. The arrow indicates lactoferrin. DETAILED DESCRIPTION
[0070] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0071] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0072] The quantitative data involved in the following examples are the results obtained by repeating the experiments more than 3 times.
[0073] The amino acid sequence of the PEP4 protein involved in the following examples is shown in SEQ ID No. 1, and the nucleotide sequence of the corresponding encoding gene is shown in SEQ ID No. 2. The amino acid sequence of the BAR1 protein involved in the following examples is shown in SEQ ID No. 6, and the nucleotide sequence of the corresponding encoding gene is shown in SEQ ID No. 7.
[0074] Example 1: Isolation and Identification of Kluyveromyces marxianus CS-01
[0075] 1. Strain Isolation
[0076] The CS-01 strain was isolated from yak yogurt samples in Maduo County, Qinghai in August 2022.
[0077] Take 1g of yogurt sample, dilute it with 50ml of sterile water, and then dilute it 10-10000 times with sterile water. Take 100μl of the dilution and spread it on yeast solid medium YNB (amino-free yeast nitrogen base) plate, culture it at 30℃ for 3-4 days, and pick out single colonies.
[0078] 2. Strain Identification
[0079] The bacterial species was identified using the 18S rDNA method. Using the genome of strain CS-01 as a template, PCR amplification and sequencing were performed using the universal 18S rDNA primers ITS1 (TCCGTAGGTGAACCTGCG) and ITS4 (TCCTCCGCTTATTTATGG). The resulting 18S rDNA sequence is shown in SEQ ID No. 12. Comparison with known sequences in GenBank revealed that the 18S rDNA sequence of CS-01 shared 99.71% similarity with those of Kluyveromyces marxianus strain XJ-50 and Kluyveromyces marxianus isolate ilia21. Therefore, strain CS-01 was identified as Kluyveromyces marxianus.
[0080] Cell morphology observation revealed that the colonies of the CS-01 strain were round, milky white, with neat edges. Microscopic observation revealed that the yeast was oval in shape, about 4-8 μm in size, and reproduced by budding, with single, two or more strains sticking together in clusters ( Figure 1 ), which is consistent with the cell morphology of Kluyveromyces marxianus.
[0081] After the above identification, strain CS-01 was identified as Kluyveromyces marxianus. The strain was deposited in the General Microbiology Center of China Culture Collection Administration on May 9, 2024, and its registration number in the collection center is CGMCC No. 30573.
[0082] Example 2: Knockout of the PEP4 gene
[0083] 1. Amplification of donor DNA fragments for knocking out the PEP4 gene
[0084] To knock out the vacuolar protease gene PEP4 in Kluyveromyces marxianus, primers up-PEP4-F and up-PEP4-R (Table 1) were used to perform PCR amplification using the genome of K. marxianus Δura3 (K. marxianus Δura3 was obtained by using CRISPRI technology to knock out the Ura3 gene (GenBank: KX453285.1) from the genome of K. marxianus CS-01 (CGMCC No. 30573) obtained in Example 1). A fragment containing the upstream homology arm (SEQ ID No. 3) for knocking out the PEP4 gene was obtained. PCR amplification using primers down-PEP4-F and down-PEP4-R (Table 1) was also performed using the genome of K. marxianus Δura3 as a template to obtain a fragment containing the downstream homology arm (SEQ ID No. 4) for knocking out the PEP4 gene.
[0085] Using the two amplified products obtained above as templates, PCR amplification was performed using primers up-PEP4-F and down-PEP4-R to obtain an overlap PCR product. This product is the donor DNA fragment for knocking out the PEP4 gene. From the 5' end to the 3' end, it contains the upstream homology arm (SEQ ID No. 3) for knocking out the PEP4 gene and the downstream homology arm (SEQ ID No. 4) for knocking out the PEP4 gene.
[0086] Table 1. Primer sequences for amplifying target fragments
[0087] Primer name Primer sequence (5'-3') up-PEP4-F TTACTGCGTATATATTTTTTTGCT up-PEP4-R TCGATTTTACATAATAAAAGTTTTACAATAAAGTTAATATTAATTTGA down-PEP4-F AATATTAACTTTATTGTAAAACTTTATTATGTAAAATCGAAAATG down-PEP4-R ATATGAGAGTGATTACTTTCAAAC
[0088] 2. Construction of the gene editing plasmid LHZ531-PEP4 targeting PEP4
[0089] Using the CRISPR-Cas9 gene editing method, the LHZ531 plasmid (full sequence of this plasmid is shown in SEQ ID No. 11; it contains the TEF1 promoter, Cas9 gene, CYC1 terminator, Ura3 promoter and gene, ARS1 terminator, ampicillin gene, guide RNA, and tRNA-glycine) was first digested with the restriction endonuclease SapI. The digestion reaction system is shown in Table 2. The reaction conditions were overnight incubation at 37°C and inactivation at 75°C for 15 minutes. The large vector fragment was recovered by gel filtration.
[0090] Table 2. Enzyme digestion reaction system
[0091] System composition Volume (μL) LHZ531 plasmid 10 Restriction enzyme buffer (10×) 5 Restriction endonuclease SapⅠ 1 <![CDATA[ddH2O]]> 34
[0092] The PAM sequence was selected, and the 20 nt upstream of it was the target sequence, CCCACAAGAAACATTCTCCA (SEQ ID No. 5). This sequence is targeted for knocking out the PEP4 gene using CRISPR-Cas9. Sticky ends were added to the 5' ends of the target sequence on both the sense and antisense strands, and synthesis was performed using primers. The synthesized sequences are shown in Table 3.
[0093] Table 3. Synthetic sequences
[0094] serial number Sequence (5'-3') N20-F TCACCCACAAGAAACATTCTCCA N20-R AACTGGAGAATGTTTCTTGTGGG
[0095] After unwinding the two primers (N20-F / R) at 95°C for 15 minutes, anneal them at 12°C for 5 minutes, and then at room temperature for 10 minutes. The annealed primers were then ligated with the large Sap I-digested LHZ531 vector fragment using T4 ligase. The ligation product was then transformed into competent E. coli DH5α cells using heat shock. The transformed cells were plated on LB+ampicin plates and cultured overnight at 37°C.
[0096] Identification of LHZ531 E. coli transformants containing the target PEP4 gene sequence: Ten transformants were selected and plated on LB + ampicillin plates and cultured overnight at 37°C. A cell pellet approximately 1 / 4 the size of a match head was resuspended in 20 μL of water, placed in a 100°C water bath for 2 minutes, and cooled to room temperature. The pellet was centrifuged at 13,200 rpm for 1 minute. 2 μL of the supernatant was aspirated as a template and PCR products were detected using forward primer YY161F (5'-GTCGCTTACAGTGTACTGGTTGTGG-3') and reverse primer N20-R (5'-AACTGGAGAATGTTTCTTGTGGG-3') containing the target sequence. KOD-plus-neo enzyme was used for the reaction. PCR products were detected by agarose gel electrophoresis. Transformants that produced the expected PCR band were inoculated into 3 mL of LB + ampicillin liquid medium and cultured overnight at 37°C in a shaker. The cells were harvested and the plasmid was extracted. The plasmid was sequenced using primer M13F. The sequenced plasmid can be used for yeast transformation.
[0097] Finally, a gene-edited plasmid was obtained, named LHZ531-PEP4, which was a recombinant plasmid obtained by replacing the small fragment between the two restriction enzyme cutting sites Sap I of the LHZ531 plasmid with CCCACAAGAAACATTCTCCA (SEQ ID No. 5).
[0098] 3. Yeast Chemical Transformation and Screening of the PEP4-Targeted Editing Plasmid LHZ531-PEP4 and Donor DNA
[0099] The transformation recipient was K. marxianus Δura3, which was obtained by using CRISPRI technology to knock out the Ura3 gene in the genome of K. marxianus CS-01 (CGMCC No. 30573) obtained in Example 1. Due to production requirements, the introduction of a resistance selection marker was not allowed, so the genomic Ura3 gene was knocked out.
[0100] 1. Pick a fresh starting strain K. marxianus Δura3, inoculate it into 4.5 mL YPD liquid medium, and culture it in a shaking incubator at 30 ° C overnight until the OD 600 Greater than 10.
[0101] 2. Pipette 1.5 mL of bacterial suspension into a 1.5 mL centrifuge tube and centrifuge at 13,200 rpm for 10 seconds. Discard the supernatant. Prepare LiAc / TE buffer by mixing 3 mL of 1 M LiAc and 3 mL of 10×TE (formula: 100 mM Tris-HCl, 10 mM EDTA, adjust pH to 8.0 with HCl) with sterile water to 30 mL. Resuspend the cells in 1 mL of LiAc / TE solution and centrifuge at 13,200 rpm for 10 seconds. Discard the supernatant. Resuspend the cells again in 1 mL of LiAc / TE solution and centrifuge at 13,200 rpm for 10 seconds. Discard the supernatant.
[0102] 3. Add 5 μL of Carrier DNA (Takara, Cat. No. 630440), 500 ng of the editing plasmid LHZ531-PEP4 constructed in Step 2, and 1 μg of the donor DNA fragment template for knocking out the PEP4 gene prepared in Step 1 to the centrifuge tube. Gently pipette with the tip of the pipette to mix the bacteria and DNA.
[0103] 4. Add 300 μL of LiAc / TE / PEG solution to the centrifuge tube (preparation: dissolve 40 g of PEG in water to the 80 mL mark, sterilize at 115°C for 20 minutes, then add 10 mL each of sterile 1 M LiAc and 10×TE and mix thoroughly). Gently pipette to mix thoroughly. Add an appropriate amount of 1 mol / L DTT to the centrifuge tube to a final concentration of 10 mM and gently pipette to mix thoroughly.
[0104] 5. Place the centrifuge tube in a 30°C water bath for 15 minutes and in a 47°C water bath for 15 minutes.
[0105] 6. Centrifuge at 13200 rpm for 10 seconds and discard the supernatant. Resuspend the cells in 150 μL of sterile water and spread on SD plates.
[0106] 7. After culturing at 30°C for 2-3 days, select transformants and verify the expression using primers check-PEP4-F (5'-TTATAAATCTGGAATGTAAAAATAAC-3') and check-PEP4-R (5'-TAAATTGGTGTGAAAGTATATTGA-3'). The target gene is the PEP4 gene on the genome. The band is 2000 bp when the PEP4 gene is not knocked out, and 773 bp after the knockout.
[0107] Amplification results gel image Figure 2 The final positive strain obtained was K. marxianus Δura3, ΔPEP4. The strain K. marxianus Δura3, ΔPEP4 had the PEP4 gene in the K. marxianus Δura3 genome deleted (specifically, the fragment between SEQ ID No. 3 and SEQ ID No. 4 in the genome deleted), while keeping other sequences unchanged.
[0108] Example 3: Knockout of the BAR1 gene
[0109] 1. Amplification of donor DNA for knockout of the BAR1 gene
[0110] The gene BAR1 encoding the aspartic protease in Kluyveromyces marxianus was selected for knockout. PCR amplification was performed using primers up-BAR1-F and up-BAR1-R (Table 4) with the genome of K. marxianus Δura3, ΔPEP4 obtained in Example 2 as a template to obtain a fragment containing the upstream homology arm (SEQ ID No. 8) for knocking out the BAR1 gene. PCR amplification was performed using primers down-BAR1-F and down-BAR1-R (Table 4) with the genome of K. marxianus Δura3, ΔPEP4 as a template to obtain a fragment containing the downstream homology arm (SEQ ID No. 9) for knocking out the BAR1 gene.
[0111] Using the two amplified products obtained above as templates, PCR amplification was performed using primers up-BAR1-F and down-BAR1-R to obtain an overlap PCR product. This product is the donor DNA fragment for knocking out the BAR1 gene. From the 5' end to the 3' end, it contains the upstream homology arm (SEQ ID No. 8) for knocking out the BAR1 gene and the downstream homology arm (SEQ ID No. 9) for knocking out the BAR1 gene.
[0112] Table 4. Primer sequences for amplifying target fragments
[0113] Primer name Primer sequence (5'-3') up-BAR1-F TGCATCCGTCTTGCAGTCAA up-BAR1-R TCTTTTAAAGTCGTTCTTATGGTTAAGACTGGGTTTTTTTTC down-BAR1-F AAAAAAACCCAGTCTTAACCATAAGAACGACTTTAAAAGACATT down-BAR1-R TCCGATATGGCAATCGCCTA
[0114] 2. Construction of gene editing plasmid targeting BAR1
[0115] Using the CRISPR-Cas9 gene editing method, the LHZ531 plasmid (full sequence of this plasmid is shown in SEQ ID No. 11; it contains the TEF1 promoter, Cas9 gene, CYC1 terminator, Ura3 promoter and gene, ARS1 terminator, ampicillin gene, guide RNA, and tRNA-glycine) was first digested with the restriction endonuclease SapI. The digestion reaction system is shown in Table 2. The reaction conditions were overnight incubation at 37°C and inactivation at 75°C for 15 minutes. The large vector fragment was recovered by gel filtration.
[0116] The PAM sequence was selected, and the 20 nt upstream of it was the target sequence, namely AGTTTGCCACCTCTACGTCA (SEQ ID No. 10). This sequence is targeted for knockout of the BAR1 gene using CRISPR-Cas9. Sticky ends were added to the 5' ends of the target sequence on both the sense and antisense strands, and synthesis was performed using primers. The synthesized sequence is shown in Table 5.
[0117] Table 5. Synthetic sequences
[0118] serial number Sequence (5'-3') N20-F TCAAGTTTGCCACCTCTACGTCA N20-R AACTGACGTAGAGGTGGCAAACT
[0119] After unwinding the two primers (N20-F / R) at 95°C for 15 minutes, anneal them at 12°C for 5 minutes, and then at room temperature for 10 minutes. The annealed primers were then ligated with the large Sap I-digested LHZ531 vector fragment using T4 ligase. The ligation product was then transformed into competent E. coli DH5α cells using heat shock. The transformed cells were plated on LB+ampicin plates and cultured overnight at 37°C.
[0120] Identification of LHZ531 E. coli transformants containing the target BAR1 gene sequence: Ten transformants were selected and plated on LB + ampicillin plates and cultured overnight at 37°C. A cell pellet approximately 1 / 4 the size of a match head was resuspended in 20 μL of water, placed in a 100°C water bath for 2 minutes, and cooled to room temperature. The cell pellet was centrifuged at 13,200 rpm for 1 minute. 2 μL of the supernatant was aspirated as a template and PCR products were detected using forward primer YY161F (5'-GTCGCTTACAGTGTACTGGTTGTGG-3') and reverse primer N20-R (5'-AACTGACGTAGAGGTGGCAAACT-3') containing the target sequence. KOD-plus-neo enzyme was used for the reaction. PCR products were detected by agarose gel electrophoresis. Transformants that produced the expected PCR band were inoculated into 3 mL of LB + ampicillin liquid medium and cultured overnight at 37°C in a shaker. The cells were harvested and the plasmid was extracted. The plasmid was sequenced using primer M13F. The sequenced plasmid can be used for yeast transformation.
[0121] Finally, a gene-edited plasmid was obtained, named LHZ531-BAR1, which was a recombinant plasmid obtained by replacing the small fragment between the two restriction enzyme cutting sites Sap I of the LHZ531 plasmid with AGTTTGCCACCTCTACGTCA (SEQ ID No. 10).
[0122] 3. Chemical transformation and screening of BAR1-targeted editing plasmid LHZ531-BAR1 and donor DNA in yeast
[0123] (1) Pick fresh starting strains K. marxianus Δura3, ΔPEP4, inoculate them into 4.5 mL YPD liquid medium, and culture them in a shaking incubator at 30 °C overnight until OD 600 Greater than 10.
[0124] (2) Pipette 1.5 mL of bacterial solution into a 1.5 mL centrifuge tube, centrifuge at 13200 rpm for 10 seconds, and discard the supernatant. Take 3 mL of 1 M LiAc and 3 mL of 10×TE (formula: 100 mM Tris-HCl, 10 mM EDTA, pH = 8.0), add sterile water to 30 mL and mix well to obtain LiAc / TE buffer. Resuspend the bacterial cells in 1 mL of LiAc / TE solution, centrifuge at 13200 rpm for 10 seconds, and discard the supernatant. Resuspend the bacterial cells in 1 mL of LiAc / TE solution again, centrifuge at 13200 rpm for 10 seconds, and discard the supernatant.
[0125] (3) Add 5 μL of carrier DNA (Takara, catalog number 630440), 500 ng of the editing plasmid LHZ531-BAR1 constructed in step 2, and 1 μg of the donor DNA fragment for knocking out the BAR1 gene prepared in step 1 to the centrifuge tube. Gently pipette with the tip of the pipette to mix the bacteria and DNA.
[0126] (4) Add 300 μL of LiAc / TE / PEG solution (preparation method: dissolve 40 g of PEG in water to the 80 mL mark, sterilize at 115°C for 20 min, add 10 mL each of sterile 1 M LiAc and 10×TE to the solution and mix thoroughly) to the centrifuge tube. Gently pipette and mix thoroughly. Add an appropriate amount of 1 mol / L DTT to the centrifuge tube to a final concentration of 10 mM DTT and gently pipette and mix thoroughly.
[0127] (5) Place the centrifuge tube in a 30°C water bath for 15 minutes and in a 47°C water bath for 15 minutes.
[0128] (6) Centrifuge at 13200 rpm for 10 seconds and discard the supernatant. Resuspend the cells in 150 μL of sterile water and spread on a SD plate.
[0129] (7) After culturing at 30°C for 2–3 days, transformants were selected and verified using primers check-BAR1-F (5’-TTATCTGTGTTATGTCTTCGAG-3’) and check-BAR1-R (5’-TAATTATCATGTGCAATAACCATT-3’). The target gene was the BAR1 gene on the genome. The band was 2000 bp when the BAR1 gene was not knocked out, and 494 bp after knockout.
[0130] Amplification results gel image Figure 3 The final positive strain obtained was K. marxianus Δura3, ΔPEP4, ΔBAR1. The strain K. marxianus Δura3, ΔPEP4, ΔBAR1 had the PEP4 gene and BAR1 gene in the K. marxianus Δura3 strain genome knocked out (specifically, the fragment between SEQ ID No. 3 and SEQ ID No. 4 in the genome was knocked out, and the fragment between SEQ ID No. 8 and SEQ ID No. 9 was knocked out), while keeping other sequences unchanged.
[0131] Example 4: Detection of the degradation of Kluyveromyces marxianus lactoferrin
[0132] The positive transformants K. marxianus Δura3, ΔPEP4, and ΔBAR1 obtained in Example 3 above were first cultured in YPD liquid medium (formula: 4 g / L tryptone, 2 g / L yeast powder, 2 g / L glucose) at 30°C for 12-18 h, then streaked on YPD + 5-FOA plates (formula: YPD medium supplemented with 5-fluorouracil and agar powder, 5-fluorouracil final concentration of 1.25 g / L, agar powder final concentration of 20 g / L) and incubated at 30°C until single colonies grew. Subsequently, single colonies were picked and cultured in YG liquid medium (formula: yeast powder 20 g / L, glucose 40 g / L) at 200 rpm and 30°C for 48 h. After 48 hours, centrifuge 1 mL of the supernatant and transfer it to a 1.5 mL sterile EP tube. Add lactoferrin standard to the supernatant to initiate the reaction. The final lactoferrin concentration in the supernatant is 0.125 μg / μL. Incubate at 30°C for 8 hours. Quantify lactoferrin using SDS-PAGE. Simultaneously, empty culture medium supplemented with the same concentration of lactoferrin and K. marxianus Δura3 strain cultured under the same conditions served as controls.
[0133] SDS-PAGE picture Figure 4 As shown in the figure, the amount of intact lactoferrin in the supernatant of K. marxianus Δura3, ΔPEP4, ΔBAR1 was significantly higher than that of K. marxianus Δura3. Calculation showed that the degradation rate of lactoferrin by K. marxianus Δura3 was 54.3% ± 1.11%, while that by K. marxianus Δura3, ΔPEP4, ΔBAR1 was 8.3% ± 5.61%. Knockout of the PEP4 and BAR1 genes significantly reduced the lactoferrin degradation ability of yeast cells (P < 0.05).
[0134] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Use of inhibiting the expression of PEP4 protein and BAR1 protein in any of the following: (A1) reducing the degradation of lactoferrin by Kluyveromyces marxianus; (A2) Reducing the degradation of lactoferrin by the fermentation supernatant of Kluyveromyces marxianus.
2. Use of a substance capable of reducing the expression of PEP4 protein and BAR1 protein in Kluyveromyces marxianus in any of the following: (A1) reducing the degradation of lactoferrin by Kluyveromyces marxianus; (A2) Reducing the degradation of lactoferrin by the fermentation supernatant of Kluyveromyces marxianus.
3. The use according to claim 2, characterized in that: The substance includes a CRISPR / Cas9 editing tool 1 targeting the gene encoding the PEP4 protein in the genome of the Kluyveromyces marxianus recipient bacteria, and a CRISPR / Cas9 editing tool 2 targeting the gene encoding the BAR1 protein in the genome of the Kluyveromyces marxianus recipient bacteria; Furthermore, the target sequence of the CRISPR / Cas9 editing tool 1 is shown as SEQ ID No. 5; the target sequence of the CRISPR / Cas9 editing tool 2 is shown as SEQ ID No.
10.
4. A method for reducing the ability of Kluyveromyces marxianus or its fermentation supernatant to degrade lactoferrin, comprising the following steps: inhibiting the expression of genes encoding PEP4 protein and BAR1 protein in a Kluyveromyces marxianus recipient strain, thereby reducing the ability of Kluyveromyces marxianus or its fermentation supernatant to degrade lactoferrin.
5. The method according to claim 4, characterized in that: In the method, inhibiting the expression of the gene encoding the PEP4 protein in the Kluyveromyces marxianus recipient strain is achieved by CRISPR / Cas9 gene editing technology; and / or In the method, inhibiting the expression of the gene encoding the BAR1 protein in the Kluyveromyces marxianus recipient strain is achieved by CRISPR / Cas9 gene editing technology; Furthermore, inhibiting the expression of the gene encoding the PEP4 protein in the Kluyveromyces marxianus recipient strain is achieved by introducing a CRISPR / Cas9 editing tool 1 into the Kluyveromyces marxianus recipient strain; the target sequence of the CRISPR / Cas9 editing tool 1 is shown in SEQ ID No. 5; and / or Furthermore, inhibiting the expression of the gene encoding the BAR1 protein in the Kluyveromyces marxianus recipient strain is achieved by introducing the CRISPR / Cas9 editing tool 2 into the Kluyveromyces marxianus recipient strain; the target sequence of the CRISPR / Cas9 editing tool 2 is shown in SEQ ID No.
10.
6. Use of the method according to claim 4 or 5 in increasing the yield of lactoferrin secreted by Kluyveromyces marxianus; Furthermore, the application includes the step of introducing a gene encoding lactoferrin into the Kluyveromyces marxianus recipient bacteria to enable secretory expression in the Kluyveromyces marxianus.
7. Any of the following: (B1) A method for constructing a recombinant Kluyveromyces marxianus strain with reduced lactoferrin degradation ability, comprising the steps of claim 4 or 5; (B2) A recombinant Kluyveromyces marxianus with reduced lactoferrin degradation ability, characterized in that: The recombinant Kluyveromyces marxianus was constructed using the method described in (B1).
8. Any of the following applications: (C1) Use of the recombinant Kluyveromyces marxianus described in (B2) of claim 7 in the preparation of a compound formulation; the compound formulation contains: a1) the recombinant Kluyveromyces marxianus and / or its fermentation product; and a2) lactoferrin; (C2) Use of the recombinant Kluyveromyces marxianus and lactoferrin described in (B2) of claim 7 in the preparation of a compound preparation; the compound preparation contains: a1) the recombinant Kluyveromyces marxianus and / or its fermentation product; and, a2) lactoferrin.
9. A compound preparation comprising: a1) the recombinant Kluyveromyces marxianus and / or its fermentation product according to (B2) of claim 7; and a2) lactoferrin.
10. The use or method or recombinant Kluyveromyces marxianus or compound preparation according to any one of claims 1 to 9, characterized in that: The PEP4 protein is any one of the following proteins: (D1) a protein having an amino acid sequence of SEQ ID No. 1; (D2) a protein derived from Kluyveromyces marxianus having the same function as the amino acid sequence shown in SEQ ID No. 1, through substitution and / or deletion and / or addition of one or more amino acid residues; (D3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (D1) to (D2) and having the same function as that of Kluyveromyces marxianus; (D4) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of any of the proteins defined in (D1) to (D3); and / or The BAR1 protein is any one of the following proteins: (E1) a protein having an amino acid sequence of SEQ ID No. 6; (E2) a protein derived from Kluyveromyces marxianus having the same function as the amino acid sequence of SEQ ID No. 6, with one or more amino acid residues substituted and / or deleted and / or added; (E3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (E1) to (E2) and having the same function as that of Kluyveromyces marxianus; (E4) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein defined in any one of (E1) to (E3); and / or The coding gene of the PEP4 protein is any one of the following DNA molecules: (F1) the DNA molecule shown in SEQ ID No. 2; (F2) a DNA molecule that hybridizes with the DNA molecule defined in (F1) under stringent conditions and encodes the PEP4 protein; (F3) a DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with any of the DNA sequences defined in (F1) to (F2) and encodes the PEP4 protein; and / or The gene encoding the BAR1 protein is any one of the following DNA molecules: (G1) DNA molecule represented by SEQ ID No. 7; (G2) a DNA molecule that hybridizes with the DNA molecule defined in (G1) under stringent conditions and encodes the BAR1 protein; (G3) a DNA molecule that is 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identical to the DNA sequence defined in any one of (G1) to (G2) and encodes the BAR1 protein; and / or The Kluyveromyces marxianus recipient strain is a Kluyveromyces marxianus strain with a Ura3 gene deleted; Furthermore, the Kluyveromyces marxianus recipient strain is obtained by knocking out the Ura3 gene in the Kluyveromyces marxianus CS-01 genome; the Kluyveromyces marxianus CS-01 is deposited in the General Microbiology Center of the China Culture Collection Administration under the CGMCC No. 30573.
Citation Information
Cited By
Lactoferrin expression strains and methods of use in saccharomyces marxianus
CN122587898A
Preparation method of skin immune factor for promoting self-healing of inflammatory skin and self-healing of thermal injury and application thereof
CN122681745A