Living cell nucleic acid imaging system and method based on CRISPR (clustered regularly interspaced short palindromic repeats) and nano antibody and application

Abstract

The invention belongs to the technical field of living cell imaging, and discloses a living cell nucleic acid imaging system and method based on CRISPR (clustered regularly interspaced short palindromic repeats) and a nano antibody and application, the system comprises: a modified dCas protein expression vector containing n antigen polypeptide tags; the modified sgRNA and / or crRNA expression vector comprises a specific guide sequence; the fluorescent nano-antibody expression vector contains m fluorescent nano-antibody coding sequences which are connected in an operable manner, and fluorescent protein serving as an internal tag is inserted between nano-antibody splitting sites, can be combined with a polypeptide tag carried by dCas protein and can stably emit light; and the fluorescent nano antibody in a free state can be self-degraded, so that the fluorescent nano antibody does not emit fluorescence. According to the invention, the single-copy nucleic acid sequence, especially the imaging marker of the single-copy nucleic acid sequence in a living cell, can be visualized with single-molecule resolution and high signal-to-noise ratio.

Description

Technical Field

[0001] The present invention relates to the field of live cell imaging technology, and in particular to a live cell nucleic acid imaging system, method and use based on CRISPR and nanoantibodies. Background Art

[0002] Nucleic acids (DNA and RNA) are important biological macromolecules and play a vital role in many life activities. About 40-50% of the human genome is composed of protein-coding genes, gene regulatory regions and key non-coding regions. Most of these regions are non-repetitive sequences that control core life processes. RNA is directly involved in protein synthesis and regulates gene expression at the transcriptional and post-transcriptional levels. Live cell nucleic acid imaging with single-molecule resolution is an important means to monitor the spatiotemporal distribution of nucleic acid molecules in cells and explore changes in chromatin dynamics. It is of great significance for in-depth understanding of cell functions, revealing pathogenic mechanisms, and developing precise disease treatment strategies.

[0003] Traditional fluorescence in situ hybridization (FISH) and oligo-FISH techniques utilize fluorescently labeled probes to specifically hybridize with denatured target DNA within cells. This method requires the design of numerous fluorescent probes targeting the target site and its adjacent sequences, as well as cell fixation and DNA denaturation. This captures only the state of cellular DNA at a specific moment and is incapable of dynamically tracking DNA sites. Imaging techniques that use fluorescent proteins to directly and specifically target the target sequence or nearby exogenous sequences are more challenging to establish and have low imaging efficiency.

[0004] After binding to a sgRNA, the CRISPR / dCas9 protein specifically targets and stably binds to a DNA sequence complementary to the sgRNA. Through techniques such as gene recombination and transfection, the CRISPR / dCas9-sgRNA complex can carry fluorescence and bind to DNA, enabling live-cell DNA imaging with minimal perturbation of gene function and real-time tracking of DNA status. For example, Chen Baohui et al. first fused dCas9 to EGFP, enabling live-cell imaging of telomeres guided by an sgRNA targeting telomeric repeats. However, the fluorescence intensity of a single dCas9-EGFP was very limited, limiting its ability to label only telomere-like repeats. Furthermore, free dCas9-EGFP tended to accumulate in the nucleolus, resulting in high background signal. Imaging non-repetitive DNA sequences in live cells requires sufficient signal amplification and low background signal. Although various CRISPR / Cas9-based live-cell imaging systems have been developed, technical limitations have hindered high signal-to-noise ratio imaging of non-repetitive DNA sequences.

[0005] Currently, signal amplification methods for CRISPR / Cas9-based live cell DNA non-repetitive sequence imaging systems can be mainly divided into two categories:

[0006] The first type is a non-cascade signal amplification system, which is achieved by modifying the CRISPR / dCas9-sgRNA complex, such as serially attaching multiple RNA aptamers (such as MS2, PP7, boxB, etc.) to the sgRNA, and serially attaching polypeptide tags (such as GCN4) to the dCas9 protein, and then combining with binding components carrying fluorescent signals (such as MCP protein, PP7 protein, λN22 protein, scFv protein, etc.). However, the number of fluorescent signal groups recruited by the above system is limited, depending on the number of RNA aptamers and GCN4 copies fused to the sgRNA and dCas9 protein. For example, the imaging method based on MS2-sgRNA in the existing literature can recruit up to 16 MCP fluorescent proteins, while the SunTag system based on dCas9-GCN4 can recruit 24 fluorescent proteins. Using a single sgRNA can only image low-order tandem repeat sequences, and the sensitivity is still insufficient for imaging non-repetitive sequences, and the presence of free fluorescent groups leads to high background signals. Although background signals can be suppressed to a certain extent by removing the nuclear import signal of scFv-GFP or by light-induced transfer of free scFv-GFP to the cytoplasm, the improvement in signal-to-noise ratio is very limited (1.6-fold and 2-4-fold). Inducing rapid degradation of imaging components is another means to improve the signal-to-noise ratio. For example, the fCRISPR system uses tDeg carrying fluorescent protein to specifically bind to sgRNA-Pepper for imaging. The free tDeg undergoes rapid self-degradation, which greatly improves the signal-to-noise ratio (26-fold). Non-repetitive sequence imaging can be achieved by tandemly connecting 11 copies of GFP to tDeg. However, due to the limited ability of this system to recruit fluorescent signals to the target site, that is, when the imaging component is overexpressed in the cell, self-association can occur to form a stable free fluorescent dCas9 / Pepper-sgRNA / tDeg-FP complex, which still leads to background fluorescence.

[0007] The second type is the cascade signal amplification system, which is based on the first type and introduces bridging components to form a superposition of multiple layers of signal groups. For example, the CRISPR FISHer system, by constructing a foldon-GFP-PCP trimer protein, uses the CRISPR / dCas9-sgRNA (carrying the PP7 motif)-target DNA complex as a fulcrum, and realizes the cascade assembly of sgRNA-PP7 and foldon-GFP-PCP through the PCP-PP7 interaction, achieving non-repetitive sequence imaging through high signal amplification. However, this system is limited by the natural polymerization characteristics of foldon, making it difficult to achieve multi-color imaging, and the modified sgRNA backbone is prone to aggregation, resulting in significant non-specific signals, and the problem of high background signals is not solved. The SIMBA system consists of a target site binding arm composed of dCas9-GCN4 / scFv-FKBP and a signal amplification arm composed of FRB-mCherry-HP1α. FKBP binds to FRB under rapamycin induction and, through HP1α-mediated multivalent interactions, forms a signal amplification complex at the target site consisting of a target binding arm and a signal amplification arm, thereby visualizing non-repetitive sequences. However, HP1α is a natural component of human cells and is prone to non-specific binding to chromatin, resulting in false-positive signals.

[0008] Similar problems exist in live cell RNA imaging technology. Labeling methods using stem-loop structures or aptamers require the insertion of exogenous nucleic acid sequences into specific regions of RNA, or rely on exogenous expression of tagged RNA. These operations are cumbersome and may affect the natural behavior of RNA. The use of molecular beacons or CRISPR-Cas systems to visualize unmodified endogenous RNA is usually limited to single-molecule resolution. It is mainly suitable for high-abundance, repetitive RNA and is susceptible to high background signal interference caused by endosomal capture probes or overexpression of fluorescent proteins. The latest imaging platform that can achieve single-molecule resolution, smLiveFISH, targets 24 regions of the target RNA by constructing a CRISPR array. It is only applicable to long RNA and may change the natural RNA behavior to a certain extent.

[0009] In summary, the development of a live-cell imaging system with a high signal-to-noise ratio that can achieve labeling of non-repetitive DNA sequences and single-molecule RNA is a key issue that needs to be addressed at present. Imaging of non-repetitive DNA sequences and single-molecule RNA in live cells is of great significance and application value for fully revealing life science and medical science research such as gene expression regulation, cell function, tissue development and disease mechanisms. Summary of the Invention

[0010] The embodiments of the present invention provide a live cell nucleic acid imaging system, method and use based on CRISPR and nanoantibodies to solve the problems of the above-mentioned technologies in the prior art.

[0011] To provide a basic understanding of some aspects of the disclosed embodiments, the following is a brief summary. This summary is not intended to be a comprehensive review, identify key or essential elements, or delineate the scope of these embodiments. Its sole purpose is to present some concepts in a simplified form as a prelude to the detailed description that follows.

[0012] The purpose of this invention is to improve the signal-to-noise ratio of the imaging system and achieve low-background imaging of non-repetitive DNA sequences and single-molecule RNA. It uses the CRISPR / dCas9-sgRNA complex to target nucleic acid sequences in living cells and a cascade fluorescence signal amplification system mediated by antigen-dependent luminescence fluorescent nanobodies to achieve high signal-to-noise ratio imaging, referred to as the BRIGHT system ( B i-NI R -Fb-mediated cascade-dependent I illumination for non-repetitive G enomicloci H igh-SNR T This imaging system can significantly improve the signal-to-noise ratio of imaging, greatly reducing background noise while amplifying the signal, thereby achieving high signal-to-noise ratio imaging of non-repetitive DNA sequences and single-molecule RNA in living cells.

[0013] According to a first aspect of an embodiment of the present invention, a live cell nucleic acid imaging system based on CRISPR and nanoantibodies is provided.

[0014] In one embodiment, the live cell nucleic acid imaging system based on CRISPR and nanobodies comprises:

[0015] A modified dCas protein expression vector, comprising: a dCas9 or dCas13 sequence and n tandem antigen polypeptide tags that specifically bind to corresponding nanobodies, wherein n is an integer greater than or equal to 1, and they are connected in an operable manner and the connection mode is not fixed, and the optimal connection mode can be selected according to actual needs;

[0016] A modified sgRNA and / or crRNA expression vector comprising: an sgRNA and / or crRNA backbone and a guide sequence specific for the target sequence, with the fluorescent sequence such as the mCherry sequence of the plasmid removed to avoid interference with the interpretation of imaging results;

[0017] A fluorescent nanobody expression vector comprises a heavy chain variable region sequence engineered from pure heavy chain antibodies from camels and sharks, with a fluorescent protein sequence inserted at the N65 / C66 sites to recognize the tandem antigen peptide tag in the engineered dCas protein expression vector. The expression vector contains m fluorescent nanobody encoding sequences, where m is an integer greater than or equal to 2; the fluorescent protein sequence can be a variety of colors across the entire spectral range from ultraviolet to near-infrared.

[0018] In one embodiment, the modified dCas protein expression vector, the modified sgRNA and / or crRNA expression vector and the fluorescent nanobody expression vector are transfected into the cell line.

[0019] In one embodiment, in the BRIGHT system, the dCas protein may be a dCas9 protein and / or a dCas13 protein, wherein the dCas9 protein is used for DNA-based nucleic acid imaging and the dCas13 protein is used for RNA-based nucleic acid imaging;

[0020] In one embodiment, the modified dCas protein expression vector is a dCas9 expression vector, and the dCas9 sequence is shown in SEQ ID No: 1.

[0021] In one embodiment, the dCas9 protein is derived from Staphylococcus aureus. Those skilled in the art can replace it with dCas9 proteins including but not limited to those derived from Neisseria meningitidis according to actual needs.

[0022] In one embodiment, the antigen polypeptide tag fused to the dCas9 sequence is an ALFA polypeptide, which can be replaced by antigen polypeptide tags such as Myc and FLAG according to actual needs by those skilled in the art. The ALFA sequence is shown in SEQ ID No: 2.

[0023] "n×ALFA" represents n ALFA polypeptides linked in series, which may be connected via a linker sequence selected from commonly used linker sequences in the art. Wherein n is an integer greater than or equal to 2, such as 2, 3, 4, 5, 6, 7, 8, or a larger integer, and there is no particular upper limit. Those skilled in the art can select an appropriate value for n based on actual needs.

[0024] In one embodiment, in the BRIGHT system, the number of dCas9-linked ALFAs is 1, 4, 8, 16, and 24, and the dCas9-n×ALFA (n=1, 4, 8, 16, 24) fusion protein sequences are shown in SEQ ID No: 3, 4, 5, 6, and 7, respectively.

[0025] In one embodiment, in the BRIGHT system, the CRISPR RNA expression vector is paired with the dCas protein. If a dCas9 expression vector is selected, an sgRNA expression vector is constructed accordingly; if a dCas13 expression vector is selected, a crRNA expression vector is constructed accordingly.

[0026] In one embodiment, in the BRIGHT system, the fluorescent nanobody is an ALFA nanobody, and the inserted fluorescent protein is the miRFP670nano3 near-infrared fluorescent protein. The fluorescent nanobody has the property of self-degradation, that is, in the absence of dCas9-n×ALFA, the antibody is degraded through the ubiquitin-proteasome pathway, and only when dCas9-n×ALFA is expressed and stably bound to the fluorescent nanobody can it emit stable red fluorescence.

[0027] The fluorescent nanobody expression vector comprises m fluorescent nanobody coding sequences, wherein m is an integer greater than or equal to 2. In a specific embodiment, m is 2 (bivalent fluorescent nanobody, Bi-NIR-Fb ALFA ) or 3 (trivalent fluorescent nanobody, Tri-NIR-Fb ALFA ), the Bi-NIR-Fb ALFA The sequence is shown in SEQ ID No: 8, the Tri-NIR-Fb ALFA The sequence is shown in SEQ ID No:9.

[0028] In other embodiments, the ALFA nanobody can be replaced by, but not limited to, Myc nanobodies, FLAG nanobodies, etc. The fluorescent nanobody and the antigen polypeptide tag connected in series with dCas9 exist in a paired combination, such as the ALFA antigen polypeptide tag and the ALFA nanobody. Other similar antigens and nanobody combinations can also be used in the CRISPR and fluorescent nanobody-based imaging labeling system of the present invention.

[0029] In other embodiments, the near-infrared fluorescent protein in the fluorescent nanobody can be replaced by, but not limited to, green fluorescent protein, red fluorescent protein, blue fluorescent protein, etc. The screening principles are as follows: (1) can be stably expressed in mammalian cells; (2) no exogenous cofactors are required to avoid potential effects on cell function; (3) small size (less than 20 kDa), exists in monomeric form, and is suitable for insertion as an internal tag into Bi-Fb ALFA N65 / C66 sites; (4) The structure is compact, and the N-terminus and C-terminus are close to each other in space, ensuring that they do not interfere with Bi-Fb ALFA Spatial conformational changes during antigen recognition and binding. The same imaging effect can be achieved using fluorescent proteins of other colors, such as inserting miniGFP1 into Bi-FbALFA The N65 / C66 sites of ALFA Green fluorescent nanobody, the sequence of which is shown in SEQ ID No: 10.

[0030] The expression of fluorescent nanobodies is driven by CMV promoter, EF-1α core promoter, hPGK promoter and miniCMV promoter, and the promoter sequences are shown in SEQ ID No: 11, 12, 13, and 14, respectively. Preferably, the hPGK promoter has the best imaging effect.

[0031] For dCas9 recombinant protein, conventional promoters such as SV40 promoter and CMV promoter can be used to continuously promote the expression of dCas9 recombinant protein and sgRNA. Those skilled in the art can select an appropriate promoter.

[0032] For sgRNA, a suitable promoter such as the U6 promoter can be selected.

[0033] According to the needs of actual applications, those skilled in the art can easily select appropriate plasmids to construct the above-mentioned expression vectors (i.e., modified dCas protein expression vectors, modified sgRNA and / or crRNA expression vectors, and fluorescent nanobody expression vectors). Available plasmids include, but are not limited to, pcDNA3.1, PX330, and lentivirus.

[0034] The dCas9-n×ALFA expression vector in the CRISPR and fluorescent nanobody-based imaging labeling system of the present invention can be replaced by a dCas9-n×ALFA protein or a cell line stably expressing the dCas9-n×ALFA protein.

[0035] The present invention's live cell nucleic acid imaging system based on CRISPR and nanobodies can achieve high signal-to-noise ratio imaging labeling of non-repetitive sequences. This is achieved by the self-degradation of free fluorescent nanobodies while the dCas9 recombinant protein and fluorescent nanobodies form an exponential cascade signal amplification complex at the target nucleic acid. ALFA As an example, the process of imaging marker aggregation is schematically illustrated: (1) Cascade process: dCas9-16×ALFA first forms a complex with sgRNA and binds to the DNA site targeted by sgRNA. Then, dCas9-16×ALFA recruits Bi-NIR-Fb through antigen-antibody interaction. ALFA , Bi-NIR-Fb ALFAThe dual antigen-binding arms can bind to two antigen epitopes simultaneously, thus playing a "bridge" role to bind to the second layer of dCas9-16×ALFA, which in turn recruits more Bi-NIR-Fb ALFA Therefore, the BRIGHT system of the present invention is composed of dCas9-16×ALFA and Bi-NIR-Fb ALFA Repeated recruitment and binding eventually form dCas9-n×ALFA / Bi-NIR-Fb ALFA This aggregate contains multiple near-infrared fluorescent protein groups, thereby achieving high-fold amplification of the fluorescence signal. (2) Background denoising: Bi-NIR-Fb ALFA Can bind two molecules of ALFA, only Bi-NIR-Fb ALFA Red fluorescence can only be emitted when both antigen-binding arms are stably bound to dCas9-16×ALFA. In the free state or when a single antigen-binding arm is stably bound to dCas9-16×ALFA, it will be degraded through the ubiquitin-proteasome pathway and thus cannot emit light. (3) Imaging effect: The signal cascade causes multiple near-infrared fluorescent proteins to aggregate at the target site, greatly improving the fluorescence intensity of the signal point of the BRIGHT system. Background denoising causes the free near-infrared fluorescent protein to self-degrade, greatly reducing the background fluorescence signal intensity, thereby achieving the effect of high signal-to-noise ratio imaging of non-repetitive sequences using only one sgRNA ( Figure 1 ).

[0036] According to a second aspect of an embodiment of the present invention, a method for nucleic acid imaging of living cells based on CRISPR and nanoantibodies is provided.

[0037] In one embodiment, the live cell nucleic acid imaging method based on CRISPR and nanobodies comprises:

[0038] Construct a CRISPR and nanobody-based live-cell nucleic acid imaging system, including a modified dCas protein expression vector, a modified sgRNA and / or crRNA expression vector, and a fluorescent nanobody expression vector;

[0039] The components of the constructed CRISPR and nanoantibody-based live cell nucleic acid imaging system are transfected into the cells to be detected;

[0040] Live cell imaging instruments such as confocal microscopes and multimodal super-resolution microscopes were used to observe the fluorescent signal spots formed by the live cell nucleic acid imaging system based on CRISPR and nanoantibodies.

[0041] Among them, cell transfection method is a conventional transfection method that can introduce exogenous DNA sequences into cells, including the use of lentivirus, Transfection was performed using transfection reagents such as Polyplus and Lipofectamine 3000 transfection reagent (Thermo FISHer) and electroporation methods.

[0042] The signal points formed by the BRIGHT system in the present invention have sufficient fluorescence signal intensity and can be observed and photographed using a confocal microscope or a common optical microscope in the art.

[0043] In one embodiment, the BRIGHT live-cell DNA imaging system was constructed by targeting the telomeres of HEK293T cells, and the telomere imaging effect was compared with that of the CRISPR SunTag system (referred to as the SunTag system) developed by Ronald D. Val and the dCas9 / 2×PP7-sgRNA / PCP-3×GFP imaging system (referred to as the PP7-PCP system) in CRISPRainbow developed by Ma Hanhui.

[0044] In one embodiment, the selected target DNA sequences include multiple types of high-copy highly tandemly repeated sequences, low-copy low-copy tandemly repeated sequences, and single-copy non-repetitive sequences, which can be located on or outside the chromosomal DNA and can be any sequence derived from the human genome or introduced exogenously; the dCas9 protein can be replaced by RNA targeting proteins such as dCas13, so that this method can be used for imaging labeling of RNA in living cells, wherein the selected target RNA sequences include multiple types such as transcripts of genes of interest, non-coding RNA, microRNA, etc.

[0045] In one embodiment, the imaging specificity of the BRIGHT live cell DNA non-repetitive sequence imaging system is verified and the optimal conditions for visualizing non-repetitive sequences are determined. The specificity of single-copy non-repetitive DNA sequence imaging is verified by co-localization with Oligo FISH imaging technology. Preferably, dCas9-16×ALFA / Bi-NIR-Fb ALFA and dCas9-24×ALFA / Bi-NIR-Fb ALFA Visualizing non-repetitive sequences has the highest signal-to-noise ratio.

[0046] In one embodiment, the selected labeled cell lines are Hela cell line, HepG2 cell line and U2OS cell line. Those skilled in the art can select corresponding cell lines for imaging according to actual needs, including but not limited to various mammalian cell lines.

[0047] In one embodiment, the BRIGHT system described in the present invention can be used to label extrachromosomal DNA sequences (such as eccDNA, HBV cccDNA, etc.).

[0048] According to a third aspect of an embodiment of the present invention, there is provided a use of a live cell nucleic acid imaging system based on CRISPR and nanoantibodies, and a use of a live cell nucleic acid imaging system based on CRISPR and nanoantibodies in a kit.

[0049] The technical solution provided by the embodiment of the present invention may have the following beneficial effects:

[0050] (1) This invention establishes a new method for live-cell nucleic acid imaging labeling based on CRISPR and fluorescent nanobodies, providing a technical foundation for live-cell nucleic acid sequence imaging and enabling high signal-to-noise ratio imaging of single-copy sites. The technical ideas provided by this invention can provide empirical methods for the development of new live-cell nucleic acid imaging technologies.

[0051] (2) The live cell nucleic acid imaging system proposed in the present invention has simple components and can achieve cascade signal amplification only through the antigen-antibody interaction of dCas-tandem antigen polypeptide fusion protein and fluorescent nanobody.

[0052] (3) The live cell nucleic acid imaging system proposed in the present invention is based on the multivalent binding ability, luminescence characteristics and antigen-dependent stability of fluorescent nanoantibodies, and simultaneously realizes cascade signal amplification based on antigen-antibody interaction and background noise reduction based on self-degradation of free fluorescent elements, thereby maximizing the high signal-to-noise ratio imaging of DNA non-repetitive sequences and single-molecule RNA, and significantly improving the imaging effect.

[0053] (4) The live cell nucleic acid imaging system proposed in the present invention is operational. By serially connecting different copies of fluorescent nanobodies, bivalent, trivalent or higher-valent nanobodies can be constructed. By making the nanobodies carry different fluorescent proteins, live cell imaging systems with different fluorescent labels can be flexibly designed, thereby achieving multicolor imaging.

[0054] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0056] Figure 1 The schematic diagram of the construction of fluorescent nanobody and BRIGHT live cell imaging system according to an exemplary embodiment is shown; by inserting miRFP670nano3 near-infrared fluorescent protein into ALFA nanobody (Nb ALFA ) at the N65 / C66 site to construct a near-infrared fluorescent nanobody (NIR-Fb ALFA). Use (G4S)5 linker to connect two NIR-Fb ALFA Connect to form a bivalent infrared fluorescent nanobody (Bi-NIR-Fb ALFA dCas9-16×ALFA relies on antigen-antibody interaction to recruit Bi-NIR-Fb ALFA , Bi-NIR-Fb ALFA The dual antigen-binding arms can bind to two antigen epitopes simultaneously, thus playing a "bridge" role and ultimately forming dCas9-n×ALFA / Bi-NIR-Fb ALFA In a free state or when a single antigen-binding arm is stably bound to dCas9-16×ALFA, it will be degraded through the ubiquitin-proteasome pathway and will not emit light.

[0057] Figure 2 Schematic diagram of the construction and verification results of dCas9-n×ALFA (n=1, 4, 8, 16, 24) fusion protein expression plasmids according to an exemplary embodiment; Figure 2 A is a schematic diagram of constructing a dCas9-n×ALFA fusion protein expression plasmid based on the dCas9-24×GCN4 fusion protein expression plasmid; Figure 2 B is the result of enzyme electrophoresis of dCas9-n×ALFA plasmid; Figure 2 C is the telomere labeling results of dCas9 and dCas9-n×ALFA;

[0058] Figure 3 Bi-NIR-Fb is shown according to an exemplary embodiment ALFA Schematic diagram of the construction and verification of expression plasmids; Figure 3 A shows the mRNA expression levels of dCas9-24×ALFA and dCas9-24×GCN4 in each group detected by RT-qPCR; Figure 3 B is the detection of Bi-NIR-Fb in each group by RT-qPCR ALFA mRNA expression levels; Figure 3 C is the microscopic results of the ALFA polypeptide group, GCN4 polypeptide group and proteasome inhibition group 24 hours after transfection; Figure 3 D shows the TagBFP fluorescence intensity of the above groups; Figure 3 E shows the near-infrared fluorescence intensity of the above groups;

[0059] Figure 4 Bi-miniGFP-Fb is shown according to an exemplary embodiment ALFA Diagram of the construction of green fluorescent nanobody; Figure 4 A shows the protein structure and sequence composition of miniGFP1; Figure 4B shows Bi-miniGFP-Fb ALFA Protein structure prediction results;

[0060] Figure 5 Bi-NIR-Fb is shown according to an exemplary embodiment ALFA Promoter optimization result diagram; Figure 5 A: The mRNA expression levels of dCas9-24×ALFA in different promoter groups were detected by RT-qPCR; Figure 5 B is the detection of Bi-NIR-Fb in different promoter groups by RT-qPCR ALFA mRNA expression levels; Figure 5 C shows the expression of Bi-NIR-Fb in different promoter groups. ALFA Comparison results of mRNA expression levels of Figure 5 D shows Bi-NIR-Fb carrying different promoters ALFA Microscopic results after co-transfection with dCas9-24×ALFA plasmid; Figure 5 E for different promoter groups Bi-NIR-Fb ALFA Comparison results of near-infrared fluorescence intensity;

[0061] Figure 6 is a diagram showing telomere imaging results using the BRIGHT system, the SunTag system, and the PP7-PCP system according to an exemplary embodiment; Figure 6 A The first row shows the maximum intensity projection results of the Z-stack of representative telomere labeling results of the BRIGHT system, SunTag system, and PP7-PCP system; the second row shows the XYZ three-dimensional images of the representative results in the first row; the third row shows the curve of the fluorescence intensity of the representative signal points obtained by Plot Profile analysis of the selected signal points in the first row of images as a function of the line spacing; Figure 6 B is the statistical result of the fluorescence intensity of the telomere imaging signal points of the above three systems; Figure 6 C is the statistical result of the signal-to-noise ratio of telomere imaging of the above three systems;

[0062] Figure 7 This is a microscopic result diagram showing the use of the BRIGHT system to label highly tandemly repeated sequences of the Chr3, Chr13 and MUC4 genes according to an exemplary embodiment;

[0063] Figure 8 is a microscopic result diagram showing the use of the BRIGHT system to label low-level tandem repeat sequences on Chr9, Chr13, Chr17, Chr19, and Chr21 according to an exemplary embodiment;

[0064] Figure 9is a diagram showing a non-repetitive sequence labeling result according to an exemplary embodiment; Figure 9 A shows the microscopic results of labeling MUC4.1, MUC4.2, MUC4.3, MUC4.4, PPP1R2 and SOX1 non-repetitive sequences using the BRIGHT system; Figure 9 B shows the expression of Bi-miniGFP-Fb ALFA Microscopic results showing the MUC4.1 locus;

[0065] Figure 10 is a diagram showing the co-localization experimental results of MUC4.1 labeled by the BRIGHT system and MUC4Rep labeled by Oligo-FISH according to an exemplary embodiment;

[0066] Figure 11 According to an exemplary embodiment, dCas9-n×ALFA (n=1, 4, 8, 16, 24), Bi-NIR-Fb ALFA Bivalent Nanobodies and Tri-NIR-Fb ALFA The result diagram of the trivalent nanobody labeling the MUC4.1 site; Figure 11 A is the result graph under the microscope and the curve of the fluorescence intensity of representative signal points obtained by Plot Profile analysis versus the distance between the lines; Figure 11 B is the statistical result of the diameter of the signal points of each group marking MUC4.1 sites; Figure 11 C is the statistical result graph of the signal-to-noise ratio of each group of labeled MUC4.1 sites;

[0067] Figure 12 The figure shows the microscopic results of labeling MUC4.1 non-tandem repeat sequences in HeLa, HepG2 and U2OS cells using the BRIGHT system according to an exemplary embodiment. DETAILED DESCRIPTION

[0068] The following description and the accompanying drawings sufficiently illustrate the specific embodiments of this invention to enable those skilled in the art to practice them. Portions and features of some embodiments may be included in or replace portions and features of other embodiments. The scope of the embodiments herein includes the entire scope of the claims, and all available equivalents of the claims.

[0069] As used herein, unless otherwise specified, the term "plurality" means two or more.

[0070] In this document, the character " / " indicates that the preceding and following objects are in an "or" relationship. For example, A / B means: A or B.

[0071] In this article, the term "and / or" is used to describe the association relationship between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or, A and B.

[0072] In the absence of conflict, the embodiments of the present invention and the features thereof may be combined with each other.

[0073] Example 1 Preparation and Verification of Components of the BRIGHT Live Cell DNA Imaging System

[0074] This example describes the plasmids used in other examples of the present invention. The specific sequence information of these plasmids is detailed in the sequence listing.

[0075] (1) Construction and verification of dCas9-n×ALFA fusion protein expression plasmid

[0076] ① Construction of dCas9-n×ALFA fusion protein expression plasmid: Based on the dCas9-24×GCN4 fusion protein expression plasmid in the SunTag system (Addgene#60910), the 24×GCN4 sequence was removed by double digestion with BamHI and SalI. The tandem ALFA polypeptide (amino acid sequence: SRLEEELRRRLTE) coding sequence of different copies (1, 4, 8, 16, 24) synthesized by the gene was inserted into the digested vector to construct the dCas9-n×ALFA fusion protein expression plasmid ( Figure 2 A). This vector drives the expression of the dCas9-n×ALFA fusion protein under the control of the SV40 promoter. The expressed fusion protein can target and recognize specific sites under the guidance of sgRNA. The sequences of the dCas9-1×ALFA, dCas9-4×ALFA, dCas9-8×ALFA, dCas9-16×ALFA, and dCas9-24×ALFA fusion proteins provided by the present invention are shown in SEQ ID Nos: 3, 4, 5, 6, and 7, respectively.

[0077] ②Verify the target binding ability of dCas9-n×ALFA fusion protein: Verify the target binding ability of dCas9-n×ALFA fusion protein based on the PP7-PCP system.

[0078] The experimental steps are as follows:

[0079] a. HEK293T cells were plated and cultured overnight. Transfection was performed after the cell density reached 70%.

[0080] b. 30 min before transfection, the culture medium was replaced with 2 mL of Opti-MEM reduced serum medium (phenol red-free, ThermoFISHer).

[0081] c. Add 200 μL to a 1.5 mL EP tube buffer(Polyplus).

[0082] d. According to the plasmid transfection dosage in Table 1, add 200 μL of each plasmid Buffer. Vortex for 10 seconds and then centrifuge.

[0083] e. The transfection reagent was vortexed for 5 seconds and then centrifuged.

[0084] f. According to the total nucleic acid mass (μg): transfection reagent (μL) = 1:2 ratio, add the corresponding volume Transfection reagent, vortex for 1 second and then centrifuge.

[0085] g. Incubate at room temperature for 10 minutes.

[0086] h. Slowly add the transfection mixture to the culture dish, gently shake to mix, and incubate at 37°C for 4-6 hours.

[0087] After 4-6 hours, replace the transfection medium with complete medium and return the plate to the incubator.

[0088] j. The results were observed using a confocal fluorescence microscope 24 hours after transfection.

[0089] Table 1 Transfection system

[0090]

[0091] Experimental results:

[0092] Figure 2 B is the electrophoresis verification result of double digestion of dCas9-n×ALFA (n=1, 4, 8, 16, 24) using BamHI and SalI. Figure 2 C shows the telomere labeling results for the dCas9 positive control group and the dCas9-n×ALFA experimental group. Similar to the positive control group, the dCas9-n×ALFA fusion protein was able to target telomeres under the guidance of 2×PP7-sgRNA, indicating that the fusion of tandem ALFA peptides does not affect the dCas9 target binding ability.

[0093] (2) Construction and verification of fluorescent nanobody expression plasmid

[0094] ①Construction of Bi-NIR-Fb ALFA Fusion protein expression plasmid: Bi-NIR-Fb obtained by gene synthesis ALFABivalent Nanobody coding sequence, wherein the two Nanobody sequences are connected by a (G4S)5 connecting peptide ( Figure 1 The coding sequence was inserted between the KpnI and BamHI restriction sites of the CMV-pcDNA3.1(+) plasmid vector to construct Bi-NIR-Fb ALFA Fusion protein expression plasmid. This vector drives Bi-NIR-Fb under the control of CMV promoter. ALFA Fusion protein expression, the Bi-NIR-Fb ALFA The sequence is shown in SEQ ID No:8.

[0095] ②Verification of Bi-NIR-Fb ALFA Antigen-dependent stability of fusion proteins: setting up dCas9-24×ALFA and Bi-NIR-Fb ALFA Co-transfection (ALFA peptide group), dCas9-24×GCN4 and Bi-NIR-Fb ALFA Co-transfection (GCN4 peptide group) and dCas9-24×GCN4 and Bi-NIR-Fb ALFA After 16 hours of co-transfection, the proteasome inhibitor MG132 was superimposed and treated for 6 hours (proteasome inhibition group). Transfection was performed as shown in Table 2. 24 hours after transfection, the dCas9-24×ALFA, dCas9-24×GCN4, and Bi-NIR-Fb groups were analyzed by dye-based RT-qPCR and confocal microscopy. ALFA β-catenin was used as an internal control for dye-based RT-qPCR. The primer sequences used for dye-based RT-qPCR are shown in Table 3.

[0096] Table 2 Co-transfection system

[0097] ALFA peptide group GCN4 peptide group Proteasome inhibition group Transfection volume dCas9-24×ALFA dCas9-24×GCN4 dCas9-24×GCN4 0.30 pmol <![CDATA[Bi-NIR-Fb ALFA ]]> <![CDATA[Bi-NIR-Fb ALFA ]]> <![CDATA[Bi-NIR-Fb ALFA ]]> 0.15 pmol

[0098] Table 3 Primer sequences used in dye-based RT-qPCR experiments

[0099] Primers sequence Serial number dCas9-24×ALFA forward primer CCCTGCCCTCCAAATATGTGA SEQ ID No:15 dCas9-24×ALFA rear primer GCACCTTGTCCAGATTAGCG SEQ ID No: 16 dCas9-24×GCN4 forward primer CCCTGCCCTCCAAATATGTGA SEQ ID No: 17 dCas9-24×GCN4 rear primer GCACCTTGTCCAGATTAGCG SEQ ID No: 18 <![CDATA[Bi-NIR-Fb ALFA Forward primer]]> ATACGTCCACGGCAGATACCAG SEQ ID No: 19 <![CDATA[Bi-NIR-Fb ALFA Post primer]]> CCCCACAGCTTCTTGCCTT SEQ ID No:20 β-catenin forward primer CACCATTGGCAATGAGCGGTTC SEQ ID No:21 β-catenin rear primer AGGTCTTTGCGGATGTCCACGT SEQ ID No:22

[0100] Note: RT-qPCR detects the dCas9 fragments of dCas9-24×ALFA and dCas9-24×GCN4, so the front and back primers of dCas9-24×ALFA and dCas9-24×GCN4 are the same.

[0101] Experimental results:

[0102] Figure 3 A shows that the mRNA expression levels of dCas9-24×ALFA and dCas9-24×GCN4 in each group were consistent. The specific data of Ct values are shown in Table 4.

[0103] Figure 3 B shows the Bi-NIR-Fb ALFA The mRNA expression levels of the two genes were consistent with those of the two genes, and the specific Ct values are shown in Table 4.

[0104] Figure 3 C and Figure 3 D shows that TagBFP blue fluorescence was visible in all groups, and there was no statistical difference in fluorescence intensity (p>0.05), indicating that the expression levels of dCas9-24×ALFA and dCas9-24×GCN4 fusion proteins were consistent among the groups;

[0105] Figure 3 C shows that the GCN4 peptide group has no obvious near-infrared fluorescence, while the ALFA peptide group has strong near-infrared fluorescence. Figure 3 E quantitative analysis of near-infrared fluorescence intensity showed that the fluorescence intensity of ALFA peptide group was 2070.28 times that of GCN4 peptide group, indicating that Bi-NIR-Fb ALFA It specifically binds to ALFA polypeptide and depends on the stable presence of ALFA polypeptide; when MG132 proteasome inhibitor is added to block the proteolytic activity of 26S proteasome complex, the near-infrared fluorescence of GCN4 polypeptide group recovers to 75.53% of that of ALFA polypeptide group, and the fluorescence intensity is 1563.74 times that of GCN4 polypeptide group, indicating that Bi-NIR-Fb ALFA Degraded through the proteasome pathway.

[0106] Table 4 RT-qPCR detection results

[0107]

[0108] ③Construction of Tri-NIR-Fb ALFA Fusion protein expression plasmid: Tri-NIR-Fb obtained by gene synthesis ALFA The coding sequence of trivalent nanobody is connected by (G4S)5 connecting peptide. The coding sequence is inserted between KpnI and BamHI restriction sites of CMV-pcDNA3.1(+) plasmid vector to construct Tri-NIR-Fb ALFA Fusion protein expression plasmid. This vector drives Tri-NIR-Fb under the control of CMV promoter. ALFA Fusion protein expression, the Tri-NIR-Fb ALFA The sequence is shown in SEQ ID No:9.

[0109] ④ Expand the imaging spectral range of the BRIGHT system: miniGFP1 is a monomeric green fluorescent protein naturally present in Arabidopsis thaliana, with a size of 12.6 kDa and composed of 110 amino acids ( Figure 4 A), with a maximum excitation wavelength of 450nm and a maximum emission wavelength of 499nm. Its monomeric, small size, ability to exist stably in mammalian cells and the absence of exogenous cofactors are suitable for the development of self-degradable Bi-Fb in other spectral ranges. ALFA By inserting the miniGFP protein into Bi-Fb ALFA The N65 / C66 site ( Figure 4 B) AlphaFold3 was used to predict protein structure and construct Bi-miniGFP-Fb ALFA Green fluorescent nanobody (sequence corresponding to SEQ ID No: 10).

[0110] ⑤Optimization of Bi-NIR-Fb ALFA Promoter sequence: Based on Bi-NIR-Fb carrying CMV promoter (strong promoter) ALFA The fusion protein expression plasmid was constructed by removing the CMV promoter sequence using MluI and SacI endonucleases, and inserting the EF-1α core promoter, hPGK promoter (medium strength), and miniCMV (weak promoter) sequences into the site to construct Bi-NIR-Fb with promoters of different strengths. ALFA The expression plasmids, the nucleotide sequences of each promoter correspond to SEQ ID No: 11, 12, 13, 14. ALFA The molar mass ratio was 2:1, and dCas9-24×ALFA (0.30 pmol) and Bi-NIR-Fb carrying different promoters were co-transfected. ALFA Plasmid (0.15 pmol) was injected into HEK293T cells, and dCas9-24×ALFA and Bi-NIR-Fb in each group were detected by dye RT-qPCR. ALFA The mRNA level of the promoter was measured (the primer sequences used in the dye-based RT-qPCR experiment are shown in Table 3, and β-catenin was used as an internal reference). The near-infrared fluorescence intensity was observed under a confocal microscope, and the promoter with high mRNA level and fluorescence intensity, no aggregation, and no nonspecific binding to the nucleolus was selected as the optimal condition.

[0111] Experimental results:

[0112] Figure 5 A shows that the mRNA expression levels of dCas9-24×ALFA were consistent among the groups. Specific Ct value data are shown in Tables 5.1 and 5.2.

[0113] Figure 5 B shows Bi-NIR-Fb ALFAThe mRNA expression levels were CMV promoter > EF-1α core promoter > hPGK promoter > miniCMV promoter. The specific Ct value data are shown in Tables 5.1 and 5.2.

[0114] Figure 5 C shows Bi-NIR-Fb regulated by CMV promoter, EF-1α core promoter and hPGK promoter ALFA The mRNA expression levels of the promoter were 64.00, 36.50 and 5.31 times that of the miniCMV promoter, respectively.

[0115] Figure 5 D shows Bi-NIR-Fb carrying different promoters ALFA Microscopic results after co-transfection with dCas9-24×ALFA plasmid: TagBFP blue fluorescence was used to indicate the expression of dCas9-24×ALFA protein in each group. The near-infrared fluorescence intensity showed significant differences among the groups. Obvious near-infrared fluorescent plaque aggregation was observed in the CMV promoter-induced group, non-specific binding to the nucleus was observed in the EF-1α core promoter group, no obvious fluorescence aggregation or non-specific binding to the nucleus was observed in the hPGK promoter group, and no obvious near-infrared fluorescence was observed in the miniCMV promoter group.

[0116] Figure 5 E shows Bi-NIR-Fb regulated by CMV promoter, EF-1α core promoter and hPGK promoter ALFA The near-infrared fluorescence intensities were 24.25, 6.39 and 3.03 times that of the miniCMV promoter, respectively.

[0117] Under the condition that dCas9-24×ALFA expression is consistent among the groups, different promoter regulation leads to Bi-NIR-Fb ALFA The difference in expression levels is caused by the difference in expression regulation of different promoters. Among them, the hPGK promoter can control Bi-NIR-Fb ALFA Moderate expression level and no Bi-NIR-Fb ALFA Fluorescent patches caused by aggregation and non-specific binding to nucleoli, so hPGK was selected as Bi-NIR-Fb ALFA Optimal promoter for the plasmid.

[0118] Table 5.1 RT-qPCR test results (1)

[0119]

[0120]

[0121] Table 5.2 RT-qPCR test results (II)

[0122]

[0123] (3) Construction of sgRNA expression plasmid: Based on the plasmid expressing telomeric sgRNA in the SunTag system (Addgene #51024), the mCherry sequence was removed by double digestion with AgeI and SgrAI, and the complementary sticky ends formed after double digestion were ligated by ligase to construct the telomere-targeting sgTelomere plasmid. sgRNA expression plasmids targeting other sites were constructed by the Gibson seamless cloning method.

[0124] Example 2: Targeting telomeres to construct the BRIGHT live cell DNA imaging system

[0125] For live cell imaging of telomeres, the sgTelomere targeting telomere (experimental group) and the sgRNA expression plasmids targeting GAL4 (negative control group, the targeting site does not exist in human cells) were transfected with dCas9-24×ALFA and Bi-NIR-Fb according to the transfection system in Table 6. ALFA The expression plasmid was transfected into HEK293T cells, and the labeling results were observed using a confocal microscope 24 hours later. To verify the signal amplification capability of the BRIGHT system, telomeres were labeled in HKE293T cells based on the SunTag system live cell imaging system (based on dCas9 protein modification) and the PP7-PCP imaging system (based on sgRNA modification) according to the transfection system in Table 6. The results were observed 24 hours after transfection. Using the Straight Line tool in ImageJ, a line was drawn along the central axis of the representative signal point, and the Plot profile tool was used to plot the change curve of fluorescence intensity as a function of the spatial distance of the line. The fluorescence intensity (Signal) of 20 signal points in each group was quantitatively analyzed by ImageJ software, and 30 circular areas of the same size (10×10 pixels) were randomly selected in the background area using the Oval Selection tool to calculate the average background fluorescence intensity (Noise), thereby calculating the SNR value.

[0126] Table 6 Transfection system

[0127]

[0128] Experimental results:

[0129] Figure 6Figure A shows that the telomere-like near-infrared fluorescence signal produced by the BRIGHT imaging system is evenly distributed throughout the cell nucleus, with a bright signal and extremely low background. The negative control group targeting GAL4 exhibited only a uniformly diffuse near-infrared fluorescence background signal, with no nonspecific binding observed, further demonstrating the telomere-labeling specificity of the BRIGHT system. In contrast, the SunTag system results in significant nuclear background fluorescence due to the constitutively overexpressed scFv-sfGFP, which is stably isolated outside the target site. The PP7-PCP system has a signal amplification factor of only 6x, resulting in a weaker fluorescence signal.

[0130] Figure 6 B and 6C analyzed the fluorescence signal intensity and SNR of 20 telomere signal points of the three labeling systems, respectively. The average signal-to-noise ratio of telomere imaging of the BRIGHT system of the present invention was 72.68±13.28, which was 35.34 times and 13.22 times that of the SunTag system and PP7-PCP system.

[0131] In summary, the present invention significantly reduces background fluorescence while increasing signal intensity, achieving a better telomere labeling effect, which is due to the Bi-NIR-Fb ALFA and dCas9-24×ALFA-mediated exponential signal amplification and free Bi-NIR-Fb ALFA self-degradation properties.

[0132] Example 3: Labeling other tandem repeat sequences using the BRIGHT live cell DNA imaging system

[0133] The CRISPRbar database (http: / / genome.ucf.edu / CRISPRbar / ) was used to screen high tandem repeat sequences (copy number>100) (target sequences correspond to SEQ ID No:23, 24, 25) and low tandem repeat sequences (copy number 5 to 100) (target sequences correspond to SEQ ID No:26, 27, 28, 29, 30, 31) located on different chromosomes. The specific sequences are shown in Table 7. These sequences are known, belong to the public domain, and have been described in other literature. The sgRNA, dCas9-24×ALFA and Bi-NIR-Fb targeting sites were used. ALFA The expression plasmid was transfected into HEK293T cells, and the labeling results were observed using a confocal microscope 24 hours later.

[0134] Table 7 sgRNA information targeting other tandem repeat sequences

[0135]

[0136] Experimental results:

[0137] Figure 7 and Figure 8 The microscopic results of using the BRIGHT system to label high-order tandem repeat sequences (copy number >100, located in Chr3, Chr13 and MUC4 genes) and low-order tandem repeat sequences (copy number 5-100, located in Chr9, Chr13, Chr17, Chr19 and Chr21) on different chromosomes are shown respectively. Two bright near-infrared fluorescent signal spots can be seen in the cell nucleus, indicating that the new method can achieve the labeling of repetitive sequences other than telomeres.

[0138] Example 4: Labeling of non-tandem repeat sequences using the BRIGHT live cell DNA imaging system

[0139] A total of 6 non-repetitive sequences were selected, including the MUC4 gene on chromosome 3 (4), the PPP1R2 gene on chromosome 3 (1), and the SOX1 gene on chromosome 13 (1). The target sequences correspond to SEQ ID No: 32, 33, 34, 35, 36, and 37, respectively. The specific sequences are shown in Table 8. These sequences are known, belong to the public domain, and have been described in other literature. The sgRNA, dCas9-24×ALFA, and Bi-NIR-Fb targeting sites were used. ALFA The expression plasmid was transfected into HEK293T cells, and the labeling results were observed using a confocal microscope 24 hours later.

[0140] To verify Bi-miniGFP-Fb ALFA The non-repetitive sequence imaging capability was achieved by combining sgRNA, dCas9-24×ALFA and Bi-miniGFP-Fb targeting the MUC4.1 locus. ALFA The expression plasmid was transfected into HEK293T cells, and the labeling results were observed using a confocal microscope 24 hours later.

[0141] Table 8 Information of sgRNA targeting non-tandem repeat sequences

[0142]

[0143] Experimental results:

[0144] Figure 9 A shows the microscopic results of labeling non-tandem repeat sequences on different chromosomes using the BRIGHT system. Two bright near-infrared fluorescent signal spots can be seen in the cell nucleus, indicating that the new method can label non-tandem repeat sequences.

[0145] Figure 9 B shows the expression of Bi-miniGFP-Fb ALFA The results of the microscopy of the MUC4.1 site were that two bright green fluorescent signal spots were visible in the cell nucleus, indicating that Bi-miniGFP-FbALFA It can also mark non-tandem repeat sequences.

[0146] Example 5 Verification of the performance of the BRIGHT live cell DNA non-repetitive sequence imaging system

[0147] ① Imaging specificity:

[0148] To verify the imaging specificity of non-repetitive sequences, co-localization imaging experiments of the BRIGHT system and Oligo-FISH were performed. The BRIGHT system targeted the MUC4.1 non-tandem repeat sequence, and Oligo-FISH targeted MUC4Rep (oligonucleotide fluorescent probe: / Cy3 / CTTCCTGTCACCGAC).

[0149] The experimental steps are as follows:

[0150] BRIGHT Live Cell DNA Imaging:

[0151] a. Place a 20mm×20mm coverslip on the bottom of a six-well plate and treat with poly-D-lysine to promote cell attachment and growth. Seed HEK293T cells on the slide. When the confluency reaches 70%, use jetPRIME transfection reagent (Polyplus) according to the transfection system in Table 9 to transfect sgRNA targeting MUC4.1, dCas9-24×ALFA, and Bi-NIR-Fb ALFA The expression plasmid was transfected into the above cells.

[0152] Oligo-FISH:

[0153] b. 16 h after transfection, wash once with 1 mL 1× PBS to remove dead cells.

[0154] c. Fix with 4% paraformaldehyde for 15 min (room temperature).

[0155] d. Wash three times with PBS, 5 min (room temperature).

[0156] e. Permeabilize with 2×SSC containing 0.7% Triton X-100 for 30 min (room temperature).

[0157] f. Wash cells twice with 2×SSC (room temperature).

[0158] g. Treat with 100 μg / mL RNase A at 37°C for 1 h (37°C).

[0159] h. Wash once with 2×SSC for 5 min (room temperature).

[0160] i. Equilibrate in PBS for 5 min (room temperature).

[0161] j. Dehydration: 70%, 85%, 100% for 2 minutes each, and air dry (room temperature).

[0162] k. Adjustment The temperature of the ThermoBrite in situ hybridization instrument is 80°C. Place the slide on the hybridization instrument, add 100 μL of 2×SSC containing 70% formamide to the slide, place the cell coverslip upside down on the slide, and maintain at 80°C for 10 minutes to denature the sample.

[0163] l: Shake the slide vertically to remove the coverslip.

[0164] m: Incubate the coverslips with 70%, 85%, or 100% ice ethanol pre-cooled at -20°C for 5 min (incubation on ice).

[0165] n: After removing the ethanol and air-drying the sample, add 10 μL of oligonucleotide fluorescent probe hybridization solution to the coverslip, place it upside down on a slide, and seal it with a rubber seal.

[0166] o: Set the hybridizer temperature to 37°C and incubate the slides on the hybridizer overnight.

[0167] After 16 h, the coverslips were removed and washed three times with 2× SSC in the dark (room temperature).

[0168] q: Confocal observation after DAPI staining.

[0169] Table 9 Transfection system

[0170]

[0171]

[0172] Experimental results:

[0173] Figure 10 The colocalization experiment results are shown, giving the BRIGHT imaging results a red pseudocolor and the Oligo-FISH imaging results a green pseudocolor. The colocalization signal of the two is yellow, indicating that the BRIGHT system can specifically label the MUC4.1 non-repetitive sequence.

[0174] ②Optimal conditions for visualization of non-repetitive sequences.

[0175] The key components of the BRIGHT imaging system are dCas9-n×ALFA and nanoantibodies with cascade effects, which are alternately connected to achieve exponential amplification of the fluorescence signal. To determine the optimal conditions for visualizing non-repetitive sequences, dCas9-n×ALFA (n=1, 4, 8, 16, 24) (500ng), Bi-NIR-FbALFA Bivalent nanobody (500ng) and Tri-NIR-Fb ALFA The MUC4.1 genomic locus was labeled with a trivalent nanobody (500 ng). Images were acquired under the same imaging conditions for all experimental groups. ImageJ software was used to quantitatively analyze the fluorescence intensity (Signal) of 20 signal points in each group. The Oval Selection tool was used to randomly select 30 circular areas of equal size (10 × 10 pixels) in the background region to calculate the average background fluorescence intensity (Noise), thereby calculating the SNR value. The Straight Line tool in ImageJ was used to draw a line along the central axis of a representative signal point, and the Plot Profile tool was used to plot the change in fluorescence intensity as a function of the spatial distance between the lines.

[0176] Experimental results:

[0177] Figure 11 A is the use of dCas9-n×ALFA (n=1, 4, 8, 16, 24), Bi-NIR-Fb ALFA and Tri-NIR-Fb ALFA The result of MUC4.1 genomic site labeling and the curve of the fluorescence intensity of representative signal points obtained by Plot Profile analysis versus the distance between the lines. ALFA When imaging, dCas9-1×ALFA, dCas9-4×ALFA, and dCas9-8×ALFA failed to successfully mark the MUC4.1 site, while dCas9-16×ALFA and dCas9-24×ALFA successfully marked the MUC4.1 site. ALFA During imaging, dCas9-1×ALFA and dCas9-4×ALFA failed to successfully mark the MUC4.1 site, while dCas9-8×ALFA, dCas9-16×ALFA, and dCas9-24×ALFA successfully marked the MUC4.1 site.

[0178] Figure 11 B shows the diameter of the signal points of each group marking MUC4.1 sites. ALFA / dCas9-16×ALFA、Bi-NIR-Fb ALFA / dCas9-24×ALFA、Tri-NIR-Fb ALFA / dCas9-8×ALFA、Tri-NIR-Fb ALFA / dCas9-16×ALFA and Tri-NIR-Fb ALFAThe average diameters of the signal spots at the MUC4.1 sites marked by / dCas9-24×ALFA were 0.97±0.16μm, 1.16±0.29μm, 0.65±0.18μm, 0.90±0.27μm, and 1.08±0.24μm, respectively.

[0179] Figure 11 C shows the SNR values of each group of MUC4.1 sites. ALFA / dCas9-16×ALFA、Bi-NIR-Fb ALFA / dCas9-24×ALFA、Tri-NIR-Fb ALFA / dCas9-8×ALFA、Tri-NIR-Fb ALFA / dCas9-16×ALFA and Tri-NIR-Fb ALFA The average SNRs of MUC4.1 sites labeled with dCas9-24×ALFA were 52.91±19.14, 57.19±25.93, 19.92±8.70, 29.56±11.54 and 37.36±11.21, respectively. ALFA The signal-to-noise ratio of the group was significantly higher than that of Tri-NIR-Fb ALFA group (p<0.01), while Bi-NIR-Fb ALFA / dCas9-16×ALFA and Bi-NIR-Fb ALFA There was no statistical difference in the signal-to-noise ratio between the / dCas9-24×ALFA groups (p>0.05).

[0180] In summary, Bi-NIR-Fb ALFA / dCas9-16×ALFA group and Bi-NIR-Fb ALFA Both / dCas9-24×ALFA groups can achieve high signal-to-noise ratio imaging of non-repetitive sequences.

[0181] Example 6: The BRIGHT system can be used to image non-repetitive sequences in various cell lines.

[0182] Tumor cell lines of different tissue origins and disease types were selected, including human cervical cancer cell line HeLa, human liver cancer cell line HepG2, and human osteosarcoma cell line U2OS. According to the transfection system in Table 10, sgRNA targeting MUC4.1, dCas9-16×ALFA, and Bi-NIR-Fb were transfected using Lipofectamine 3000 transfection reagent (Thermo FISHer). ALFA The expression plasmid was transfected into the above cells, and the labeling results were observed using a confocal microscope 24 hours later.

[0183] Table 10 Transfection system

[0184]

[0185] The experimental steps are as follows:

[0186] a. Hela, HepG2, and U2OS cells were plated and cultured overnight. Transfection was performed after the cell density reached 70%.

[0187] b. 30 min before transfection, the culture medium was replaced with 2 mL of Opti-MEM reduced serum medium (phenol red-free, ThermoFISHer).

[0188] c. Dilute Lipofectamine TM 3000 Reagent: Add 125 μL Opti-MEM to a 1.5 mL EP tube TM Culture medium, followed by the addition of 7.5 μL Lipofectamine TM 3000 μl of reagent, vortex for 2-3 seconds and then centrifuge.

[0189] d. Dilute DNA: Add 125 μL Opti-MEM to another 1.5 mL EP tube TM Culture medium, according to the plasmid transfection dosage in Table 10, add each plasmid to 125 μL Opti-MEM TM In culture medium. According to total nucleic acid mass (μg): P3000 TM Reagent (μL) = 1:2 ratio, add the corresponding volume of P3000 TM Reagent, vortex for 5 seconds and then centrifuge.

[0190] e. 125 μL diluted Lipofectamine TM Mix 3000 μL of reagent and 125 μL of diluted DNA, vortex for 2-3 seconds and then centrifuge.

[0191] f. Incubate at room temperature for 15 minutes.

[0192] g. Slowly add 250 μL of transfection mixture to the culture dish, gently shake to mix, and incubate at 37°C for 4-6 hours.

[0193] After 4-6 h, replace the transfection medium with complete medium and return the plate to the incubator.

[0194] i. Observe the results using a confocal fluorescence microscope 24 hours after transfection.

[0195] Experimental results:

[0196] Figure 12The microscopic results of labeling MUC4.1 non-tandem repeat sequences in HeLa, HepG2 and U2OS cells using the BRIGHT system are shown. 3, 2 and 2 signal spots were observed in HeLa, HepG2 and U2OS cells, respectively, indicating that the new method can achieve imaging of non-repetitive sequences in different cell lines.

[0197] The present invention is not limited to the structures described above and shown in the drawings, and various modifications and changes can be made without departing from the scope thereof. The scope of the present invention is limited only by the appended claims.

Claims

1. A live cell nucleic acid imaging system based on CRISPR and nanobodies, characterized in that: Including modified dCas protein expression vector, modified sgRNA and / or crRNA expression vector and fluorescent nanobody expression vector; Among them, the modified dCas protein expression vector contains a tandem antigen polypeptide tag that can bind to the corresponding nanobody; The modified sgRNA and / or crRNA expression vector contains a specific guide sequence for the detection target sequence that can be paired with the dCas protein; The antigen complementarity determining region of the nanobody in the fluorescent nanobody expression vector can recognize the tandem antigen polypeptide tag in the modified dCas protein expression vector, and the fluorescent protein is inserted between the nanobody cleavage sites as an internal tag.

2. A live cell nucleic acid imaging system based on CRISPR and nanoantibodies according to claim 1, characterized in that: The modified dCas protein expression vector, modified sgRNA and / or crRNA expression vector and fluorescent nanobody expression vector are transfected into the cell line.

3. A live cell nucleic acid imaging system based on CRISPR and nanoantibodies according to claim 1, characterized in that: The dCas protein is dCas9 protein and / or dCas13 protein, wherein the dCas9 protein is used for DNA nucleic acid imaging and the dCas13 protein is used for RNA nucleic acid imaging; the dCas9-fused tandem antigen polypeptide tag and the fluorescent nanoantibody exist in a paired combination.

4. A live cell nucleic acid imaging system based on CRISPR and nanoantibodies according to claim 1, characterized in that: The modified dCas protein expression vector and fluorescent nanobody expression vector contain nuclear localization sequences when marking nucleic acid sequences in the cell nucleus.

5. The live cell nucleic acid imaging system based on CRISPR and nanoantibodies according to claim 1, characterized in that: The fluorescent nanobody expression vector is driven by the CMV promoter, EF-1α core promoter, hPGK promoter and miniCMV promoter.

6. A live cell nucleic acid imaging system based on CRISPR and nanoantibodies according to claim 1, characterized in that: The fluorescent protein inserted into the fluorescent nanobody expression vector has an excitation band ranging from ultraviolet to near-infrared full spectrum band to display imaging effects of different colors of fluorescence, wherein the sequence copy number of the fluorescent nanobody is variable.

7. A method for live cell nucleic acid imaging based on CRISPR and nanoantibodies, characterized in that: include: Constructing a live cell nucleic acid imaging system based on CRISPR and nanobodies according to any one of claims 1 to 6; The components of the constructed CRISPR and nanoantibody-based live cell nucleic acid imaging system are transfected into the cells to be detected; A live cell imaging instrument was used to observe the fluorescent signal spots formed by the live cell nucleic acid imaging system based on CRISPR and nanoantibodies.

8. The method for live cell nucleic acid imaging based on CRISPR and nanoantibodies according to claim 7, characterized in that: When the dCas protein is dCas9 protein, the method is used for imaging and labeling DNA in living cells, wherein the DNA includes repetitive sequences and non-repetitive sequences.

9. The method for live cell nucleic acid imaging based on CRISPR and nanoantibodies according to claim 7, characterized in that: When the dCas protein is dCas13 protein, the method is used for imaging and labeling RNA in living cells, where the RNA includes transcripts of genes of interest, non-coding RNA, and microRNA.

10. A use of a live cell nucleic acid imaging system based on CRISPR and nanobodies, characterized in that: Use of a CRISPR and nanobody-based live-cell nucleic acid imaging system for a kit.

Images