Compositions, systems and methods for modulating hepatitis b virus by targeting gene repression

Abstract

Provided herein are epigenetically modified DNA targeting systems, such as CRISPR-Cas / Guiding RNA (gRNA) systems, for transcriptional repression of Hepatitis B Virus (HBV) genes to promote cell phenotypes that lead to reduced HBV infection. In some embodiments, the epigenetically modified DNA targeting system binds to or targets a target site of at least one gene in a hepatitis B virus DNA sequence or a regulatory element thereof in a cell. In some aspects, the provided systems relate to transcriptional repression of one or more hepatitis B virus genes and / or regulatory elements thereof. In some aspects, also provided herein are methods and uses related to the provided compositions, for example, in repression of hepatitis B virus replication and expression associated with hepatitis B infection.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 399,634, filed on August 19, 2022, entitled “Compositions, Systems, and Methods for Regulating Hepatitis B Virus by Targeted Gene Repression,” U.S. Provisional Application No. 63 / 472,236, filed on June 9, 2023, entitled “Compositions, Systems, and Methods for Regulating Hepatitis B Virus by Targeted Gene Repression,” and U.S. Provisional Application No. 63 / 531,309, filed on August 7, 2023, entitled “Compositions, Systems, and Methods for Regulating Hepatitis B Virus by Targeted Gene Repression,” the contents of which are incorporated by reference in their entirety. Incorporation by Reference into the Sequence Listing

[0002] This application is submitted with a sequence listing in electronic format. The sequence listing is provided as a file titled 224742002040SeqList.xml, created on August 18, 2023, and is 1,595,298 bytes in size. The information in the electronic sequence listing is incorporated by reference in its entirety. Technical Field

[0003] In some respects, the present disclosure relates to an epigenetic modification DNA targeting system for the transcriptional repression of hepatitis B virus (HBV) genes to promote the epigenetic modification DNA targeting system of the cell phenotype that causes HBV infection to reduce, such as CRISPR-Cas / guidance RNA (gRNA) system. In some embodiments, the epigenetic modification DNA targeting system is bound to or targets the target site of at least one gene or its regulatory element in the hepatitis B virus DNA sequence in the cell. In some embodiments, the system is a multiplex system that is bound to or targets the target site in at least two genes or its regulatory elements. In some respects, the system of the present disclosure relates to the transcriptional repression of one or more hepatitis B virus genes. In some respects, the present disclosure relates to the method and uses related to the composition provided, for example, in the repression hepatitis B virus replication and expression related to the treatment of hepatitis B infection. Background Art

[0004] A large number of patients (estimated to have 1 million people in the United States alone and 250 million people worldwide) suffer from chronic hepatitis B infection. However, current standard of care (including inhibition of viral DNA transcription such as administration of nucleoside analogs, pegylated interferon, antisense oligonucleotides, and siRNA approaches) faces challenges in efficacy and stability. Therefore, new and improved methods are needed to overcome these challenges. The present disclosure addresses these and other needs. Summary of the Invention

[0005] Provided herein is an epigenetic modification DNA targeting system comprising at least one DNA targeting module for suppressing the transcription of one or more hepatitis B virus (HBV) genes, wherein each of the at least one DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence; and (b) at least one transcription repressor effector domain. In some embodiments, the at least one DNA binding domain comprises a clustered regularly interspaced short palindromic repeats-related (Cas)-guide RNA (gRNA) combination, the combination comprising (a) a Cas protein or a variant thereof and (b) at least one gRNA; a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a mega-nuclease; a homing endonuclease; or an I-SceI enzyme or a variant thereof, optionally wherein the DNA binding domain comprises a catalytically inactive variant of any of the foregoing. In some embodiments, the hepatitis B virus DNA sequence is an HBV gene or its regulatory element. In some embodiments, the at least one DNA targeting module comprises a plurality of DNA targeting modules for targeting a plurality of target sites of one or more genes or their regulatory elements. In some embodiments, the plurality of DNA targeting modules comprises at least a first DNA targeting module and a second DNA targeting module, wherein: (1) the first DNA targeting module represses transcription of a first HBV gene, wherein the first DNA targeting module comprises a first fusion protein comprising (a) a DNA binding domain for targeting a target site of the first gene or its regulatory DNA element; and (b) at least one transcriptional repressor domain; and (2) the second DNA targeting module represses transcription of a second HBV gene, wherein the second DNA targeting module comprises a second fusion protein comprising (a) a DNA binding domain for targeting a target site of the second gene or its regulatory DNA element; and (b) at least one transcriptional repressor domain. and (b) at least one transcriptional repressor domain, optionally wherein: the first DNA-targeting module and the second DNA-targeting module have the same fusion protein, such that the first fusion protein and the second fusion protein are identical, and wherein the DNA-binding domain of the fusion protein is a Clustered Regularly Interspaced Short Palindromic Repeats-associated (Cas) protein or a variant thereof; and the first DNA-targeting module comprises a first guide RNA (gRNA) that targets a target site of a first HBV gene or a regulatory element thereof, and the second DNA-targeting module comprises a second gRNA that targets a target site of a second HBV gene or a regulatory element thereof.

[0006] Also provided herein is an epigenetic modification DNA targeting system for suppressing the transcription of one or more hepatitis B virus (HBV) genes, wherein the DNA targeting system comprises: (a) a fusion protein comprising a clustered regularly interspaced short palindromic repeats-related (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain; and (b) a plurality of guide RNAs (gRNAs), wherein the plurality of guide RNAs comprises at least a first gRNA and a second gRNA, wherein the first gRNA targets a target site of a first HBV gene or its regulatory element, and the second gRNA targets a target site of a second HBV gene or its regulatory element, wherein the first gene and the second gene or its regulatory element regulate hepatitis B virus replication and / or HBV transcription. In some embodiments, the DNA targeting system further comprises a third gRNA targeting a target site of a third gene or its regulatory element, wherein the third gene or its regulatory element regulates hepatitis B virus replication and / or HBV transcription. In some embodiments, the system further comprises a fourth gRNA targeting a target site of a fourth gene or its regulatory element, optionally a fifth gRNA targeting a fifth gene or its regulatory element, and / or optionally a sixth gRNA targeting a target site of a sixth gene or its regulatory element, wherein the gene or its regulatory element regulates hepatitis B virus replication and / or HBV transcription. In some embodiments, the first gene, the second gene, the third gene, the fourth gene, the fifth gene, and / or the sixth gene or its regulatory element are different.

[0007] Also provided herein is an epigenetic modification DNA targeting system for repressing transcription of one or more hepatitis B virus (HBV) genes, wherein the DNA targeting system comprises: (a) a fusion protein comprising a clustered regularly interspaced short palindromic repeats-associated (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain; and (b) a plurality of guide RNAs (gRNAs) targeting a plurality of target sites of a plurality of genes or their regulatory elements, wherein the plurality of genes or their regulatory elements regulate hepatitis B virus replication and / or HBV transcription.

[0008] Also provided herein is an epigenetic modification DNA targeting system, comprising a single DNA targeting module for repressing transcription of more than one hepatitis B virus (HBV) gene, wherein the DNA targeting module comprises: (a) a fusion protein comprising a clustered regularly interspaced short palindromic repeats-associated (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain; and (b) guide RNAs (gRNAs) targeting multiple target sites of multiple genes or their regulatory elements, wherein the multiple genes or their regulatory elements regulate hepatitis B virus replication and / or HBV transcription.

[0009] In any of the embodiments herein, suppressing transcription results in reduced HBV replication and / or reduced HBV protein levels.

[0010] In any of the embodiments herein, the DNA targeting system does not introduce gene disruption or DNA breakage.

[0011] In any of the embodiments herein, the at least one DNA binding module comprises a plurality of DNA binding modules that together target a plurality of target sites in the HBV DNA sequence, optionally wherein each DNA binding module targets a different target site in the HBV DNA sequence.

[0012] In any embodiment herein, the multiple target sites are 2, 3, 4, 5 or 6 different target sites. In any embodiment herein, the multiple target sites are each in a different HBV gene or regulatory element thereof.

[0013] In any of the embodiments herein, each target site is in the same HBV gene or regulatory element thereof.

[0014] In any of the embodiments herein, the system comprises 2 to 10 DNA targeting modules.

[0015] In any of the embodiments herein, any two or more of the DNA-targeting modules have the same fusion protein, or wherein any two or more of the DNA-targeting modules comprise different fusion proteins.

[0016] In any of the embodiments herein, the DNA-binding domain of each DNA-targeting module comprises a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats-associated (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain, and wherein each DNA-targeting module comprises a unique gRNA.

[0017] In any embodiment herein, each of the target site or the target site exists in the form of covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA), and / or in the HBV viral DNA integrated in human genomic DNA. In any embodiment herein, each of the target site or the target site exists in or near a gene or its regulatory element that participates in controlling HBV replication and / or HBV transcription.

[0018] In any embodiment herein, the gene encoding polymerase, envelope protein, capsid protein, transcription factor or transcription transactivator involved in controlling HBV replication and / or HBV transcription. In any embodiment herein, the gene encoding polymerase, envelope protein, capsid protein, transcription factor or transcription transactivator involved in controlling HBV replication and / or HBV transcription is a polymerase gene, S family gene, X gene or core family gene.

[0019] In any of the embodiments herein, at least one target site is in the gene encoding the Hepatitis B virus X protein (HBx) X gene or a regulatory element thereof.

[0020] In any embodiment herein, the target site or each of the target sites is at or near a regulatory element of an HBV gene involved in controlling HBV replication and / or HBV transcription. In some embodiments, the regulatory element is a promoter region. In some embodiments, the promoter region is a pre-S1 promoter, a pre-S2 promoter, an X promoter, or a basic core promoter. In some embodiments, the regulatory element is an enhancer region. In some embodiments, the enhancer region is an Enh1 or Enh2 enhancer region. In some embodiments, the regulatory element is a transcript processing control region.

[0021] In any embodiment herein, each of the target site or the target site is in the coding region of the HBV gene. In any embodiment herein, each of the target site or the target site is positioned within 500 base pairs (bp) of the transcription start site, within 1000bp, within 1500bp. In any embodiment herein, each of the target site or the target site is located in a target region, and the target region is positioned between 0-3300 base pairs (bp) of the HBV genome, optionally at a base pair between 0-3182bp corresponding to the position of the HBV genome shown in SEQ ID NO:650. In any embodiment herein, each of the target site or the target site is located in a target region, and the target region is positioned at a base pair between 43bp-490bp, 1033bp-1749bp, 1800bp-1950bp or 2953bp-3182bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO:650. In any embodiment herein, the target site or each of the target sites is located within a target region, and the target region is positioned at a base pair between 1 bp-42 bp, 491 bp-1032 bp, 1750 bp-1799 bp, or 1951 bp-2952 bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO: 650. In any embodiment herein, the target site or each of the target sites is in a CpG island of the HBV genome. In any embodiment herein, the target site or each of the target sites is located within a target region, and the target region is positioned at a base pair between 67 bp-392 bp, 1033 bp-1749 bp, or 2215 bp-2490 bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO: 650. In any of the embodiments herein, the target site or each of the target sites is located within a target region located between base pairs 1033 bp and 1749 bp in the hepatitis B virus sequence with reference to the nucleotide position of SEQ ID NO: 650. In any of the embodiments herein, the target site or each of the target sites is within a target region located within 300 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx).

[0022] Also provided herein is an epigenetic modification DNA targeting system comprising at least one DNA targeting module for repressing transcription of one or more hepatitis B virus (HBV) genes, wherein each of the at least one DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site within a target region spanning 300 base pairs upstream of the start codon of hepatitis B virus X protein (HBx); and (b) at least one transcriptional repressor effector domain.

[0023] In any embodiment herein, the or each of said target sites is located in the HBx basal core promoter region. In any embodiment herein, the or each of said target sites is located in the HBx promoter / enhancer region.

[0024] In any embodiment herein, the target site or each of the target sites is within a target region within 250 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site or each of the target sites is within a target region having a sequence corresponding to a sequence located at base pairs between 1060-1480bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:650. In any embodiment herein, the target site or each of the target sites is within a target region within 150 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site or each of the target sites is within a target region within 120 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site or each of the target sites is within a target region sequence corresponding to a sequence spanning 1250-1374bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:650. In any of the embodiments herein, the target site or each of the target sites is within a target region sequence corresponding to a sequence spanning 1255-1302 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO: 650. In any of the embodiments herein, the target site or each of the target sites is within a target region sequence corresponding to a sequence spanning 1260-1300 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO: 650.

[0025] In any embodiment herein, the target site or each of the target sites is at least 70% homologous to all hepatitis B virus genomes. In any embodiment herein, the target site or each of the target sites is at least 70% homologous to at least 1000 hepatitis B virus genomes. In any embodiment herein, the target site or each of the target sites is at least 70% homologous to at least 1000 hepatitis B virus genomes and comprises at most two mismatches.

[0026] In any embodiment herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 1-195, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence to any of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 175, 138, 192, 152, 118, 125, 185, 63, 116, 124, 35, 82, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence to any of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 175, 138, 192, 152, 118, 125, 185, 63, 116, 124, 35, 82. In any of the embodiments herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NO: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. In any of the embodiments herein, the target site or each of the target sites comprises a sequence set forth in any one of SEQ ID NOs: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192. In any embodiment herein, the target site or each of the target sites is as shown in SEQ ID NO: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence of any of the foregoing. In any embodiment herein, the target site or each of the target sites is as shown in SEQ ID NO: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192.In any embodiment herein, the target site or each of the target sites comprises the sequence shown in SEQ ID NO: 22, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any of the foregoing, optionally wherein the target site is as shown in SEQ ID NO: 22. In any embodiment herein, the target site or each of the target sites comprises the sequence shown in SEQ ID NO: 63, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any of the foregoing, optionally wherein the target site is as shown in SEQ ID NO: 63.

[0027] In any embodiment herein, the gRNA or each of the gRNAs comprises a gRNA spacer sequence comprising a sequence as shown in any one of SEQ ID NOs: 196-390. In any embodiment herein, the gRNA or each of the gRNAs further comprises a sequence as shown in SEQ ID NO: 587. In any embodiment herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 196-390. In any embodiment herein, the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 391-585. In any of the embodiments herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 370, 333, 387, 347, 313, 320, 380, 256, 258, 311, 319, 230, 272, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 565, 528, 542, 508, 515, 575, 515, 453, 506, 514, 425, or 472. In any of the embodiments herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 370, 333, 387, 347, 313, 320, 380, 256, 258, 311, 319, 230, 272, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 565, 528, 542, 508, 515, 575, 515, 453, 506, 514, 425, or 472.In any embodiments herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 370, 371, 377, 380, 384, 385, 387, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence of any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in SEQ ID NOs: Any one of NO: 369, 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582. In any embodiments herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NO: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 370, 371, 377, 380, 384, 385, or 387, optionally wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NO: 200, 201, 207, 217, 221, 224, Any one of NO: 369, 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582.In any of the embodiments herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any one of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582. In any embodiment herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387. In any embodiment herein, the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582. In any embodiment herein, the gRNA or each of the gRNAs comprises a sequence as shown in SEQ ID NO: 217, a continuous portion of at least 14 nucleotides thereof, or a complementary sequence of any of the foregoing. In any embodiment herein, the gRNA or each of the gRNAs comprises a sequence as shown in SEQ ID NO: 217. In any embodiment herein, the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO: 412. In any embodiment herein, the gRNA or each of the gRNAs comprises the sequence shown in SEQ ID NO: 258, a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In any embodiment herein, the gRNA or each of the gRNAs comprises the sequence shown in SEQ ID NO: 258. In any embodiment herein, the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO: 453.

[0028] In any embodiment herein, the target site or each of the target sites is at least 90% homologous to all hepatitis B virus genomes. In any embodiment herein, the target site or each of the target sites is at least 90% homologous to at least 1000 hepatitis B virus genomes. In any embodiment herein, the target site or each of the target sites is at least 90% homologous to at least 1000 hepatitis B virus genomes and comprises at most two mismatches, optionally one or two mismatches.

[0029] In any of the embodiments herein, the or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 35-100, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any one of the foregoing.

[0030] In any embodiment herein, the gRNA or each of the gRNAs comprises a gRNA spacer sequence comprising a sequence as shown in any one of SEQ ID NOs: 230-295. In any embodiment herein, the gRNA or each of the gRNAs further comprises a sequence as shown in SEQ ID NO: 587. In any embodiment herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 230-295, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 425-490.

[0031] In any of the embodiments herein, the at most two mismatches are located in the first 12 nt on the 5' end of the protospacer.

[0032] In any of the embodiments herein, the or each of the target sites is at least 90% homologous to at least 1000 hepatitis B virus genomes and comprises zero mismatches.

[0033] In any embodiment herein, the target site comprises a sequence as shown in any one of SEQ ID NOs: 1-34, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. In any embodiment herein, the gRNA or each of the gRNAs comprises a gRNA spacer sequence comprising a sequence as shown in SEQ ID NOs: 196-229.

[0034] In any embodiment herein, the length of the gRNA spacer sequence is between 14nt and 24nt or between 16nt and 22nt. In any embodiment herein, the length of the gRNA spacer sequence is 18nt, 19nt, 20nt, 21nt or 22nt.

[0035] In any of the embodiments herein, the gRNA spacer sequence comprises modified nucleotides to increase stability.

[0036] In any embodiment herein, the at least one gRNA further comprises the sequence shown in SEQ ID NO: 587. In any embodiment herein, the gRNA or each of the gRNAs comprises the sequence shown in any one of SEQ ID NOs: 196-229, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 391-424. In any embodiment herein, the gRNA or each of the gRNAs comprises the sequence shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582. In any of the embodiments herein, the gRNA comprises the sequence shown in SEQ ID NO: 217, optionally wherein the gRNA is shown in SEQ ID NO: 412.

[0037] In any embodiment herein, the Cas protein or its variant is a Cas9 protein or its variant. In any embodiment herein, the Cas protein or its variant is a Cas12 protein or its variant. In any embodiment herein, the Cas protein or its variant is a variant Cas protein, wherein the variant Cas protein lacks nuclease activity or is an inactivated Cas (dCas) protein. In any embodiment herein, the variant Cas protein is a variant Cas9 protein lacking nuclease activity or being an inactivated Cas9 (dCas9) protein. In any embodiment herein, the Cas9 protein or its variant is a Staphylococcus aureus (Staphylococcus aureus) Cas9 (SaCas9) protein or its variant. In any embodiment herein, the variant Cas9 is a Staphylococcus aureus dCas9 protein (dSaCas9) comprising at least one amino acid mutation selected from D10A and N580A, with reference to the numbering of the position of SEQ ID NO:596. In any embodiment herein, the variant Cas9 protein comprises the sequence shown in SEQ ID NO: 597, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the Cas9 protein or its variant is a Streptococcus pyogenes Cas9 (SpCas9) protein or its variant. In any embodiment herein, the variant Cas9 is a Streptococcus pyogenes dCas9 (dSpCas9) protein comprising at least one amino acid mutation selected from D10A and H840A, with reference to the numbering of the positions of SEQ ID NO: 598. In any embodiment herein, the variant Cas9 protein comprises the sequence shown in SEQ ID NO: 599, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0038] In any embodiment herein, the at least one DNA binding domain comprises an engineered zinc finger protein (eZFP). In any embodiment herein, the at least one DNA binding domain is an eZFP. In any embodiment herein, the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, 1052, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In any embodiment herein, the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, 1052.

[0039] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); 2) F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) F6: DSSHRTR (SEQ ID NO: 731) NO:731); 3) F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO: 736) F6: QSSDLRR (SEQ ID NO:737); 4) F1: RSDNLSE (SEQ ID NO: 738) F2: TSSNRKT (SEQ ID NO: 739) F3: DRSHLTR (SEQ ID NO: 740) F4: RSDALTQ (SEQ ID NO: 741) F5: DRSALAR (SEQ ID NO: 742) F6: RRFTLSK (SEQ ID NO: 743); 5) F1: RSDHLSE (SEQ ID NO: 744) F2: QYSGRYY (SEQ ID NO: 745) F3: HGQTLNE (SEQ ID NO: 746) F4: QSGNLAR (SEQ ID NO: 747) F5: RSDSLLR (SEQ ID NO: 748) F6: CREYRGK (SEQ ID NO: 749); 6) F1: QSANRTT (SEQ ID NO: 750) F2: RSANLTR (SEQ ID NO: 751) F3: RSDVLSE (SEQ ID NO: 752) F4: TSGHLSR (SEQ ID NO: 753) F5: QSSDLSR (SEQ ID NO: 754) F6: QWSTRKR (SEQ ID NO: 755);<h2 style=";text-align:left;direction:ltr">7)F1:QSGNLAR(SEQ IDNO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ IDNO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761);8)F1:NPANLTR(SEQ IDNO:762)F2:QNATRTK(SEQ ID NO:763)F3:QSGHLAR(SEQ ID NO:764)F4:NRHDRAK(SEQ IDNO:765)F5:RSDHLSE(SEQ ID NO:766)F6:QRRSRYK(SEQ ID NO:767);9)F1:QSSDLSR(SEQ IDNO: 768) F2: HRSTRNR (SEQ ID NO: 769) F3: RSDVLSA (SEQ ID NO: 770) F4: DSR TRKN (SEQ ID NO: 771) F5: QSGSLTR (SEQ ID NO: 772) F6: DQSGLAH (SEQ ID NO: 773);10) F1: QNPAQWR (SEQID NO: 774) F2: RSADLSR (SEQ ID NO: 775) F3: TSGSLSR (SEQ ID NO: 776) F4: RSDHLSR (SEQ ID NO: 777) F5: RSDSLR (SEQ ID NO: 778) F6: QSYDRFQ (SEQ ID NO: 779);11) F1: TSGSLSR (SEQID NO: 780) F2: RSDHLSR (SEQ ID NO: 780) F3: RSDHLSR (SEQ ID NO: 780) IDNO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ IDNO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ ID NO:785);12)F1:DRSNLSR(SEQID) NO:786)F2:LRQNLIM(SEQ ID NO:787)F3:ERGTLAR(SEQ ID NO:788)F4:RSDALTQ(SEQ IDNO:789)F5:RSDSLSQ(SEQ ID NO:790)F6:RKADRTR(SEQ ID NO:791);<h2 style=";text-align:left;direction:ltr">13)F1:QYCCLTN(SEQID NO:792)F2:TSGNLTR(SEQ ID NO:793)F3:QSSDLSR(SEQ ID NO:794)F4:FRYYLKR(SEQ ID NO:795)F5:QSGDLTR(SEQ ID NO:796)F6:DKGNLTK(SEQ ID NO:797);14)F1:TSGSLSR(SEQID NO:798)F2:RSDNLTT(SEQ ID NO:799)F3:QSGNLAR(SEQ ID NO:800)F4:DRTTLMR(SEQ ID NO:801)F5:QSGHLAR(SEQ ID NO:802)F6:QLTHLNS(SEQ ID NO:803);15)F1:IKHDLHR(SEQID NO:804) F2:RSANLTR(SEQ ID NO:805) F3:RSDNLAR(SEQ ID NO:806) F4:QNVSRPR(SEQ ID NO:807) F5:RSDDLSK(SEQ ID NO:808) F6:DSSHRTR(SEQ ID NO:809);16) F1:RSDNLAR(SEQID NO:810) F2:QNVSRPR(SEQ ID NO:811) F3:RSDDLSK(SEQ ID NO:812) F4:DSSHRTR(SEQ ID NO:813) F5:TSSNRKT(SEQ ID NO:814) F6:AQWTRAC(SEQ ID NO:815);17) F1:RSDDLSK(SEQID NO:816) F2:DSSHRTR(SEQ ID NO:816) NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ ID NO:821);18)F1:QSAHRKN(SEQID NO:822)F2:TSSNRKT(SEQ ID NO:823)F3:RSDNLSA(SEQ ID NO:824)F4:RNNDRKT(SEQ ID NO:825)F5:TSGSLSR(SEQ ID NO:826)F6:QAGHLAK(SEQ ID NO:827);<h2 style=";text-align:left;direction:ltr">19) F1: RSDHLSQ(SEQID NO: 828) F2: ASSTRTK(SEQ ID NO: 829) F3: RSDDLTR(SEQ ID NO: 830) F4: QKSNLSS(SEQ ID NO: 831) F5: QSANRTT(SEQ ID NO: 832) F6: QNATRTK(SEQ ID NO: 833);20) F1: RSDTLSE(SEQID NO: 834) F2: RRWTLVG(SEQ ID NO: 835) F3: DRSNLSR(SEQ ID NO: 836) F4: QSGDLTR(SEQ ID NO: 837) F5: QSSDLSR(SEQ ID NO: 838) F6: YHWYLKK(SEQ ID NO: 839);21) F1: RSANLAR(SEQID NO:840) F2:RSDNLRE(SEQ ID NO:841) F3:RPYTLRL(SEQ ID NO:842) F4:HRSNLNK(SEQ ID NO:843) F5:QSGSLTR(SEQ ID NO:844) F6:TSANLSR(SEQ ID NO:845);22) F1:RSDDLVR(SEQID NO:846) F2:TSGSLVR(SEQ ID NO:847) F3:RSDKLVR(SEQ ID NO:848) F4:RSDELVR(SEQ ID NO:849) F5:TSHSLTE(SEQ ID NO:850) F6:RADNLTE(SEQ ID NO:851);23) F1:ERSHLRE(SEQID NO:852) F2:TSHSLTE(SEQ ID NO:852) NO:853)F3:QAGHLAS(SEQ ID NO:854)F4:TSHSLTE(SEQ ID NO:855)F5:DPGHLVR(SEQ ID NO:856)F6:TSGNLVR(SEQ ID NO:857);24)F1:RADNLTE(SEQID NO:858)F2:TSGSLVR(SEQ ID NO:859)F3:RKDNLKN(SEQ ID NO:860)F4:QSSSLVR(SEQ ID NO:861)F5:RSDKLVR(SEQ ID NO:862)F6:DSGNLRV(SEQ ID NO:863);25) F1: QSSSLVR (SEQ ID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO:869); 26) F1: QSGDLRR (SEQ ID NO: 870) F2: RSDERKR (SEQ ID NO: 871) F3: HRTTLTN (SEQ ID NO: 872) F4: RSDHLTN (SEQ ID NO: 873) F5: TSGELVR (SEQ ID NO: 874) F6: RSDDLVR (SEQ ID NO:875); 27) F1: QRAHLER (SEQ ID NO: 876) F2: QLAHLRA (SEQ ID NO: 877) F3: DPGHLVR (SEQ ID NO:878) F4: RRSACRR (SEQ ID NO:879) F5: RSDHLTT (SEQ ID NO:880) F6: QSSSLVR (SEQ ID NO:881); and 28) F1: QSSNLVR (SEQ ID NO:882) F2: RSDDLVR (SEQ ID NO:883) F3: THLDLIR (SEQ ID NO:884) F4: TSGNLTE (SEQ ID NO:885) F5: RRSACRR (SEQ ID NO:886) F6: RNDTLTE (SEQ ID NO:887). ;

[0040] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO: 822) F2: TSSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827).

[0041] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO: 828) F2: ASSTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833).

[0042] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO: 869).

[0043] Also provided herein is an epigenetic modification DNA targeting system, comprising: a) an eZFP that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses the transcription of one or more HBV genes, wherein the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); 2) F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) F6: DSSHRTR (SEQ ID NO: 731); 3) F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO: 736) F6: QSSDLRR (SEQ ID NO: 737); 4) F1: RSDNLSE (SEQ ID NO: 738) F2: TSSNRKT (SEQ ID NO: 739) F3: DRSHLTR (SEQ ID NO:740)F4:RSDALTQ(SEQ IDNO:741)F5:DRSALAR(SEQ ID NO: 742) F6: RRFTLSK (SEQ ID NO: 743); 5) F1: RSDHLSE (SEQ ID NO: 744) F2: QYSGRYY (SEQ ID NO: 745) F3: HGQTLNE (SEQ ID NO: 746) F4: QSGNLAR (SEQ ID NO: 747) F5: RSDSLLR (SEQ ID NO:748)F6: CREYRGK (SEQ ID NO:749);<h2 style=";text-align:left;direction:ltr">6)F1:QSANRTT(SEQ IDNO:750)F2:RSANLTR(SEQ ID NO:751)F3:RSDVLSE(SEQ ID NO:752)F4:TSGHLSR(SEQ IDNO:753)F5:QSSDLSR(SEQ ID NO:754)F6:QWSTRKR(SEQ ID NO:755);7)F1:QSGNLAR(SEQ IDNO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ IDNO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761);8)F1:NPANLTR(SEQ IDNO:762) F2: QNATRTK(SEQ ID NO:763) F3: QSGHLAR(SEQ ID NO:764) F4: NRHDRAK(SEQ ID NO:765) F5: RSDHLSE(SEQ ID NO:766) F6: QRRSRYK(SEQ ID NO:767);9) F1: QSSDLSR(SEQ ID NO:768) F2: HRSTRNR(SEQ ID NO:769) F3: RSDVLSA(SEQ ID NO:770) F4: DSRRKN(SEQ ID NO:771) F5: QSGSLTR(SEQ ID NO:772) F6: DQSGLAH(SEQ ID NO:773);10) F1: QNPAQWR(SEQID NO:774) F2: RSADLSR(SEQ ID NO:774) NO:775)F3:TSGSLSR(SEQ ID NO:776)F4:RSDHLSR(SEQ ID NO:777)F5:RSDSLLR(SEQ ID NO:778)F6:QSYDRFQ(SEQ ID NO:779);11)F1:TSGSLSR(SEQID NO:780)F2:RSDHLSR(SEQ ID NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ ID NO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ ID NO:785);<h2 style=";text-align:left;direction:ltr">12) F1: DRSNLSR (SEQID NO: 786) F2: LRQNLIM (SEQ ID NO: 787) F3: ERGTLAR (SEQ ID NO: 788) F4: RSDALTQ (SEQ ID NO: 789) F5: RSDSLSQ (SEQ ID NO: 790) F6: RKADRTR (SEQ ID NO: 791);13) F1: QYCCLTN (SEQID NO: 792) F2: TSGNLTR (SEQ ID NO: 793) F3: QSSDLSR (SEQ ID NO: 794) F4: FRYYLKR (SEQ ID NO: 795) F5: QSGDLTR (SEQ ID NO: 796) F6: DKGNLTK (SEQ ID NO: 797);14) F1: TSGSLSR (SEQID NO: NO:798) F2:RSDNLTT(SEQ ID NO:799) F3:QSGNLAR(SEQ ID NO:800) F4:DRTTLMR(SEQ ID NO:801) F5:QSGHLAR(SEQ ID NO:802) F6:QLTHLNS(SEQ ID NO:803);15) F1:IKHDLHR(SEQID NO:804) F2:RSANLTR(SEQ ID NO:805) F3:RSDNLAR(SEQ ID NO:806) F4:QNVSRPR(SEQ ID NO:807) F5:RSDDLSK(SEQ ID NO:808) F6:DSSHRTR(SEQ ID NO:809);16) F1:RSDNLAR(SEQID NO:810) F2:QNVSRPR(SEQ ID NO:810) F2:QNVSRPR(SEQ ID NO:810) NO:811)F3:RSDDLSK(SEQ ID NO:812)F4:DSSHRTR(SEQ ID NO:813)F5:TSSNRKT(SEQ ID NO:814)F6:AQWTRAC(SEQ ID NO:815);17)F1:RSDDLSK(SEQID NO:816)F2:DSSHRTR(SEQ ID NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ ID NO:821);<h2 style=";text-align:left;direction:ltr">18) F1: QSAHRKN (SEQID NO: 822) F2: TSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827);19) F1: RSDHLSQ (SEQID NO: 828) F2: ASTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833);20) F1: RSDTLSE (SEQID NO:834)F2:RRWTLVG(SEQ ID NO:835)F3:DRSNLSR(SEQ ID NO:836)F4:QSGDLTR(SEQ ID NO:837)F5:QSSDLSR(SEQ ID NO:838)F6:YHWYLKK(SEQ ID NO:839);21)F1:RSANLAR(SEQID NO:840)F2:RSDNLRE(SEQ ID NO:841)F3:RPYTLRL(SEQ ID NO:842)F4:HRSNLNK(SEQ ID NO:843)F5:QSGSLTR(SEQ ID NO:844)F6:TSANLSR(SEQ ID NO:845);22)F1:RSDDLVR(SEQID NO:846)F2:TSGSLVR(SEQ ID NO:846)F2:TSGSLVR(SEQ ID NO:846)F3:RSDDL ... NO:847)F3:RSDKLVR(SEQ ID NO:848)F4:RSDELVR(SEQ ID NO:849)F5:TSHSLTE(SEQ ID NO:850)F6:RADNLTE(SEQ ID NO:851);23)F1:ERSHLRE(SEQID NO:852)F2:TSHSLTE(SEQ ID NO:853)F3:QAGHLAS(SEQ ID NO:854)F4:TSHSLTE(SEQ ID NO:855)F5:DPGHLVR(SEQ ID NO:856)F6:TSGNLVR(SEQ ID NO:857);<h2 style=";text-align:left;direction:ltr">24) F1: RADNLTE (SEQID NO: 858) F2: TSGSLVR (SEQ ID NO: 859) F3: RKDNLKN (SEQ ID NO: 860) F4: QSSSLVR (SEQ ID NO: 861) F5: RSDKLVR (SEQ ID NO: 862) F6: DSGNLRV (SEQ ID NO: 863);25) F1: QSSSLVR (SEQID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO: 869);26) F1: QSGDLRR (SEQ ID NO: 869) NO:870) F2: RSDERKR (SEQ ID NO:871) F3: HRTTLTN (SEQ ID NO:872) F4: RSDHLTN (SEQ ID NO:873) F5: TSGELVR (SEQ ID NO:874) F6: RSDDLVR (SEQ ID NO:875);27) F1: QRAHLER (SEQID NO:876) F2: QLAHLRA (SEQ ID NO:877) F3: DPGHLVR (SEQ ID NO:878) F4: RRSACRR (SEQ ID NO:879) F5: RSDHLTT (SEQ ID NO:880) F6: QSSSLVR (SEQ ID NO:881);28) F1: QSSNLVR (SEQID NO:882) F2: RSDDLVR (SEQ ID NO:882) NO:883)F3:THLDLIR(SEQ ID NO:884)F4:TSGNLTE(SEQ IDNO:885)F5:RRSACRR(SEQ ID NO:886)F6:RNDTLTE(SEQ ID NO:887)。;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0044] In any embodiment herein, the engineered zinc finger protein comprises a sequence as set forth in any one of SEQ ID NOs: 692-719 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein is encoded by a sequence as set forth in any one of SEQ ID NOs: 888-915 or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0045] Also provided herein is an epigenetic modification DNA targeting system, comprising: a) an engineered zinc finger protein that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses the transcription of one or more HBV genes, wherein the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO: 822) F2: TSSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827).

[0046] In any of the embodiments herein, the eZFP comprises the sequence set forth in SEQ ID NO: 709 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein comprises the sequence set forth in any one of SEQ ID NO: 709.

[0047] In any embodiment herein, the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 905 or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO: 905.

[0048] Also provided herein is an epigenetic modification DNA targeting system, comprising: a) an engineered zinc finger protein that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses the transcription of one or more HBV genes, wherein the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO: 828) F2: ASSTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833). In some embodiments, the engineered zinc finger protein comprises the sequence shown in SEQ ID NO: 710 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO: 710. In any embodiment herein, the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 906 or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO: 906.

[0049] Also provided herein is an epigenetic modification DNA targeting system, comprising: a) an engineered zinc finger protein that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses the transcription of one or more HBV genes, wherein the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO: 869). In some embodiments, the engineered zinc finger protein comprises the sequence of SEQ ID NO: 716 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein comprises the sequence of any one of SEQ ID NO: 716. In some embodiments, the engineered zinc finger protein is encoded by the sequence of SEQ ID NO: 912 or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein is encoded by the sequence of any one of SEQ ID NO: 912.

[0050] In any embodiment herein, the at least one effector domain induces transcriptional repression. In any embodiment herein, the at least one effector domain is a DNA methyltransferase. In any embodiment herein, the at least one effector domain comprises a DNA methyltransferase and a repressor domain capable of recruiting a heterochromatin inducing factor, or optionally wherein the heterochromatin inducing factor comprises a histone methyltransferase. In any embodiment herein, the at least one effector domain comprises a DNA methyltransferase and a histone methyltransferase. In any embodiment herein, the at least one effector domain is selected from a KRAB repressor domain, an ERF repressor domain, an Mxi1 repressor domain, a SID4X repressor domain, a Mad-SID repressor domain, a LSD1 repressor domain, or a DNMT3A, a DNMT3A-3L, a DNMT3A / L-KRAB fusion repressor domain, a DNMT3B domain binding protein, an EZH2 repressor domain or a LSD1 repressor domain or a variant of any of the foregoing. In any embodiment herein, at least one effector domain comprises a sequence selected from any one of SEQ ID NO: 590 or 600-608, 651, 661, 664, 665, 666, 668, and 669, or a domain thereof, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of the foregoing. In any embodiment herein, the at least one effector domain comprises a KRAB domain or a variant thereof. In any embodiment herein, the at least one effector domain comprises a sequence as set forth in SEQ ID NO: 590, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of the foregoing. In any embodiment herein, the at least one effector domain comprises a DNMT3A / L domain or a variant thereof. In any of the embodiments herein, the at least one effector domain comprises the sequence set forth in SEQ ID NOs: 604 and 607, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing; or the at least one effector domain comprises the sequence set forth in SEQ ID NO: 651, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 651.

[0051] In any embodiment herein, the fusion protein comprises a DNMT3A / 3L-dSpCas9-KRAB fusion protein. In any embodiment herein, the fusion protein comprises the sequence shown in SEQ ID NO: 645, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

[0052] In any of the embodiments herein, the at least one effector domain is fused to the N-terminus, the C-terminus, or both the N-terminus and the C-terminus of the DNA binding domain or a component thereof.

[0053] In any embodiment herein, the fusion protein is encoded by the sequence shown in SEQ ID NO: 680, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing. In any embodiment herein, the fusion protein is encoded by the sequence shown in SEQ ID NO: 680.

[0054] In any embodiment herein, the fusion protein is encoded by a sequence as set forth in any one of SEQ ID NOs: 916-943, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the fusion protein comprises a sequence as set forth in any one of SEQ ID NOs: 944-971, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the fusion protein comprises a sequence as set forth in any one of SEQ ID NOs: 961, 962 or 968.

[0055] In any of the embodiments herein, the fusion protein comprises a DNMT3A / 3L-eZFP-KRAB fusion protein.

[0056] In any embodiment herein, the fusion protein is encoded by a sequence as set forth in any one of SEQ ID NOs: 972-999, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the fusion protein is encoded by a sequence as set forth in any one of SEQ ID NOs: 933, 934 or 940, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the fusion protein comprises a sequence as set forth in any one of SEQ ID NOs: 1000-1027, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the fusion protein comprises a sequence as set forth in any one of SEQ ID NOs: 1017, 1018 or 1024, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0057] In any of the embodiments herein, the fusion protein further comprises one or more nuclear localization signals (NLS).

[0058] In any of the embodiments herein, the fusion protein further comprises one or more linkers connecting two or more of: the DNA binding domain, the at least one effector domain, and the one or more nuclear localization signals.

[0059] In any of the embodiments herein, the DNA targeting system targets the entire hepatitis B virus genome.

[0060] In any embodiment herein, the DNA targeting system targets at least 70% of all hepatitis B virus genomes. In any embodiment herein, the DNA targeting system targets at least 60% of all hepatitis B virus genomes. In any embodiment herein, the DNA targeting system targets at least 50% of all hepatitis B virus genomes.

[0061] In any of the embodiments herein, the DNA targeting system is incapable of introducing gene disruption or DNA breakage at or near the target site.

[0062] In any embodiment herein, suppressing the transcription of one or more HBV genes results in a reduction in RNA levels and / or protein levels from HBV DNA sequences. In any embodiment herein, suppressing transcription includes a reduction in total hepatitis B virus RNA transcript levels. In any embodiment herein, suppressing transcription includes a reduction in hepatitis B virus pre-core ("pre-C"), pre-genome ("pgRNA"), pre-S1, pre-S2 / S, and HBx levels. In any embodiment herein, suppressing transcription includes a reduction in HBx levels. In any embodiment herein, suppressing transcription includes a reduction in hepatitis B virus surface antigen (HBsAg) and / or hepatitis B virus core-associated antigen (HbcrAg) protein levels. In any embodiment herein, suppressing transcription includes a reduction in HbsAg transcripts and / or protein levels by at least 90%. In any embodiment herein, suppressing transcription includes a reduction in HbcrAg transcripts and / or protein levels from cccDNA by at least 50%.

[0063] Also provided herein is a guide RNA (gRNA) that binds to a target site in a hepatitis B virus DNA sequence. In some embodiments, the hepatitis B virus DNA sequence is a hepatitis B virus (HBV) gene or its regulatory element. In some embodiments, the target site exists in the form of covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA), and / or is integrated into human genomic DNA. In any embodiment herein, the target site is at or near a gene or its regulatory element that participates in controlling HBV replication and / or HBV transcription. In any embodiment herein, the gene encoding polymerase, envelope protein, capsid protein, transcription factor, or transcription transactivator that participates in controlling HBV replication and / or HBV transcription. In any embodiment herein, the gene involved in controlling HBV replication and / or HBV transcription is a polymerase gene, an S family gene, an X gene, or a core family gene. In any embodiment herein, the target site is in a gene or its regulatory element that encodes the X gene of the hepatitis B virus X protein (HBx). In any of the embodiments herein, the target site is at or near a regulatory element involved in controlling HBV replication and / or HBV transcription.

[0064] In any embodiment herein, the regulatory element is a promoter region. In any embodiment herein, the promoter region is a pre-S1 promoter, a pre-S2 promoter, an X promoter, or a basic core promoter. In any embodiment herein, the regulatory element is an enhancer region. In any embodiment herein, the enhancer region is an Enh1 or Enh2 enhancer region. In any embodiment herein, the regulatory element is a transcript processing control region.

[0065] In any embodiment herein, the target site is a coding region. In any embodiment herein, the target site is positioned within 500bp, within 1000bp, or within 1500bp of the transcription start site. In any embodiment herein, the target site is located in a target region, and the target region is positioned between 0-3300 base pairs (bp) of the HBV genome, optionally at a base pair between 0-3189bp corresponding to the position of the HBV genome shown in SEQ ID NO:650. In any embodiment herein, the target site is located in a target region, and the target region is positioned at a base pair between 43bp-490bp, 1033bp-1749bp, 1800bp-1950bp, or 2953bp-3182bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO:650. In any embodiment herein, the target site is located within a target region positioned at base pairs between 1bp-42bp, 491bp-1032bp, 1750bp-1799bp or 1951bp-2952bp of the HBV genome corresponding to the position of the HBV genome shown in reference SEQ ID NO:650.

[0066] In any embodiment herein, the target site or each of the target sites is in the CpG island of the HBV genome. In any embodiment herein, the target site is located in a target region, and the target region is located at a base pair between 67bp-392bp, 1033bp-1749bp or 2215bp-2490bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO:650. In any embodiment herein, the target site is located in a target region, and the target region is located at a base pair between 1033bp-1749bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO:650. In any embodiment herein, the target site or each of the target sites is within a target region within 300 base pairs spanning upstream of the start codon of hepatitis B virus X protein (HBx).

[0067] Also provided herein is a gRNA (gRNA) that binds to a target site within a target region within 300 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site is located in the HBx basic core promoter region. In any embodiment herein, the target site is located within the HBx promoter / enhancer region. In any embodiment herein, the target site is within a target region within 250 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site is within a target region of 1060-1480bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO: 650. In any embodiment herein, the target site is within a target region within 150 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site is within a target region within 120 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any of the embodiments herein, the target site is within a target region sequence corresponding to a sequence spanning 1250-1374 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO: 650. In any of the embodiments herein, the target site is within a target region sequence corresponding to a sequence spanning 1255-1302 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO: 650. In any of the embodiments herein, the target site is within a target region sequence corresponding to a sequence spanning 1260-1300 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO: 650.In any of the embodiments herein, the gRNA comprises a sequence as set forth in any one of SEQ ID NOs: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 369, 370, 371, 377, 380, 384, 385, or 387, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as set forth in SEQ ID NOs: Any one of NO: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582. In any of the embodiments herein, the gRNA is as set forth in any one of SEQ ID NO: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580, or 582. In any of the embodiments herein, the gRNA comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575 or 582.In any embodiment herein, the gRNA comprises the sequence shown in any one of SEQ ID NO: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575 or 582. In any embodiment herein, the gRNA comprises the sequence shown in SEQ ID NO: 217, a contiguous portion of at least 14 nucleotides thereof, or the complement of any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO: 412. In any embodiment herein, the gRNA comprises the sequence shown in SEQ ID NO: 412.

[0068] Also provided herein is a CRISPR Cas-guide RNA (gRNA) combination comprising: (a) clustered regularly interspaced short palindromic repeats-related (Cas) protein or variants thereof; and (b) at least one gRNA according to any one of claims 165-202, wherein the gRNA targets the Cas protein or its variant to a target site in a target site in a hepatitis B virus DNA sequence. In some embodiments, the Cas protein or its variant is a Cas9 protein or its variant. In any embodiment herein, the Cas protein or its variant is a variant Cas protein, wherein the variant Cas protein lacks nuclease activity or is an inactivated Cas (dCas) protein. In any embodiment herein, the variant Cas protein is a variant Cas9 protein that lacks nuclease activity or is an inactivated Cas9 (dCas9) protein. In any embodiment herein, the Cas9 protein or its variant is a Staphylococcus aureus Cas9 (SaCas9) protein or its variant. In some embodiments, the variant Cas9 is a Staphylococcus aureus dCas9 protein (dSaCas9) comprising at least one amino acid mutation selected from D10A and N580A, with reference to the numbering of the positions of SEQ ID NO: 596. In some embodiments, the variant Cas9 protein comprises the sequence shown in SEQ ID NO: 597, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the Cas9 protein or its variant is a Streptococcus pyogenes Cas9 (SpCas9) protein or its variant. In some embodiments, the variant Cas9 is a Streptococcus pyogenes dCas9 (dSpCas9) protein comprising at least one amino acid mutation selected from D10A and H840A, with reference to the numbering of the positions of SEQ ID NO: 598. In some embodiments, the variant Cas9 protein comprises the sequence shown in SEQ ID NO:599, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0069] Also provided is a polynucleotide encoding the epigenetic modification DNA targeting system disclosed herein or a fusion protein of the DNA targeting system disclosed herein, the gRNA disclosed herein, the CRISPR Cas-gRNA combination disclosed herein, or a portion or component of any one of the foregoing.

[0070] Also provided are a variety of polynucleotides encoding an epigenetic modification DNA targeting system disclosed herein or a fusion protein of a DNA targeting system disclosed herein, a gRNA disclosed herein, a CRISPR Cas-gRNA combination disclosed herein, or a portion or component of any of the foregoing.

[0071] Also provided is a vector comprising a polynucleotide disclosed herein. Also provided is a vector comprising a plurality of polynucleotides disclosed herein.

[0072] In any embodiment herein, the vector is a viral vector. In some embodiments herein, the vector is an adeno-associated virus (AAV) vector. In some embodiments herein, the vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9. In some embodiments herein, the vector is a lentiviral vector. In some embodiments herein, the vector is a non-viral vector. In some embodiments herein, the non-viral vector is selected from: lipid nanoparticles, liposomes, exosomes or cell penetrating peptides. In any embodiment herein, the vector exhibits tropism to hepatitis B virus infected cells. In any embodiment herein, the vector comprises one vector or two or more vectors.

[0073] The present invention also provides a method for promoting epigenetic modification in a target region of a hepatitis B virus sequence, the method comprising introducing an epigenetic modification DNA targeting system targeting a target site in the target region into an HBV-infected cell containing a hepatitis virus sequence.

[0074] The present invention also provides a method for increasing CpG methylation in a target region of a hepatitis B virus sequence, the method comprising introducing an epigenetic modification DNA targeting system targeting a target site in the target region into an HBV-infected cell containing a hepatitis virus sequence.

[0075] Also provided herein is a method for promoting epigenetic modification of a target region in a hepatitis B virus sequence, the method comprising introducing into an HBV-infected cell comprising a hepatitis B virus sequence an epigenetic modification DNA targeting system disclosed herein, a gRNA disclosed herein, a CRISPR Cas-gRNA combination disclosed herein, a polynucleotide disclosed herein, a plurality of polynucleotides disclosed herein, a vector disclosed herein, or a portion or component of any of the foregoing.

[0076] Also provided herein is a method for increasing CpG methylation of a target region in a hepatitis B virus sequence, the method comprising introducing into an HBV-infected cell comprising a hepatitis B virus sequence an epigenetic modification DNA targeting system disclosed herein, a gRNA disclosed herein, a CRISPR Cas-gRNA combination disclosed herein, a polynucleotide disclosed herein, a plurality of polynucleotides disclosed herein, a vector disclosed herein, or a portion or component of any of the foregoing.

[0077] In any of the embodiments herein, the target region comprises a contiguous nucleotide sequence within a sequence of 1033 bp to 1749 bp in the hepatitis B virus sequence corresponding to the nucleotide position with reference to SEQ ID NO: 650.

[0078] Also provided herein is a method for reducing transcription of one or more genes in an HBV-infected cell comprising a hepatitis B virus sequence, the method comprising introducing into the cell an epigenetic modification DNA targeting system that induces targeted CpG methylation within the hepatitis B virus sequence at a nucleotide position with reference to SEQ ID NO: 650.

[0079] Also provided herein is a method for reducing hepatitis B virus infection in HBV-infected cells, the method comprising introducing an epigenetic modification DNA targeting system into a cell comprising a hepatitis B virus sequence, wherein the epigenetic modification DNA targeting system induces targeted CpG methylation within a target region in the hepatitis B virus sequence with reference to the nucleotide position of SEQ ID NO: 650.

[0080] In any of the embodiments herein, the epigenetic modification DNA targeting system comprises at least one DNA targeting module, wherein the at least one DNA targeting module comprises a fusion protein comprising (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence; and (b) at least one effector domain comprising a DNA methyltransferase effector domain.

[0081] In any of the embodiments herein, the region of CpG methylation is within 500 base pairs of the target region.In any of the embodiments herein, the introducing occurs in vivo or ex vivo in a subject.

[0082] In any embodiment herein, the cell is a mammalian cell. In any embodiment herein, the cell is a human cell. In any embodiment herein, the cell comprises integrated HBV DNA. In any embodiment herein, the cell is a hepatocyte comprising a pool of free HBV cccDNA. In some embodiments, the hepatocyte expresses HBV protein, wherein the HBV protein is HBsAg, HBeAg or HBcrAg or a combination thereof.

[0083] Also provided herein is a method for reducing hepatitis virus infection in a subject, the method comprising administering to a subject infected with hepatitis B an epigenetic modification DNA targeting system that increases CpG methylation within a target region in a hepatitis B virus sequence, wherein the epigenetic modification DNA targeting system comprises (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence; and (b) at least one effector domain comprising a DNA methyltransferase effector domain.

[0084] In any embodiment herein, the target region is a region containing CpG in the HBV genome. In any embodiment herein, the target region is included in a continuous nucleotide sequence within a sequence of 67bp-392bp, 1033bp-1749bp, or 2215bp-2490bp in the hepatitis B virus sequence corresponding to the nucleotide position of reference SEQ ID NO: 650. In any embodiment herein, the target region is included in a continuous nucleotide sequence within a sequence of 1033bp-1749bp in the hepatitis B virus sequence corresponding to the nucleotide position of reference SEQ ID NO: 650. In any embodiment herein, the target region is located within 300 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx). In any embodiment herein, the target region is within the HBx basic core promoter region. In any embodiment herein, the target region is within the HBx promoter / enhancer region. In any embodiment herein, the target region is within 250 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx). In any embodiment herein, the target region comprises a contiguous nucleotide sequence within a sequence of 1060 bp to 1480 bp in the hepatitis B virus sequence corresponding to the nucleotide position with reference to SEQ ID NO: 650. In any embodiment herein, the target region is within 150 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx). In any embodiment herein, the target region is within 120 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx). In any embodiment herein, the target region comprises a contiguous nucleotide sequence within a sequence of 1250 bp to 1374 bp in the hepatitis B virus sequence corresponding to the nucleotide position with reference to SEQ ID NO: 650. In some embodiments, the target region has the sequence set forth in SEQ ID NO: 1068. In any embodiment herein, the target region comprises a contiguous nucleotide sequence within a sequence of 1260 bp to 1300 bp in the hepatitis B virus sequence corresponding to the nucleotide position with reference to SEQ ID NO: 650. In some embodiments, the target region has the sequence shown in SEQ ID NO:1070.

[0085] In any of the embodiments herein, the DNA binding domain comprises a clustered regularly interspaced short palindromic repeats-associated (Cas)-guide RNA (gRNA) combination comprising (a) a Cas protein or a variant thereof and (b) at least one gRNA; a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a meganuclease; a homing endonuclease; or an I-SceI enzyme or a variant thereof, optionally wherein the DNA binding domain comprises a catalytically inactive variant of any one of the foregoing.

[0086] In any of the embodiments herein, the method comprises a CRISPR Cas-guide RNA (gRNA) combination comprising: (a) a clustered regularly interspaced short palindromic repeats-related (Cas) protein or a variant thereof; and (b) at least one gRNA according to any one of claims 165-202, which targets the Cas protein or variant thereof to a target site in a target site in a hepatitis B virus DNA sequence.

[0087] In any of the embodiments herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NO: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a sequence as shown in any one of SEQ ID NO: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a sequence as shown in SEQ ID NO: 22, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. In any embodiment herein, the gRNA wherein the gRNA or each of the gRNA comprises SEQ ID NO: NO: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 370, 371, 377, 380, 384, 385, 387, a contiguous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in SEQ ID Any one of NO: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582.In any of the embodiments herein, the gRNA wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, a consecutive portion of at least 14 nucleotides thereof, or a complementary sequence to any one of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582. In any of the embodiments herein, the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NO: 217, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO: 412.

[0088] In any embodiment herein, the at least one DNA binding domain comprises an engineered zinc finger protein (eZFP). In any embodiment herein, the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, 1052, at least a 12 nt continuous portion thereof, or a complementary sequence of any one of the foregoing. In any embodiment herein, the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, 1052.

[0089] In any embodiment herein, at least one effector domain is a DNA methyltransferase. In any embodiment herein, at least one effector domain comprises a DNA methyltransferase and a repressor domain capable of recruiting a heterochromatin inducing factor, or optionally wherein the heterochromatin inducing factor comprises a histone methyltransferase. In any embodiment herein, the at least one effector domain comprises a DNA methyltransferase and a histone methyltransferase. In any embodiment herein, the at least one effector domain comprises a DNMT3A / L domain or a variant thereof. In any embodiment herein, the at least one effector domain comprises an effector domain comprising a sequence shown in SEQ ID NO: 604 and 607, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with any of the foregoing. In any embodiment herein, the at least one effector domain further comprises a KRAB domain or a variant thereof. In any embodiment herein, the at least one effector domain further comprises a sequence as set forth in SEQ ID NO: 590, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In any embodiment herein, the DNA targeting system comprises a DNMT3A / 3L-dSpCas9-KRAB domain or a variant thereof. In any embodiment herein, the DNA targeting system comprises a sequence as set forth in SEQ ID NO: 645, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0090] In any embodiment herein, the DNA targeting system comprises the sequence shown in SEQ ID NO: 680, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the DNA targeting system comprises the sequence shown in SEQ ID NO: 680.

[0091] Also provided herein is a method for suppressing the transcription of one or more genes in hepatitis B virus infected cells, the method comprising introducing into hepatitis B virus infected cells an epigenetic modification DNA targeting system disclosed herein, gRNA disclosed herein, CRISPR Cas-gRNA combination disclosed herein, polynucleotides disclosed herein, multiple polynucleotides disclosed herein, vectors disclosed herein, or a portion or component of any of the foregoing. In some embodiments, the DNA targeting system epigenetically modifies the one or more genes. In some embodiments, the transcription of the one or more genes is reduced compared to comparable cells not subjected to the method.

[0092] In any embodiment herein, the transcription of the one or more genes is reduced by at least about 1.25 times, 1.5 times, 1.75 times, 2.0 times, 2.5 times, 2.75 times, 3.0 times, 3.5 times, 3.75 times, 4.0 times, 4.5 times, 4.75 times, 5.0 times, 5.25 times, 5.5 times, 5.75 times, 6 times. In any embodiment herein, suppressing the transcription of the one or more genes causes HBV replication and / or HBV transcription to decrease. In any embodiment herein, the HBV infected cell is a mammalian cell.

[0093] In any embodiment herein, the HBV infected cell is a human cell. In any embodiment herein, the cell comprises integrated HBV DNA. In any embodiment herein, the cell is a hepatocyte comprising a pool of free HBV cccDNA. In any embodiment herein, the hepatocyte expresses HBV protein, wherein the HBV protein is HBsAg and / or HBeAg. In any embodiment herein, the HBV infected cell is present in a subject.

[0094] In any embodiment herein, the subject is a human. In any embodiment herein, the subject suffers from HBV viral infection. In any embodiment herein, the subject has hepatocytes comprising integrated HBV DNA. In any embodiment herein, the subject has hepatocytes comprising a pool of free HBV cccDNA. In any embodiment herein, the subject has hepatocytes expressing HBV proteins, wherein the HBV proteins are HBsAg, HBeAg, or HBcrAg, and combinations thereof.

[0095] In any embodiment herein, the subject suffers from a disease, condition or disorder associated with the HBV viral infection. In any embodiment herein, the disease, condition or disorder is liver disease or cancer. In any embodiment herein, the disease, condition or disorder is acute hepatitis, chronic hepatitis, liver failure or cirrhosis. In any embodiment herein, the disease, condition or disorder is cancer, optionally wherein the cancer is hepatocellular carcinoma.

[0096] Also provided herein is a pharmaceutical composition comprising a vector disclosed herein.In any embodiment herein, the vector is conjugated to an amino sugar derivative of galactose, optionally wherein the vector is conjugated to an N-acetylgalactosamine (GalNAc) moiety.

[0097] Also provided herein is a pharmaceutical composition comprising an epigenetic modification DNA targeting system disclosed herein or a fusion protein disclosed herein, a gRNA disclosed herein, a CRISPR Cas-gRNA combination disclosed herein, a polynucleotide disclosed herein, a plurality of polynucleotides disclosed herein, a vector disclosed herein, or a portion or component of any of the foregoing.

[0098] Also provided herein is a pharmaceutical composition for use in treating HBV viral infection in a subject. In any embodiment herein, the subject suffers from a disease, condition or disorder associated with the HBV viral infection.

[0099] Also provided herein is a pharmaceutical composition for use in treating a disease, disorder or condition associated with HBV viral infection in a subject.

[0100] Also provided herein is a pharmaceutical composition for use in the preparation of a medicament for treating HBV viral infection in a subject. In some embodiments, the HBV viral infection is associated with a disease, disorder, or condition.

[0101] Also provided herein is a pharmaceutical composition for use in the preparation of a medicament for treating a disease, condition or disorder associated with HBV viral infection in a subject.

[0102] In any embodiment herein, the disease, condition or disorder is liver disease or cancer. In any embodiment herein, the disease, condition or disorder is acute hepatitis, chronic hepatitis, liver failure or cirrhosis. In any embodiment herein, the disease, condition or disorder is cancer, optionally hepatocellular carcinoma. In any embodiment herein, the pharmaceutical composition will be administered to the subject in vivo.

[0103] In any embodiment herein, after administration of the pharmaceutical composition, the transcription of one or more HBV genes in the cells of the subject is suppressed. In any embodiment herein, the one or more HBV genes are involved in controlling HBV replication and / or HBV transcription. In any embodiment herein, the one or more genes are polymerase genes, S family genes, X genes, or core family genes.

[0104] Also provided herein is a method for treating a disease, condition, or disorder in a subject in need thereof, comprising administering to the subject an epigenetic modification DNA targeting system disclosed herein, a gRNA disclosed herein, a CRISPR Cas-gRNA combination disclosed herein, a polynucleotide disclosed herein, a plurality of polynucleotides disclosed herein, a vector disclosed herein, a pharmaceutical composition disclosed herein, or a portion or component of any of the foregoing.

[0105] Also provided herein is a method of reducing hepatitis B virus infection in a subject, the method comprising administering to a subject having hepatitis B virus infection an epigenetic modification DNA targeting system disclosed herein, a gRNA disclosed herein, a CRISPR Cas-gRNA combination disclosed herein, a polynucleotide disclosed herein, a plurality of polynucleotides disclosed herein, a vector disclosed herein, a pharmaceutical composition disclosed herein, or a portion or component of any one of the foregoing.

[0106] Also provided herein is an engineered zinc finger protein (eZFP) that binds to a target site in one or more HBV genes or their regulatory elements, wherein the target site is within a target region of 1033bp-1749bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO: 650. In any embodiment herein, the target site is within a target region within 300 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx). In any embodiment herein, the target site is located in the HBx basic core promoter region. In any embodiment herein, the target site is located within the HBx promoter / enhancer region. In any embodiment herein, the target site is within a target region within 250 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx). In any embodiment herein, the target site is within a target region of 1060-1480bp of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO: 650. In any embodiment herein, the target site is within a target region spanning 150 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site is within a target region spanning 120 base pairs upstream of the start codon of hepatitis B virus X protein (HBx). In any embodiment herein, the target site is within a target region sequence corresponding to a sequence spanning 1250-1374bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target region has the sequence shown in SEQ ID NO: 1068. In any embodiment herein, the target site is within a target region sequence corresponding to a sequence spanning 1255-1302bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target region has the sequence shown in SEQ ID NO: 1069. In any of the embodiments herein, the target site is within a target region sequence corresponding to a sequence spanning 1260-1300 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO: 650. In some embodiments, the target region has a sequence set forth in SEQ ID NO: 1070. In any of the embodiments herein, the target site is within a target region sequence corresponding to a sequence spanning 1255 bp-1290 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO: 650. In any of the embodiments herein, the target site comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 1028-1055, a contiguous portion of at least 12 nt thereof, or a complementary sequence of any one of the foregoing.In any of the embodiments herein, the target site comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 1028-1055.

[0107] In any embodiment herein, the target site comprises the nucleotide sequence shown in any one of SEQ ID NO: 1045, 1046 or 1052, at least a 12 nt continuous portion thereof, or a complementary sequence of any one of the foregoing. In any embodiment herein, the target site comprises the nucleotide sequence shown in any one of SEQ ID NO: 1045, 1046 or 1052.

[0108] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); 2) F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) F6: DSSHRTR (SEQ ID NO: 731) NO:731); 3) F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO: 736) F6: QSSDLRR (SEQ ID NO:737); 4) F1: RSDNLSE (SEQ ID NO: 738) F2: TSSNRKT (SEQ ID NO: 739) F3: DRSHLTR (SEQ ID NO: 740) F4: RSDALTQ (SEQ ID NO: 741) F5: DRSALAR (SEQ ID NO: 742) F6: RRFTLSK (SEQ ID NO: 743); 5) F1: RSDHLSE (SEQ ID NO: 744) F2: QYSGRYY (SEQ ID NO: 745) F3: HGQTLNE (SEQ ID NO: 746) F4: QSGNLAR (SEQ ID NO: 747) F5: RSDSLLR (SEQ ID NO: 748) F6: CREYRGK (SEQ ID NO: 749); 6) F1: QSANRTT (SEQ ID NO: 750) F2: RSANLTR (SEQ ID NO: 751) F3: RSDVLSE (SEQ ID NO: 752) F4: TSGHLSR (SEQ ID NO: 753) F5: QSSDLSR (SEQ ID NO: 754) F6: QWSTRKR (SEQ ID NO: 755);<h2 style=";text-align:left;direction:ltr">7)F1:QSGNLAR(SEQ IDNO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ IDNO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761);8)F1:NPANLTR(SEQ IDNO:762)F2:QNATRTK(SEQ ID NO:763)F3:QSGHLAR(SEQ ID NO:764)F4:NRHDRAK(SEQ IDNO:765)F5:RSDHLSE(SEQ ID NO:766)F6:QRRSRYK(SEQ ID NO:767);9)F1:QSSDLSR(SEQ IDNO: 768) F2: HRSTRNR (SEQ ID NO: 769) F3: RSDVLSA (SEQ ID NO: 770) F4: DSR TRKN (SEQ ID NO: 771) F5: QSGSLTR (SEQ ID NO: 772) F6: DQSGLAH (SEQ ID NO: 773);10) F1: QNPAQWR (SEQID NO: 774) F2: RSADLSR (SEQ ID NO: 775) F3: TSGSLSR (SEQ ID NO: 776) F4: RSDHLSR (SEQ ID NO: 777) F5: RSDSLR (SEQ ID NO: 778) F6: QSYDRFQ (SEQ ID NO: 779);11) F1: TSGSLSR (SEQ ID NO: 780) F2: RSDHLSR (SEQ ID NO: 780) F3: RSDHLSR (SEQ ID NO: 780) NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ IDNO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ ID NO:785);12)F1:DRSNLSR(SEQID) NO:786)F2:LRQNLIM(SEQ ID NO:787)F3:ERGTLAR(SEQ ID NO:788)F4:RSDALTQ(SEQ IDNO:789)F5:RSDSLSQ(SEQ ID NO:790)F6:RKADRTR(SEQ ID NO:791);<h2 style=";text-align:left;direction:ltr">13)F1:QYCCLTN(SEQID NO:792)F2:TSGNLTR(SEQ ID NO:793)F3:QSSDLSR(SEQ ID NO:794)F4:FRYYLKR(SEQ ID NO:795)F5:QSGDLTR(SEQ ID NO:796)F6:DKGNLTK(SEQ ID NO:797);14)F1:TSGSLSR(SEQID NO:798)F2:RSDNLTT(SEQ ID NO:799)F3:QSGNLAR(SEQ ID NO:800)F4:DRTTLMR(SEQ ID NO:801)F5:QSGHLAR(SEQ ID NO:802)F6:QLTHLNS(SEQ ID NO:803);15)F1:IKHDLHR(SEQID NO:804) F2:RSANLTR(SEQ ID NO:805) F3:RSDNLAR(SEQ ID NO:806) F4:QNVSRPR(SEQ ID NO:807) F5:RSDDLSK(SEQ ID NO:808) F6:DSSHRTR(SEQ ID NO:809);16) F1:RSDNLAR(SEQID NO:810) F2:QNVSRPR(SEQ ID NO:811) F3:RSDDLSK(SEQ ID NO:812) F4:DSSHRTR(SEQ ID NO:813) F5:TSSNRKT(SEQ ID NO:814) F6:AQWTRAC(SEQ ID NO:815);17) F1:RSDDLSK(SEQID NO:816) F2:DSSHRTR(SEQ ID NO:816) NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ ID NO:821);18)F1:QSAHRKN(SEQID NO:822)F2:TSSNRKT(SEQ ID NO:823)F3:RSDNLSA(SEQ ID NO:824)F4:RNNDRKT(SEQ ID NO:825)F5:TSGSLSR(SEQ ID NO:826)F6:QAGHLAK(SEQ ID NO:827);<h2 style=";text-align:left;direction:ltr">19) F1: RSDHLSQ(SEQID NO: 828) F2: ASSTRTK(SEQ ID NO: 829) F3: RSDDLTR(SEQ ID NO: 830) F4: QKSNLSS(SEQ ID NO: 831) F5: QSANRTT(SEQ ID NO: 832) F6: QNATRTK(SEQ ID NO: 833);20) F1: RSDTLSE(SEQID NO: 834) F2: RRWTLVG(SEQ ID NO: 835) F3: DRSNLSR(SEQ ID NO: 836) F4: QSGDLTR(SEQ ID NO: 837) F5: QSSDLSR(SEQ ID NO: 838) F6: YHWYLKK(SEQ ID NO: 839);21) F1: RSANLAR(SEQID NO:840) F2:RSDNLRE(SEQ ID NO:841) F3:RPYTLRL(SEQ ID NO:842) F4:HRSNLNK(SEQ ID NO:843) F5:QSGSLTR(SEQ ID NO:844) F6:TSANLSR(SEQ ID NO:845);22) F1:RSDDLVR(SEQID NO:846) F2:TSGSLVR(SEQ ID NO:847) F3:RSDKLVR(SEQ ID NO:848) F4:RSDELVR(SEQ ID NO:849) F5:TSHSLTE(SEQ ID NO:850) F6:RADNLTE(SEQ ID NO:851);23) F1:ERSHLRE(SEQID NO:852) F2:TSHSLTE(SEQ ID NO:852) NO:853)F3:QAGHLAS(SEQ ID NO:854)F4:TSHSLTE(SEQ ID NO:855)F5:DPGHLVR(SEQ ID NO:856)F6:TSGNLVR(SEQ ID NO:857);24)F1:RADNLTE(SEQID NO:858)F2:TSGSLVR(SEQ ID NO:859)F3:RKDNLKN(SEQ ID NO:860)F4:QSSSLVR(SEQ ID NO:861)F5:RSDKLVR(SEQ ID NO:862)F6:DSGNLRV(SEQ ID NO:863);25) F1: QSSSLVR (SEQ ID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO:869); 26) F1: QSGDLRR (SEQ ID NO: 870) F2: RSDERKR (SEQ ID NO: 871) F3: HRTTLTN (SEQ ID NO: 872) F4: RSDHLTN (SEQ ID NO: 873) F5: TSGELVR (SEQ ID NO: 874) F6: RSDDLVR (SEQ ID NO:875); 27) F1: QRAHLER (SEQ ID NO: 876) F2: QLAHLRA (SEQ ID NO: 877) F3: DPGHLVR (SEQ ID NO:878) F4: RRSACRR (SEQ ID NO:879) F5: RSDHLTT (SEQ ID NO:880) F6: QSSSLVR (SEQ ID NO:881); and 28) F1: QSSNLVR (SEQ ID NO:882) F2: RSDDLVR (SEQ ID NO:883) F3: THLDLIR (SEQ ID NO:884) F4: TSGNLTE (SEQ ID NO:885) F5: RRSACRR (SEQ ID NO:886) F6: RNDTLTE (SEQ ID NO:887). ;

[0109] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO: 822) F2: TSSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827).

[0110] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO: 828) F2: ASSTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833).

[0111] In any of the embodiments herein, the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO: 869).

[0112] Also provided herein is an eZFP that binds to a target site in one or more HBV genes or regulatory elements thereof, wherein the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); 2) F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) NO: 730) F6: DSSHRTR (SEQ ID NO: 731); 3) F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO:736) F6: QSSDLRR (SEQ ID NO:737); 4) F1: RSDNLSE (SEQ ID NO:738) F2: TSSNRKT (SEQ ID NO:739) F3: DRSHLTR (SEQ ID NO:740) F4: RSDALTQ (SEQ ID NO:741) F5: DRSALAR (SEQ IDNO:742)F6:RRFTLSK(SEQ ID NO:743);5)F1:RSDHLSE(SEQ ID NO: 744) F2: QYSGRYY (SEQ ID NO: 745) F3: HGQTLNE (SEQ ID NO: 746) F4: QSGNLAR (SEQ ID NO: 747) F5: RSDSLLR (SEQ ID NO: 748) F6: CREYRGK (SEQ ID NO: 749);<h2 style=";text-align:left;direction:ltr">6)F1:QSANRTT(SEQ ID NO:750)F2:RSANLTR(SEQ ID NO:751)F3:RSDVLSE(SEQ ID NO:752)F4:TSGHLSR(SEQ ID NO:753)F5:QSSDLSR(SEQ ID NO:754)F6:QWSTRKR(SEQ ID NO:755);7)F1:QSGNLAR(SEQ ID NO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ ID NO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761);8)F1:NPANLTR(SEQ ID NO:761) NO:762)F2:QNATRTK(SEQ ID NO:763)F3:QSGHLAR(SEQ ID NO:764)F4:NRHDRAK(SEQ ID NO:765)F5:RSDHLSE(SEQ ID NO:766)F6:QRRSRYK(SEQ ID NO:767);9)F1:QSSDLSR(SEQ ID NO:768)F2:HRSTRNR(SEQ ID NO:769)F3:RSDVLSA(SEQ ID NO:770)F4:DSRTRKN(SEQ ID NO:771)F5:QSGSLTR(SEQ ID NO:772)F6:DQSGLAH(SEQ ID NO:773);10)F1:QNPAQWR(SEQ ID NO:774)F2:RSADLSR(SEQ ID NO:774)F2:RSADLSR(SEQ ID NO:774) NO:775)F3:TSGSLSR(SEQ ID NO:776)F4:RSDHLSR(SEQ ID NO:777)F5:RSDSLLR(SEQ ID NO:778)F6:QSYDRFQ(SEQ ID NO:779);11)F1:TSGSLSR(SEQ ID NO:780)F2:RSDHLSR(SEQID NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ ID NO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ ID NO:785);<h2 style=";text-align:left;direction:ltr">12) F1: DRSNLSR (SEQ ID NO: 786) F2: LRQNLIM (SEQID NO: 787) F3: ERGTLAR (SEQ ID NO: 788) F4: RSDALTQ (SEQ ID NO: 789) F5: RSDSLSQ (SEQ ID NO: 790) F6: RKADRTR (SEQ ID NO: 791);13) F1: QYCCLTN (SEQ ID NO: 792) F2: TSGNLTR (SEQ ID NO: 793) F3: QSSDLSR (SEQ ID NO: 794) F4: FRYYLKR (SEQ ID NO: 795) F5: QSGDLTR (SEQ ID NO: 796) F6: DKGNLTK (SEQ ID NO: 797);14) F1: TSGSLSR (SEQ ID NO: NO:798) F2:RSDNLTT(SEQID NO:799) F3:QSGNLAR(SEQ ID NO:800) F4:DRTTLMR(SEQ ID NO:801) F5:QSGHLAR(SEQ ID NO:802) F6:QLTHLNS(SEQ ID NO:803);15) F1:IKHDLHR(SEQ ID NO:804) F2:RSANLTR(SEQID NO:805) F3:RSDNLAR(SEQ ID NO:806) F4:QNVSRPR(SEQ ID NO:807) F5:RSDDLSK(SEQ ID NO:808) F6:DSSHRTR(SEQ ID NO:809);16) F1:RSDNLAR(SEQ ID NO:810) F2:QNVSRPR(SEQ IDNO:811)F3:RSDDLSK(SEQ ID NO:812)F4:DSSHRTR(SEQ ID NO:813)F5:TSSNRKT(SEQ IDNO:814)F6:AQWTRAC(SEQ ID NO:815);17)F1:RSDDLSK(SEQ ID NO:816)F2:DSSHRTR(SEQ ID NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ IDNO:820)F6:HRSSLRR(SEQ ID NO:821);<h2 style=";text-align:left;direction:ltr">18) F1: QSAHRKN (SEQ ID NO: 822) F2: TSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827);19) F1: RSDHLSQ (SEQ ID NO: 828) F2: ASSTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833);20) F1: RSDTLSE (SEQ ID NO: 833) NO:834) F2:RRWTLVG(SEQID NO:835) F3:DRSNLSR(SEQ ID NO:836) F4:QSGDLTR(SEQ ID NO:837) F5:QSSDLSR(SEQ ID NO:838) F6:YHWYLKK(SEQ ID NO:839);21) F1:RSANLAR(SEQ ID NO:840) F2:RSDNLRE(SEQID NO:841) F3:RPYTLRL(SEQ ID NO:842) F4:HRSNLNK(SEQ ID NO:843) F5:QSGSLTR(SEQ ID NO:844) F6:TSANLSR(SEQ ID NO:845);22) F1:RSDDLVR(SEQ ID NO:846) F2:TSGSLVR(SEQID NO:847)F3:RSDKLVR(SEQ ID NO:848)F4:RSDELVR(SEQ ID NO:849)F5:TSHSLTE(SEQ ID NO:850)F6:RADNLTE(SEQ ID NO:851);23)F1:ERSHLRE(SEQ ID NO:852)F2:TSHSLTE(SEQID NO:853)F3:QAGHLAS(SEQ ID NO:854)F4:TSHSLTE(SEQ ID NO:855)F5:DPGHLVR(SEQ ID NO:856)F6:TSGNLVR(SEQ ID NO:857);<h2 style=";text-align:left;direction:ltr">24) F1: RADNLTE (SEQ ID NO: 858) F2: TSGSLVR (SEQ ID NO: 859) F3: RKDNLKN (SEQ ID NO: 860) F4: QSSSLVR (SEQ ID NO: 861) F5: RSDKLVR (SEQ ID NO: 862) F6: DSGNLRV (SEQ ID NO: 863);25) F1: QSSSLVR (SEQ ID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO: 869);26) F1: QSGDLRR (SEQ ID NO: 869) NO:870) F2: RSDERKR (SEQID NO:871) F3: HRTTLTN (SEQ ID NO:872) F4: RSDHLTN (SEQ ID NO:873) F5: TSGELVR (SEQ ID NO:874) F6: RSDDLVR (SEQ ID NO:875);27) F1: QRAHLER (SEQ ID NO:876) F2: QLAHLRA (SEQID NO:877) F3: DPGHLVR (SEQ ID NO:878) F4: RRSACRR (SEQ ID NO:879) F5: RSDHLTT (SEQ ID NO:880) F6: QSSSLVR (SEQ ID NO:881);28) F1: QSSNLVR (SEQ ID NO:882) F2: RSDDLVR (SEQID NO:883)F3:THLDLIR(SEQ ID NO:884)F4:TSGNLTE(SEQ ID NO:885)F5:RRSACRR(SEQ IDNO:886)F6:RNDTLTE(SEQ ID NO:887)。;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0113] In any embodiment herein, the engineered zinc finger protein comprises a sequence as set forth in any one of SEQ ID NOs: 692-719 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In any embodiment herein, the engineered zinc finger protein is encoded by a sequence as set forth in any one of SEQ ID NOs: 888-915 or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0114] Also provided herein is an engineered zinc finger protein that binds to a target site in one or more HBV genes or their regulatory elements, wherein the zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from N-terminus to C-terminus, namely F1: QSAHRKN (SEQ ID NO: 822) F2: TSSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827). In some embodiments, the engineered zinc finger protein comprises the sequence shown in SEQ ID NO: 709 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO: 709. In some embodiments, the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 905, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO: 905.

[0115] Also provided herein is an engineered zinc finger protein that binds to a target site in one or more HBV genes or regulatory elements thereof, wherein the zinc finger protein comprises six zinc fingers, represented in order from N-terminus to C-terminus, designated F1 to F6, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO: 828) F2: ASSTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833). In some embodiments, the engineered zinc finger protein comprises the sequence set forth in SEQ ID NO: 710, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO: 710. In some embodiments, the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 906, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO: 906.

[0116] Also provided herein is an engineered zinc finger protein that binds to a target site in one or more HBV genes or regulatory elements thereof, wherein the zinc finger protein comprises six zinc fingers represented in order from N-terminus to C-terminus, designated F1 to F6, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO: 869). In some embodiments, the engineered zinc finger protein comprises the sequence set forth in SEQ ID NO: 716, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO: 716. In some embodiments, the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 912, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO: 912. BRIEF DESCRIPTION OF THE DRAWINGS

[0117] Figure 1 Figure 3: Fold changes in total HBV RNA mediated by each guide RNA and dCas9-KRAB effector fusion protein. The fold changes are correlated with the median targeted position of each gRNA across all HBV genotypes.

[0118] Figure 2 Depicted is the conservation of guide RNAs among HBV genome types (HBV0-HBV12).

[0119] Figure 3A-3B The results show that the expression of total HBV RNA ( Figure 3A ) and HBsAg( Figure 3B )'s inhibition.

[0120] Figure 4Figure 3: Fold changes in total HBV RNA mediated by each guide RNA and DNMT3A / L-dCas9-KRAB effector fusion protein. The fold changes are plotted relative to the median targeted position of each gRNA in the HBV genome.

[0121] Figure 5 Depicted is the repression of total HBV RNA mediated by the top gRNA candidates screened (HBVg_142 (SEQ ID NO: 532), HBVg_138 (SEQ ID NO: 528), HBVg_185 (SEQ ID NO: 575), HBVg_152 (SEQ ID NO: 542)) at days 41 and 61 after transfection.

[0122] Figure 6A-6B Depicted is the durable and stable repression of total HBV RNA mediated by gRNAs HBVg_63 (SEQ ID NO: 453), HBVg_185 (SEQ ID NO: 575), and HBVg_56 (SEQ ID NO: 446).

[0123] Figure 7 Normalized total HBV RNA expression after re-administration with an exemplary gRNA and epi-editor combination is shown.

[0124] Figure 8 Figure 2: Fold changes in 3.5 kilobases (kb) of HBV RNA mediated by each guide RNA and DNMT3A / L-dSpCas9-KRAB effector fusion protein in a realistic infection model. The fold changes are plotted relative to the median targeting position of each gRNA in the HBV genome.

[0125] Figure 9 Shown is the concordance between infections using a correlation plot between two cccDNA screens.

[0126] Figure 10 gRNAs that repress integrated HBV, cccDNA, or both integrated HBV and cccDNA are shown.

[0127] Figure 11 Single gRNAs are listed that target HBV cccDNA and integrated DNA and achieve multiplex HBV repression on multiple genes and their regulatory elements.

[0128] Figure 12 Sequences targeted by single gRNAs that achieved multiplex HBV repression on multiple genes and their regulatory elements are listed.

[0129] Figure 13Depicted are the fold changes in total HBV RNA mediated by each guide RNA and exemplary epi-editors. The fold changes are depicted relative to the median targeting position of each gRNA in the HBV genome.

[0130] Figure 14 Repression of targeted HBV cccDNA transcripts by gRNA alone is shown.

[0131] Figures 15A-15B Delineated the repression of cccDNA in a primary human hepatocyte (PHH) infection model. Figure 15A Shown is the repression of HBV RNA from two PHH donors mediated by HBVg_22 (SEQ ID NO: 412). Figure 15B Shown is the repression mediated by HBVg_22 (SEQ ID NO: 412) in PHH cells infected with two doses of HBV.

[0132] Figures 16A-16B Shown in the HepG2.NTCP model ( Figure 16A ) and PxB PHH model ( Figure 16B ), comparison between repression mediated by HBVg_22 (SEQ ID NO:412) and the combination of dSpCas9-KRAB (SEQ ID NO:595) alone or DNMT3A / L-dSpCas9-KRAB ("D3AL-K"; SEQ ID NO:645) fusion.

[0133] Figure 17 Depicted are multiplexed targeted transcriptional repression of different regions within HBV RNA in Hep3B cells.

[0134] Figure 18 Shown are repression mediated by single or multiple gRNAs in the PLC / PRF / 5 (Alexander) cell model.

[0135] Figure 19 Shown is a multiplexing approach using two gRNAs in combination with exemplary dSpCas9-effectors in the PXB primary human hepatocyte (PHH) cell model.

[0136] Figure 20A and Figure 20B Methyl-capture sequencing analysis of cccDNA and integrated HBV DNA is shown.

[0137] Figure 21 Shown are increased methylation patterns following delivery of mRNA encoding DNMT3A / L-dSpCas9-KRAB along with various gRNAs.

[0138] Figure 22 Shown is the persistent CpG island 2 methylation pattern after delivery of mRNA encoding DNMT3A / L-dCas9-KRAB and HBVg_22 (SEQ ID NO:412) to HBV-infected PHH donors.

[0139] Figure 23A and Figure 23B RNA sequencing analysis revealed gRNA-dependent and epi-editor-dependent gene expression changes. Figure 23C Minimal changes in differentially expressed genes mediated by gRNA compared to lipid-only controls are shown. Figure 23D Genes that were not differentially expressed between non-targeting gRNA and HBVg_22 (SEQ ID NO: 412) at any dose or time point are shown.

[0140] Figure 24 A schematic representation of the in vivo studies in mice with human chimeric livers is shown.

[0141] Figure 25 Shown is repression mediated by the combination of an exemplary DNMT3A / L-dCas9-KRAB fusion protein and gRNA HBVg_22 (SEQ ID NO: 412) five days after administration (D5). Repression was measured by monitoring HBsAg protein levels and HBV DNA two days before (pre-dose) and five days after (D5) administration of lipid nanoparticles.

[0142] Figure 26 The fold change of the index after drug administration compared with that before drug administration is depicted.

[0143] Figures 27A-27D Shown are the proteins encoding dCas9-KRAB ( Figures 27A-27C ) or DNMT3A / L-dCas9-KRAB( Figure 27D ) mRNA, upon re-administration of HBVg_22 (SEQ ID NO: 412) alone or in multiplex re-administration with HBVg_185 (SEQ ID NO: 575), or when delivered via LNPs conjugated with GalNAc, repression in FRG mice.

[0144] Figures 28A-28C Shown are studies of human chimeric FRG mice following delivery by GalNAc-conjugated PEG LNPs. Figure 28A Shown is stable repression after a single dose of LNPs containing mRNA encoding DNMT3A / 3L-dSpCas9-KRAB and HBVg_22 (SEQ ID NO: 412) on day 33. Figure 28BTrajectories of repression extent for individual mice are shown. Figure 28C Tissue samples showing significantly reduced pgRNA signal in mice delivered HBVg_22 (SEQ ID NO: 412) compared to mice receiving non-targeting gRNA.

[0145] Figure 29A-29B The fold change in total HBV RNA mediated by each fusion protein containing the KRAB epitope editor and a zinc finger protein (ZFP) is depicted. ZFP-KRAB fusion proteins were screened for HBV repression in Hep3B cells in two batches ( Figure 29A and Figure 29B ).

[0146] Figure 30 Shown is a preliminary comparison between repression induced by ZFP-KRAB fusion protein and dCas9-KRAB fusion protein in combination with gRNA in Hep3B cells.

[0147] Figure 31A-Figure 31B The targeting position of each ZFP along the X promoter (HBx) site is shown. Figure 31A The highlighted regions in the figure represent the regions within the HBx promoter targeted by the most efficient gRNAs (HBVg_22 and HBVg_63) and the most efficient ZFP-KRAB fusion proteins (eZFP_18, eZFP_19, and eZFP_25). Figure 31B Sites in the HBx region targeted by gRNAs HBVg_22 and HBVg_63 and ZFP-KRAB fusion proteins eZFP_18, eZFP_19, and eZFP_25 are depicted.

[0148] Figure 32A-Figure 32B Depicted are the fold changes in total HBV RNA mediated by each eZFP-KRAB fusion protein in HepG2.NTCP cells.

[0149] Figure 33 Shown are the fold changes in total HBV RNA mediated by each eZFP-KRAB fusion protein and the conservation of the fusion proteins among HBV subtypes.

[0150] Figure 34 Shown are the fold changes in total HBV RNA mediated by each DNMT3A / L-eZFP-KRAB fusion protein at days 4 and 15 after transfection.

[0151] Figure 35 Minimal changes in differentially expressed genes mediated by the eZFP-KRAB fusion protein compared to the lipid-only control are shown.

[0152] Figure 36A-Figure 36Brevealed that the Figure 36A ) or non-targeted (NT) control ( Figure 36B ) compared with RNA sequencing analysis of eZFP-KRAB fusion protein-dependent gene expression changes. DETAILED DESCRIPTION

[0153] Hepatitis B is a potentially life-threatening liver infection caused by the hepatitis B virus (HBV). HBV infection is a global public health problem that causes chronic liver infection and increases the risk of cirrhosis and liver cancer. The World Health Organization estimates that in 2019, 296 million people worldwide were living with chronic hepatitis B infection (including 1 million in the United States), with 1.5 million new infections occurring annually. In 2019, hepatitis B caused an estimated 820,000 deaths, primarily from cirrhosis and hepatocellular carcinoma (primary liver cancer).

[0154] HBV belongs to the Hepadnaviridae, a family of small enveloped hepadnaviruses (Wei L. and Ploss A. Nature communications 12(1591)1-13(2021)). The HBV virion contains a compact, partially double-stranded, approximately 3.2 kb relaxed circular DNA (rcDNA) genome. The genome contains four lesions: a covalently linked HBV polymerase and a 10-nucleotide (nt) DNA flap at the 5′ end of the negative strand; and a 5′-capped RNA primer and a single-stranded DNA (ssDNA) gap on the positive strand. The HBV genome is a double-stranded DNA molecule of approximately 3.2 kilobases, but can be longer or shorter (e.g., up to 3300 bp or larger in size) depending on the specific HBV strain. An exemplary HBV genome is the hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1), SEQ ID NO: 650. At least 10 genotypes (A to J) have been identified, and the difference between genotypes is no more than 8%. There are also genotypes, including genotypes classified as HBV genotype A (A1-A7), genotype B (B1-B9), genotype C (C1-16), genotype D (D1-D8) and genotype F (F1-F4) (Zhang et al. World J Gastroenterol., 2015, 22: 126-144). Within genotypes, sequence identity differences are only about 4%. It should be understood that the provided system and method are applicable to a variety of HBV genomes, particularly with regard to high sequence similarity. For the purposes of this article, the numbering of nucleotide positions is mentioned to be the nucleotide (base pair) numbering of the HBV DNA sequence described under GenBank accession number U95551.1, as shown in SEQ ID NO:650. The skilled artisan understands that a target site or base pair position in another HBV genome (such as described herein) may not be at the same position, but may still be a homologous sequence or a substantially homologous sequence (e.g., 1, 2, or 3 mismatches), such as determined by aligning the HBV genome sequence with the sequence set forth in SEQ ID NO: 650. Thus, the corresponding position or positions can be readily identified by aligning the HBV genome sequence with the reference sequence set forth in SEQ ID NO: 650. The hepatitis B virus contains a circular genome, and therefore, for the purposes herein, references to nucleotide positions of a linear HBV DNA sequence may be offset by several nucleotides, such as depending on the start of the linear sequence. For example, the sequences set forth in SEQ ID NO: 650 and SEQ ID NO: 1071 are identical sequences, but due to differences in the start of the linear sequence, the start of the linear sequence is offset by two nucleotides. Identifying corresponding sequence regions between different sequences of the HBV genome sequence is well within the level of the skilled artisan.

[0155] The HBV life cycle includes processes such as viral entry, cccDNA formation, transcription, replication, assembly, secretion and integration. After the virus enters the liver cell via the bile acid transporter NTCP11, the viral nucleocapsid carrying HBV rcDNA is transported to the nucleus. rcDNA is released, and the four lesions on rcDNA are completely repaired to form supercoiled cccDNA molecules (also known as minichromosomes). Viral repair factors are dispensable for repair, and cccDNA usually depends on the host DNA repair machinery, including TDP2, DNA polymerase (POL) κ, POLα, DNA ligase 1 and 3, and flap endonuclease 1. HBV hijacks the host's ubiquitous liver-enriched transcription factors for cccDNA transcriptional regulation. cccDNA is a key viral reservoir that drives chronic HBV infection and serves as a template for all HBV viral transcripts. Another form of HBV DNA in the host is HBV DNA stably integrated in the host genome (Zhao K. et al., Cell Press-The Innovation 1(2):1-10(2020)). Double-stranded linear DNA (dslDNA) is the main substrate for integration into the host genome. Since there is almost no sequence homology between viral DNA and cellular DNA, the NHEJ DNA repair pathway is considered to be the mechanism of HBV DNA integration. HBV DNA integration occurs at double-strand breaks throughout the host genome, and terminal deletions of up to 200bp from integrated HBV DNA are common. No specific chromosomal hotspots or common recurrence sites have been observed between patients. There is some evidence that there is enrichment at specific genomic sites in tumor tissue (Sung W. et al., Nature Genetics 44 (7): 765-9 (2012)). Although no progeny viruses are produced, integrated HBV DNA can produce viral RNA and protein. HBV DNA integration occurs more frequently in liver cancer cells (84%) than in normal liver tissue (30%).

[0156] Current standards of care include nucleoside analogs (e.g., lamivudine) and pegylated interferon therapy. Nucleoside analogs work by inhibiting HBV polymerase activity, leading to reduced viral replication. However, prolonged treatment periods, increased viral resistance, and the emergence of mutants have reduced the effectiveness of nucleoside therapy (Papatheodoridis GV et al., Am. J. Gastroenterol 97(7):1618-28 (2002). Pegylated interferon therapy has been tested alone or in combination with nucleoside analogs (e.g., lamivudine) to inhibit transcription of viral DNA. Pegylated interferon therapy has been shown to mediate different effects on the innate and adaptive parts of the immune system, with a strong depletion effect on CD8 T cells, limiting the efficacy of therapy (Micco L. et al., Journal of Hepatology 58(2):225-233 (2013); Stelma F. et al., Journal of Infectious Disease 212(7):1042-51 (2015); marcellin P. et al., New England Journal of Medicine 351(12):1206-17(2004)). Neither nucleotide analogs nor pegylation therapy can eliminate or inhibit the production of HBV surface antigen (HBsAg), which has been associated with a poor prognosis in HBV infection. Other therapies, including antisense oligonucleotides (ASOs) and siRNA approaches centered on reducing HBsAg to achieve functional cure (Billioud G. et al., Journal of Hepatology 64(4):781-9(2015); Gane E. et al., Hepatology 74(4):1795-1808(2021); Flisiak R. et al., Expert Opinion on Biology Therapy 18(6)609-617), have been shown to be promising in inhibiting HBsAg, HBeAg, and HBV DNA synthesis. However, it is unclear whether any of these therapies have any functional benefit on liver tissue regeneration.

[0157] Current antiviral therapies rarely achieve a cure because they inhibit cytoplasmic HBV genome replication and do not directly target cccDNA forms - a form that acts as an HBV replication intermediate and viral persistence reservoir (Yang G. et al., Theranostics 9 (24): 7345-58 (2019)). Genome engineering methods (such as nucleases or base editors) target the removal or mutagenesis of the cccDNA pool to functionally cure infection. However, such nuclease-based therapies are likely to produce chromosomal abnormalities and are therefore not preferred, which highlights the need for better HBV therapies.

[0158] The persistence of free cccDNA pools in infected hepatocytes remains a key obstacle to complete elimination by anti-HBV therapy. cccDNA accumulates in the nucleus as chromatin-like cccDNA minichromosomes assembled by histones and non-histones. Due to its non-natural state, cccDNA shows unusual chromatin regulation. For example, it has been found that changes in the epigenetic state of cccDNA determine its transcriptional activity (Yang G. et al., Theranostics 9(24):7345-58(2019)). For example, the host nucleosome assembly machinery (HAT1 / CAF-1) acetylates histone H4 at H4K5 and H4K12 sites, contributing to the assembly of cccDNA. The acetylation marks on the histones of cccDNA in turn promote HBV replication and the accumulation of cccDNA. This transcriptional activity is largely driven by the presence or absence of activating epigenetic marks on cccDNA; repressive histone marks (e.g., H3K27me3 and H3K9me3) are minimal, suggesting limited repression in cccDNA (Tropberger P. et al., PNAS, 112(42):E5715-E5724 (2015); Riviere L. et al., J Hepatol 15(00450):S0168-8278 (2015)).

[0159] The desired clinical outcomes have been associated with key epigenetic features within the cccDNA minichromosome. Studies have found that cccDNA contains CpG islands that are easily methylated and are associated with HBV behavior (Zhang Y. et al., Plos One 9(10):e110442(2014); Vivekanandan P et al., Journal of infectious diseases, 199(9):1286-1291(2009); Vivekanandan P et al., Journal of Virology, 84(9):4321-4329(2010); Vivekanandan P et al., Journal of Viral hepatitis 15(2):103-107(2008); Jain S et al., Scientific Reports 5:10478(2015)). Methylation of CpG islands II and III has been associated with low levels of serum HBV DNA and HBsAg titers in patients (Zhang Y. et al., Plos One 9(10):e110442(2014)). HBV genotype, HBeAg positivity, patient age, and liver fibrosis stage have been found to be associated with cccDNA CpG methylation status. In vitro methylation studies have further confirmed that CpG island II methylation can significantly reduce cccDNA transcription and subsequent viral core DNA replication (Zhang Y. et al., Plos One 9(10):e110442(2014)), establishing the importance of chromatin for cccDNA regulation and as a potential target for the treatment of chronic HBV infection. Antiviral agents and broad epigenetic modifiers such as IFNα have been attributed to reducing active histone post-translational modifications, thereby transcriptionally downregulating cccDNA transcription (Tropberger P. et al., PNAS, 112(42):E5715-E5724 (2015); Belloni L et al., Journal of Clinical Investigation 122L529-537 (2012); Allweiss L. et al., Journal of Hepatology 60:500-507 (2014); Lucifora J. et al., Science 343:1221-1228 (2014)).

[0160] The embodiment provided is based on the following understanding: epigenetic silencing of one or more HBV viral genes (including those present on cccDNA) may be a feasible treatment method for curing HBV infection. Disclosed herein is a method for achieving improvement in HBV infection and potentially achieving functional cure in some cases via precise epigenetic silencing of HBV in the form of cccDNA, relaxed circular DNA (rcDNA) and integrated into human genomic DNA. The method described herein shows high efficacy, safety and stability. In some embodiments, the method targets all forms of HBV in the same way, utilizing a non-mutagenic platform, and targeting transcriptional sources rather than downstream transcripts. Since methylation can be inherited by cell progeny, the persistence of the table editing method provides hope for treating HBV infection. In some embodiments, the method described herein targets multiple positions on the viral genome to ensure a deep and lasting response across HBV variants. In some embodiments, the epigenetic method results in silencing of HBV replication, HBV transcription and protein production from HBV DNA. The embodiment provided does not rely on the clearance of immune restart and infected liver cells, but is based on direct epigenetic silencing (e.g., HBV suppression).

[0161] The embodiments provided herein include an epigenetic modification DNA targeting system, the epigenetic modification DNA targeting system comprising at least one DNA targeting module for suppressing the transcription of one or more hepatitis B virus (HBV) genes and / or their regulatory elements, wherein each of the at least one DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence; and (b) at least one transcription repressor effector domain. In some embodiments, the epigenetic modification DNA targeting system provided is used to regulate multiple targeted repression of multiple different genes or their regulatory elements for hepatitis B virus (HBV) replication and / or HBV transcription. In some embodiments, the epigenetic modification DNA targeting system comprises multiple DNA targeting modules for suppressing the transcription of multiple genes or their regulatory elements that regulate hepatitis B virus (HBV) replication and / or HBV transcription. In some embodiments, the DNA targeting module comprises (a) a fusion protein comprising a clustered regularly interspaced short palindromic repeats-related (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain; and (b) a plurality of guide RNAs (gRNAs), wherein the plurality of guide RNAs comprises at least a first gRNA and a second gRNA. In some embodiments, the first gRNA targets a target site of a first gene or its regulatory element, and the second gRNA targets a target site of a second gene or its regulatory element. The first gene and the second gene or their regulatory elements regulate hepatitis B virus replication and / or HBV transcription. Also provided herein are polynucleotides encoding the DNA targeting system or the fusion protein of the DNA targeting system, vectors, and compositions containing the same.

[0162] In some embodiments of the provided epigenetic modification DNA targeting system, the DNA binding domain is a clustered regularly interspaced short palindromic repeats-related (Cas) protein or a variant thereof with no nuclease activity, such as an inactive Cas (dCas, e.g., dCas9), and the DNA targeting system further comprises at least one gRNA that can be compounded with the Cas. In some embodiments, the DNA binding domain is a clustered regularly interspaced short palindromic repeats-related (Cas) protein or a variant thereof compounded with a guide RNA (gRNA). In such systems, the gRNA has a spacer sequence that can hybridize with the target site of the gene or its regulatory element. Also provided herein are related gRNAs (including Cas / gRNA combinations), polynucleotides, compositions, and methods related to or associated with the epigenetic modification DNA targeting system.

[0163] In some embodiments of the provided epigenetic modification DNA targeting systems, the DNA binding domain is a protein domain that is engineered to specifically bind to the target site sequence. For example, in some embodiments, the DNA binding domain is a zinc finger (ZFN)-based DNA binding domain or a transcription activator-like effector DNA binding domain as described herein.

[0164] Also provided herein is a method for regulating the transcription or phenotype of liver cells using the epigenetic modification DNA targeting system. Also provided herein is a method for suppressing HBV replication and / or protein levels using the epigenetic modification DNA targeting system. In some embodiments, the method can be used to treat therapies for HBV infection (such as hepatitis).

[0165] In some embodiments, the target site exists as covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA), and / or is integrated into genomic DNA. In some embodiments, the target site is at or near a gene or its regulatory element (such as a regulatory element or coding region) involved in HBV replication and / or HBV transcription. Also provided herein is an epigenetic modification DNA targeting system multiplexed with multiple DNA targeting modules so that the system can target a combination of such genes or their regulatory elements. In some embodiments, each module of the DNA targeting system suppresses the transcription of different genes. Also provided herein is a method for reducing HBV replication and / or transcription using the epigenetic modification DNA targeting system. In some embodiments, the method can be used to treat liver disease (e.g., hepatitis), cancer (e.g., hepatocellular carcinoma) or HBV infection (acute or chronic hepatitis).

[0166] Therefore, in some embodiments, the DNA targeting system includes a synthetic transcription factor that can regulate (such as reduce or suppress) gene transcription in a targeted manner. In the embodiment provided, the epigenetic modification DNA targeting system provided reduces the transcription of the gene and / or its regulatory element or the multiple genes and / or its regulatory element, thereby promoting the silencing of HBV replication and / or transcription. The embodiment provided can be used to target multiple genetic mechanisms to treat HBV in infected patients while avoiding viral resistance, the cost associated with extended treatment, and the poor efficacy of current combination therapies. The method provides a substantial clinical solution for the treatment of HBV infection by reducing viral replication and transcription from cccDNA and integrated HBV DNA and avoiding problems associated with current therapies.

[0167] All publications (including patent documents, scientific articles, and databases) mentioned in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If definitions set forth herein are contrary to or otherwise inconsistent with definitions set forth in patents, applications, published applications, and other publications incorporated herein by reference, the definitions set forth herein take precedence over those incorporated herein by reference.

[0168] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. I. DNA Targeting System

[0169] In some embodiments, a DNA targeting system is provided that can specifically target a target site in at least one gene (also referred to herein as a target gene) or its DNA regulatory element (e.g., a regulatory element) and reduce the transcription of the at least one gene. In the embodiments provided, for each targeted target gene or its regulatory element, the DNA targeting system comprises a DNA binding domain that is bound to the target site in the gene or its regulatory element. In some embodiments, the DNA targeting system further comprises at least one effector domain, the at least one effector domain being capable of epigenetically modifying one or more DNA bases of a gene or its regulatory element, wherein the epigenetic modification results in a reduction in the transcription of the gene (e.g., inhibiting or reducing the transcription of the gene compared to the absence of the DNA targeting system). Therefore, the terms DNA targeting system and epigenetic modification DNA targeting system are used interchangeably herein. In some embodiments, the DNA targeting system includes a fusion protein comprising: (a) at least one DNA binding domain capable of targeting to a target site; and (b) at least one effector domain capable of reducing gene transcription. For example, the at least one effector domain is a transcription repressor domain.

[0170] In some embodiments, the DNA targeting system contains at least one DNA targeting module, wherein each DNA targeting module of the system is a component of the DNA targeting system that is capable of independently targeting a target site in a target gene or its regulatory element as provided. In some embodiments, each DNA targeting module comprises (a) a DNA binding domain capable of targeting a target site in a target gene or its regulatory element, wherein the target gene or its regulatory element regulates HBV replication and / or HBV transcription; and (b) an effector domain capable of reducing gene transcription.

[0171] In some embodiments, the DNA targeting system comprises a single DNA targeting module for targeted repression of a single gene. In some embodiments, the DNA targeting module comprises (a) a DNA binding domain capable of targeting a target site of a target gene or its regulatory element that regulates HBV replication and / or HBV transcription; and (b) an effector domain capable of reducing gene transcription.

[0172] In some embodiments, the DNA targeting system comprises a single DNA targeting module for targeted repression of more than one gene or its regulatory element. Thus, in some embodiments, a single DNA targeting module provides a multiple epigenetic modification DNA targeting system, which targets and regulates (e.g., represses) more than one gene or its regulatory element. In some embodiments, the DNA targeting module comprises (a) a DNA binding domain capable of targeting a target site of more than one target gene or its regulatory element, wherein the target gene or its regulatory element regulates HBV replication and / or HBV transcription; and (b) an effector domain capable of reducing gene transcription. In some embodiments, the DNA targeting system comprises a single DNA targeting module, which is used to target and repress at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30 genes or their regulatory elements. In specific embodiments, the DNA targeting module has cross-reactivity to each of the target sites of more than one gene. In some embodiments, a single DNA targeting module provides a multiplex epigenetic modification DNA targeting system that represses the transcription of more than one gene or its regulatory elements. In some embodiments, the DNA targeting module represses the transcription of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, or at least 30 genes or their regulatory elements.

[0173] In some embodiments, the DNA targeting system is a multiplex DNA targeting system comprising a plurality of DNA targeting modules, wherein each DNA targeting module targets a different target site of one or more genes or their regulatory elements. In some embodiments, the different target sites are located in the same region of a gene or its regulatory element. In some embodiments, the different target sites are present in a regulatory element such as a promoter. In some embodiments, the target sites overlap, such that any two or more DNA targeting modules bind to overlapping target sites.

[0174] In some embodiments, the DNA targeting system comprises a plurality of DNA targeting modules, wherein each DNA targeting module is used to target and repress a different gene. In some embodiments, the DNA targeting system is a multiple DNA targeting system, i.e., it targets a target site in more than one gene or its regulatory element. The term DNA targeting system may include a multiple epigenetic modification DNA targeting system comprising more than one DNA targeting module. In some embodiments, each DNA targeting module within the multiple epigenetic modification DNA targeting system targets a target site in a different gene or its regulatory element, so as to repress a different gene with each of the other DNA targeting modules of the system. In some embodiments, each DNA targeting module within the multiple epigenetic modification DNA targeting system targets a target site in more than one gene or its regulatory element to repress the transcription of the more than one gene. In some embodiments, each DNA targeting module represses the transcription of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, or at least 30 genes.

[0175] The multiplex epigenetic modification DNA targeting system comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30 DNA targeting modules or any value between any of the foregoing values. In some embodiments, the multiplex epigenetic modification DNA targeting system represses the transcription of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30 genes.

[0176] In some embodiments, any two DNA-targeting modules of a DNA-targeting system comprise separate (i.e., non-overlapping) components. In some embodiments, each DNA-targeting module of a DNA-targeting system comprises separate (i.e., non-overlapping) components. For example, a DNA-targeting system may comprise: a first DNA-targeting module comprising a first fusion protein comprising a DNA-binding domain that targets a first target site (e.g., a DNA-binding domain based on a ZFN or TALE); and a second DNA-targeting module comprising a second fusion protein comprising a second DNA-binding domain that targets a second target site (e.g., a DNA-binding domain based on a ZFN or TALE).

[0177] In some embodiments, any two DNA targeting modules of the DNA targeting system may contain shared (i.e., overlapping) components. In some embodiments, each DNA targeting module of the DNA targeting system contains shared (i.e., overlapping) components. For example, the DNA targeting system may include: a first DNA targeting module, the first DNA targeting module comprising (a) a fusion protein comprising a Cas protein and a transcriptional repressor domain, and (b) a first gRNA that is complexed with the Cas protein and targets a first target site of a first HBV gene or its regulatory element; and a second DNA targeting module, the second DNA targeting module comprising (a) a fusion protein of the first DNA targeting module, and (b) a second gRNA that is complexed with the Cas protein and targets a second target site of a second HBV gene or its regulatory element. It should be understood that providing two or more different gRNAs for a given Cas protein enables different molecules of the same Cas protein to target the target sites of two or more gRNAs. In contrast, as described herein, different Cas protein variants (e.g., SpCas9 and SaCas9) are compatible with different gRNA scaffold sequences and PAMs. Therefore, a single DNA targeting system comprising multiple CRISPR / Cas-based non-overlapping DNA targeting modules can be engineered.

[0178] In some aspects, provided herein is an epigenetic modification DNA targeting system comprising a plurality of DNA targeting modules for suppressing the transcription of a plurality of genes regulating HBV replication and / or HBV transcription. In some embodiments, the plurality of DNA targeting modules comprise a first DNA targeting module for suppressing the transcription of a first gene or its regulatory element in the plurality of genes, and a second DNA targeting module for suppressing the transcription of a second gene in the plurality of genes. In some embodiments, each DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site of one of the plurality of genes, and (b) at least one transcription repressor domain. In some embodiments, the target site is at or near an HBV gene or its regulatory element. In some embodiments, the HBV gene or its regulatory element is involved in controlling HBV replication and / or HBV transcription. The regulatory element can be a promoter region (e.g., pre-S1 promoter, pre-S2 promoter, X promoter, or basal core promoter), an enhancer region (e.g., Enh1 or Enh2 enhancer region), or any other transcript processing control region (e.g., regions involved in 5' capping, splicing, and / or 3' polyadenylation).

[0179] In some aspects, provided herein is an epigenetic modification DNA targeting system comprising at least one DNA targeting module for repressing transcription of one or more hepatitis B virus (HBV) genes; wherein each of the at least one DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence (such as an HBV gene or its regulatory element); and (b) at least one transcriptional repressor effector domain.

[0180] In some aspects, provided herein is an epigenetic modification DNA targeting system comprising at least one DNA targeting module for repressing the transcription of one or more hepatitis B virus (HBV) genes, wherein each of the at least one DNA targeting module comprises: (a) a fusion protein comprising a clustered regularly interspaced short palindromic repeat-related (Cas) protein or its variant and at least one transcription repressor effector domain; and (b) a plurality of guide RNAs (gRNAs) targeting a plurality of target sites of a plurality of genes or their regulatory elements, wherein the plurality of genes or their regulatory elements regulate hepatitis B virus replication and / or HBV transcription. In aspects of the embodiments provided, the plurality of target sites are 2, 3, 4, 5 or 6 different target sites. In aspects of the embodiments provided, the plurality of target sites are each in a different HBV gene or its regulatory element.

[0181] In aspects of the embodiments provided, the DNA targeting systems provided herein target genes or their regulatory elements to reduce the transcription of one or more HBV genes in cells infected with hepatitis B virus (HBV), wherein the reduced transcription regulates one or more activities or functions of cells infected with HBV, such as the expression of HBV RNA and / or HBV proteins. In some embodiments, the reduced transcription of a gene results in reduced expression of the gene in infected cells, i.e., reduced gene expression. In some embodiments, the reduced transcription of a gene, such as reduced gene expression, results in reduced expression of a protein in infected cells, i.e., reduced protein expression.

[0182] In some aspects, the cell is a hepatocyte, such as a hepatocyte, a hepatic stellate cell (HSC), a Kupffer cell, and a liver sinusoidal endothelial cell. For example, provided herein is a DNA targeting system provided herein, wherein the DNA targeting system targets a gene or its regulatory element to reduce the transcription of an HBV gene in a target cell, wherein the reduced transcription regulates one or more activities or functions of HBV, such as transcription and protein expression of HBV. In some embodiments, the transcription of a gene is reduced, resulting in a reduction in the expression of the gene in the target cell, i.e., a reduction in gene expression. In some aspects, the cell is a hepatocyte.

[0183] In some aspects, the cell is from a human subject. In some aspects, the cell is a cell in a subject (i.e., a cell in vivo).

[0184] In some embodiments, the DNA binding domain comprises or is derived from CRISPR-related (Cas) proteins, zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs), mega-nucleases, homing endonucleases, I-SceI enzymes, or variants thereof. In some embodiments, the DNA binding domain comprises a catalytically inactive (e.g., nuclease-free or nuclease-inactive) variant of any of the foregoing. In some embodiments, the DNA binding domain comprises an inactivated Cas9 (dCas9) protein or a variant thereof, which is catalytically inactive and therefore does not have nuclease activity and cannot cut DNA.

[0185] In some embodiments, the DNA binding domain comprises or is derived from a Cas protein or a variant thereof, such as a Cas or dCas (e.g., dCas9) without nuclease activity, and the DNA targeting system comprises one or more guide RNAs (gRNAs), such as a combination of gRNAs (e.g., two gRNAs or three gRNAs). In some embodiments, the gRNA comprises a spacer sequence capable of targeting and / or hybridizing to a target site. In some embodiments, the gRNA can be compounded with the Cas protein or its variants. In some aspects, the gRNA guides or recruits the Cas protein or its variants to the target site. In some embodiments, the effector domain comprises a transcriptional repressor domain, and / or can reduce the transcription of a gene. In some embodiments, the effector domain directly or indirectly causes a reduction in the transcription of a gene. In some embodiments, the effector domain induces, catalyzes, or causes transcriptional repression. In some embodiments, the effector domain induces transcriptional repression. In some aspects, the effector domain is selected from a KRAB domain, an ERF repressor domain, a MXI1 domain, a SID4X domain, a MAD-SID domain, a DNMT family protein domain (e.g., DNMT3A or DNMT3B), a fusion of one or more DNMT family proteins or their domains (e.g., DNMT3A / L, comprising a fusion of DNMT3A and DNMT3L domains), LSD1, a SunTag domain, an EZH2 domain, a partial or fully functional fragment or domain of any of the foregoing, or a combination of any of the foregoing. In some embodiments, the effector domain is KRAB. In some embodiments, the effector domain is DNMT3A / L.

[0186] In some embodiments, the fusion protein of the DNA targeting system comprises a dCas9-KRAB fusion protein. In some embodiments, the fusion protein of the DNA targeting system comprises a DNMT3A / L-dCas9-KRAB fusion protein. In some embodiments, the fusion protein of the DNA targeting system comprises a KRAB-dCas9-DNMT3A / L fusion protein.

[0187] Exemplary components and features of DNA-targeting systems are provided in the following subsections. A. Target Site and Target Location

[0188] In any embodiment herein, the target site is a gene and / or its regulatory element in the hepatitis B virus (HBV) genome. In some embodiments, the target site is present in covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA) and / or is integrated in human genomic DNA. In some embodiments, the target site is located in a hepatitis B virus DNA sequence. In some embodiments, the hepatitis B virus DNA sequence is an HBV gene or its regulatory element. In some embodiments, the target site is at or near a gene involved in HBV replication and / or HBV transcription. In some embodiments, the epigenetic modification DNA targeting system includes at least one DNA targeting module for suppressing the transcription of one or more HBVs by targeting the target site. In some aspects, suppressing the transcription of HBV genes, such as reduced gene expression, leads to the silencing of HBV replication (for example, HBV replication reduction) and / or HBV transcription.

[0189] With reference to the disclosure provided, it should be understood that cells that are positive (+) for HBV (e.g., cells infected by HBV) mean that the cells express any HBV marker described herein (e.g., HBV RNA transcripts and / or proteins). Similarly, it should be understood that cells that are negative (-) for a particular marker are cells that do not express the marker and whose expression levels are undetectable. Antibodies and other binding entities can be used to detect the expression level of marker proteins to identify or detect given cell surface markers. Suitable antibodies can include polyclonal, monoclonal, fragments (e.g., Fab fragments), single-chain antibodies, and other forms of specific binding molecules. Skilled technicians are readily aware of antibody reagents for the above-mentioned cell surface markers. Many well-known methods for assessing the expression level of surface markers or proteins can be used, such as by affinity-based methods, such as detection based on immunoaffinity methods (e.g., in the context of surface markers, such as by flow cytometry). In some embodiments, the label is a fluorophore, and the method for detecting or identifying cell surface markers on cells (e.g., hepatocytes) is flow cytometry. In some embodiments, for each of the different markers, a different marker is used by multicolor flow cytometry.In some embodiments, surface expression can be determined by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting binding of the antibody to the marker.

[0190] In some embodiments, a cell (e.g., a hepatocyte) is positive (pos or +) for a particular marker if there is detectable presence of the particular marker on or in the cell (which can be an intracellular marker or a surface marker (e.g., HBeAg, HBsAg)). In some embodiments, surface expression is positive if staining by flow cytometry is detectable at a level significantly higher than staining detected by the same procedure with an isotype-matched control under otherwise identical conditions, and / or at a level substantially similar to or, in some cases, higher than that of cells known to be positive for the marker, and / or at a level higher than that of cells known to be negative for the marker. In some embodiments, a cell (e.g., a hepatocyte) contacted by a DNA-targeting system as described herein has reduced expression of a particular marker (e.g., HBeAg) if staining is significantly lower compared to a similar cell not contacted by a DNA-targeting system as described herein.

[0191] In some embodiments, a cell (e.g., a hepatocyte) is negative (neg or -) for a particular marker if there is no detectable presence of the particular marker (which can be an intracellular marker or a surface marker) on or in the cell. In some embodiments, surface expression is negative if the staining is not detectable by flow cytometry at a level significantly higher than that detected by the same procedure with an isotype-matched control under otherwise identical conditions, and / or is detectable at a level significantly lower than that of cells known to be positive for the marker, and / or is detectable at a level substantially similar to that of cells known to be negative for the marker.

[0192] In some embodiments, the phenotype of infected cells and / or individuals is functionally characterized. In some aspects, the phenotype can be characterized by the presence of HBV RNA transcripts in infected cells. In some aspects, the phenotype can be characterized by the presence of any one or combination of HBV proteins in infected cells. In some aspects, the phenotype can be characterized by the presence of antibodies against any marker described herein. In some aspects, antibodies include but are not limited to anti-HBc-IgM, anti-HBc total antibodies, and antibodies against HBeAg. In some embodiments, RNA transcripts, proteins, and / or antibodies are measured, detected, and / or quantified by any suitable technique known in the art. For example, real-time PCR technology can be used to measure, detect, and / or quantify RNA transcripts. HBV proteins (e.g., HBsAg, HBeAg, and / or HBcrAg) can be measured, detected, and / or quantified using enzyme-linked immunosorbent assay (ELISA).

[0193] The target gene and / or its regulatory element regulated by the provided DNA targeting system (including the multiple epigenetic modification DNA targeting system herein) include any gene and / or regulatory element whose transcription and expression are reduced in cells (e.g., cells infected by HBV). Various methods can be used to characterize the transcription or expression level of genes in cells (e.g., hepatocytes), such as after the cells have been contacted with or introduced into the provided DNA targeting system. In some embodiments, the transcriptional activity or expression of genes can be analyzed by RNA analysis. In some embodiments, RNA analysis includes RNA quantification. In some embodiments, RNA quantification is performed by reverse transcription quantitative PCR (RT-qPCR), multiple qRT-PCR, fluorescence in situ hybridization (FISH), RNA sequencing (RNA-seq) or a combination thereof.

[0194] In some embodiments, a gene or transcript is a gene or transcript whose gene expression or transcript presence is reduced in a cell (e.g., an HBV infected cell, such as a hepatocyte) upon contact with or introduction of a provided DNA targeting system (e.g., a multiple epigenetic DNA targeting system). In some aspects, multiple genes or transcripts are targeted by a multiple epigenetic DNA targeting system, such as by one or more DNA targeting modules thereof. In such a system, each gene or transcript of a multiple epigenetic DNA targeting system is a gene or transcript whose gene expression or transcript presence is reduced in a cell upon contact with or introduction of a provided multiple epigenetic DNA targeting system. In some embodiments, the reduction in gene expression or the change in transcript levels in cells (e.g., HBV-infected cells, such as hepatocytes) compared to the gene level in control cells is about a log2 fold change of at least 1.25-fold, 1.5-fold, 1.75-fold, 2.0-fold, 2.5-fold, 2.75-fold, 3.0-fold, 3.25-fold, 3.5-fold, 3.75-fold, 4.0-fold, 4.25-fold, 4.5-fold, 4.75-fold, 5.0-fold, 5.25-fold, 5.5-fold, 5.75-fold, 6.25-fold, 6.50-fold, 6.75-fold, 7.0-fold, 7.25-fold, 7.50-fold, 7.75-fold, 8.0-fold, 8.25-fold, 8.5-fold, 8.75-fold, 9.0-fold, or any value in between any of the foregoing values. In some embodiments, the reduction in gene expression or the change in transcript levels in cells (e.g., HBV-infected cells, such as hepatocytes) is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, or any value between any of the foregoing values, compared to the gene levels in control cells. In some embodiments, the reduction in gene expression in cells or the change in transcript levels is greater than 90%, compared to the gene levels in control cells. In some embodiments, the guide RNA is shown in SEQ ID NO: 565, 528, 542, 508, 515, 575, 515, 453, 506, 514, 425, or 472. In some embodiments, the reduction in gene expression in cells or the change in transcript levels is greater than 75%, compared to the gene levels in control cells.In some embodiments, the guide RNA is set forth in SEQ ID NO: 565 (HBVg_175), 528 (HBVg_138), 582 (HBVg_192), 542 (HBVg_152), 508 (HBVg_118), 515 (HBVg_125), 575 (HBVg_185), 453 (HBVg_63), 506 (HBVg_116), 514 (HBVg_124), 395 (HBVg_5), 472 (HBVg_63), _82), 451(HBVg_61), 488(HBVg_98), 540(HBVg_150), 533(HBVg_143), 572(HBVg_182), 566(HBVg _176), 489(HBVg_99), 469(HBVg_79), 408(HBVg_18), 465(HBVg_75), 402(HBVg_12), 474(HBVg_84 ), 525(HBVg_135), 416(HBVg_26), 396(HBVg_6), 554(HBVg_164), 419(HBVg_29), 545(HBVg_155) , 446(HBVg_56), 580(HBVg_190), 555(HBVg_165), 412(HBVg_22), 428(HBVg_38), 458(HBVg_68), 548(HBVg_158), 511(HBVg_121), 432(HBVg_42), 441(HBVg_51), 433(HBVg_43), 579(HBVg_189), 479(HBVg_89), 478(HBVg_88), 520(HBVg_130), 462(HBVg_72), 523(HBVg_133) and 503(HBVg_113).

[0195] In the provided embodiment, cccDNA transcribes five HBV RNAs (0.7 kb, 2.1 kb, 2.4 kb, longer and shorter 3.5 kb RNAs) under the action of host RNA polymerase. The transcription of cccDNA is controlled by four promoters (basic core promoter, pre-S1 promoter, pre-S2 promoter and X promoter) and two enhancers (enhancer I and enhancer II) ( Figure 1). The 0.7-kb RNA can be translated into HBV X protein (HBx), which acts as a transcriptional regulator. The 2.1-kb RNA can be translated into HBV small surface protein (S) and medium surface protein (M). The 2.4-kb RNA can be translated into HBV large surface protein (L). L, M and S can self-assemble to form empty subviral particles (SVP) (including spherical SVP and filamentous SVP), and only filamentous SVP and virions that are secreted contain a large amount of L protein. Spherical SVP is secreted through the constitutive secretory pathway. Filamentous SVP is secreted by the endosomal sorting complex required for transport (ESCRT) machinery through multivesicular bodies (MVBs). The longer 3.5-kb RNA is called pre-core RNA (pre-C RNA) and can be translated into pre-core protein, more widely known as HBV e antigen (HBeAg). The shorter 3.5-kb RNA is the pregenomic RNA (pgRNA), which has two functions: one is to serve as a translation template for HBV polymerase (Pol) and core protein, and the other is to serve as a replication template for reverse transcription in the capsid (formed by polymerization of core protein), which is reverse transcribed by Pol to form HBV rcDNA. These nucleocapsids can then be coated by HBV surface proteins (L, M, and S) to form mature virions and secreted through the ESCRT / MVB pathway. Alternatively, these nucleocapsids can also be transported to the cell nucleus to form cccDNA. In some embodiments, repression of HBV gene transcription and / or translation, such as reduced gene expression, leads to silencing of any of the following HBV markers: HBV HBV X protein (HBx), hepatitis B virus surface antigen (HBsAg) such as small surface protein (S), middle surface protein (M), or HBV large surface protein (L), HBV e antigen (HBeAg). In some embodiments, the transcription and / or translation of the HBV gene is suppressed, such as reduced gene expression, resulting in the silencing of HB core-related antigen (HBcrAg). HBcrAg includes 3 kinds of pre-core / core protein products, including hepatitis B virus core antigen (HBcAg), HBeAg and 22-kDA pre-core protein (p22cr). In some aspects, cccDNA, HBV total DNA, serum HBcrAg, HBsAg, HBeAg, hepatitis B virus core antibody (anti-HBc), HBV DNA, HBV RNA are quantitatively measured as a readout of reduced HBV transcription and / or translation. In some embodiments, the target site is located in a gene encoding any HBV protein. In some embodiments, the target site is located in a regulatory element (such as a promoter or enhancer) of a gene encoding any HBV protein.

[0196] In some embodiments, the target site for the epigenetic modification DNA targeting system is located in a gene involved in HBV replication and / or HBV transcription. In some aspects, the target site for the epigenetic modification DNA targeting system is located in or near a gene or its regulatory element involved in controlling HBV replication and / or HBV transcription. In some embodiments, the genes involved in HBV replication and / or HBV transcription are polymerase genes, S family genes, X genes and / or core family genes. In some embodiments, the genes involved in HBV replication and / or transcription encode polymerases, envelope proteins, capsid proteins, transcription factors or transcriptional transactivators. In some embodiments, the regulatory elements involved in HBV replication and / or HBV transcription are promoter regions, enhancer regions and / or any transcript processing control regions. In some embodiments, the promoter region is pre-S1 promoter, pre-S2 promoter, X promoter or basic core promoter. In some embodiments, the enhancer region is Enh1 enhancer and / or Enh2 enhancer region. In some embodiments, the transcript processing control region is a region encoding signals for 5' capping, splicing, and / or 3' polyadenylation.

[0197] In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO 650 located between base pair (bp) positions 1 bp-42 bp, 491 bp-1032 bp, 1750 bp-1799 bp, or 1951 bp-2952 bp of the HBV genome. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as set forth in SEQ ID NO: 1056 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as set forth in SEQ ID NO: 1058 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as set forth in SEQ ID NO: 1060 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as shown in SEQ ID NO: 1062 or a complementary sequence thereof.

[0198] In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650 located between base pair (bp) positions 43 bp-490 bp, 1033 bp-1749 bp, 1800 bp-1950 bp, or 2953 bp-3182 bp of the HBV genome. In some embodiments, the target site is within a target region of the HBV genome having a sequence as set forth in SEQ ID NO: 1057 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome having a sequence as set forth in SEQ ID NO: 1059 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome having a sequence as set forth in SEQ ID NO: 1061 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as shown in SEQ ID NO: 1063 or a complementary sequence thereof.

[0199] In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650 located between base pair (bp) positions 67 bp-392 bp (CpG island 1), 1033 bp-1749 bp (CpG island 2), or 2215 bp-2490 bp (CpG island 3) of the HBV genome. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as set forth in SEQ ID NO: 1064 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as set forth in SEQ ID NO: 1059 or a complementary sequence thereof. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence as set forth in SEQ ID NO: 1066 or a complementary sequence thereof.

[0200] In some embodiments, the target site is in a polymerase gene or its regulatory elements. The polymerase gene (also known as the P gene) encodes a multifunctional enzyme (also known as P polymerase, HBVgp1, or DNA-guided DNA polymerase) that converts the viral RNA genome into dsDNA within the viral cytoplasmic capsid. The polymerase exhibits DNA polymerase activity that can replicate DNA or RNA templates, as well as ribonuclease H (RNase H) activity that cleaves the RNA strand of an RNA-DNA heteroduplex in a partially progressive 3' to 5' endonuclease pattern. The polymerase gene ORF completely overlaps with the pre-S / S ORF and partially overlaps with the core family and X gene ORFs. In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650 located between 1 bp-1621 bp, 1374 bp-1838 bp, or 2307 bp-3182 bp of the HBV genome.

[0201] In some embodiments, the target site is in an S family gene or a regulatory element thereof. In some embodiments, the target site is in the S gene, pre-S1 promoter, and / or pre-S2 promoter region. The S family gene encodes three different structurally related envelope proteins that are synthesized from different start codons and are referred to as large (L), medium (M), and small (S) hepatitis B (HB) virus proteins (also referred to as L-HBs, M-HBs, and s-HBs, respectively). These three proteins have the same carboxyl terminus but different amino terminal extensions. In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650 located between 1 bp and 837 bp, 1 bp and 155 bp, or 2854 bp and 3182 bp of the HBV genome.

[0202] In some embodiments, the target site is in the X gene or its regulatory elements. The X gene (also known as HBx, HBVgp3, peptide X, pX) is a gene that encodes a multifunctional protein that regulates transcriptional regulation, protein degradation pathways, apoptosis, signal transduction, cell cycle progression, and genetic stability by interacting directly or indirectly with host factors. The X gene protein regulates protein degradation pathways, apoptosis, transcription, signal transduction, cell cycle progression, and genetic stability by interacting directly or indirectly with host factors. In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (Hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650, located between 1374 bp and 1838 bp of the HBV genome. In some embodiments, the start codon encoding the HBx protein (HBx start codon) is located at residue base pair 1376 of the HBV genome, corresponding to the position of the reference HBV genome set forth in SEQ ID NO: 650. In some embodiments, the start codon encoding the HBx protein (HBx start codon) is at the 1374th residue base pair of the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO: 1071. It was found herein that targeting a target site in the region upstream of the start codon of the X gene using the provided epigenetic modification DNA targeting system exhibited high activity in suppressing viral replication and transcription in HBV-infected cells. In some embodiments, the target region is located in a CpG island of the HBV genome. In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a sequence located between 1033-1749 bp with reference to the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target site is in the HBx promoter / enhancer #1 region, such as within a target region having a sequence corresponding to a sequence located between 1100-1350 bp with reference to the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target site is in the basic core promoter region, such as within a target region having a sequence corresponding to a sequence between 1600-1750 bp of the HBV genome shown in reference SEQ ID NO: 650.

[0203] In some embodiments, the target site is within a target region that spans 300 base pairs (bp), 250bp, 200bp, 150bp, 140bp, 130bp, 120bp, 110bp, or 100bp upstream of the HBx start codon. In some embodiments, the target site is within a target region that has a sequence corresponding to a sequence between 1250-1374bp of the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target site is within a target region of the HBV genome that has a sequence shown in SEQ ID NO: 1068 or a complementary sequence thereof. In some embodiments, the target site is a sequence within a target region that has a sequence corresponding to a sequence between 1255-1302bp of the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target site is within a target region of the HBV genome that has a sequence shown in SEQ ID NO: 1069 or a complementary sequence thereof. In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a sequence located between 1260-1300 bp with reference to the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence shown in SEQ ID NO: 1070 or a complementary sequence thereof. In some embodiments, the target site or each of the target sites is within a target region, wherein the target region is located at a base pair between 1060-1480 bp of the HBV genome corresponding to a position with reference to the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target site is within a target region of the HBV genome, wherein the target region has a sequence shown in SEQ ID NO: 1067. Exemplary DNA binding systems for targeting target sites in such regions are provided herein, including systems with various DNA binding domains, including CRISPR / Cas systems and ZFPs.

[0204] In some embodiments, the target site is in a core family gene or its regulatory element. In some embodiments, its regulatory element is the Enh2 promoter. In some embodiments, its regulatory element is a basic core promoter (BCP). The core promoter (CP) region of the viral genome plays a key role in viral replication and morphogenesis (Quarleri J, World Journal of Gastroenterology 20 (2): 425-435 (2014)). The core promoter region guides the initiation of transcription to synthesize both pre-core mRNA and pre-genomic RNA (pgRNA). The CP region is composed of a basic core promoter (BCP), which initiates the transcription of pre-core mRNA (also referred to as pre-C, C gene, HBVgp4) and pgRNA, and is composed of an upstream regulatory region (URR), which contains positive and negative regulatory elements that regulate promoter activity. Several transcription factors bind to regulatory sequence elements of the CP, such as C / EBP, HNF1, HNF3 / 4, and COUP-TF1, to differentially regulate the synthesis of pre-C mRNA and pgRNA. The presence of AT-rich regions or TATA-like boxes within the CP has also been attributed to the transcription of pgRNA. Pre-core mRNA encodes the outer core antigen (also known as capsid protein, precapsid protein, HBeAg, pre-core protein, p25), which self-assembles into an icosahedral capsid to package the viral genome. The pgRNA is translated to form the polymerase, the nucleocapsid protein HBcAg, and the soluble secreted HBeAg protein. In addition, the pgRNA is incorporated into the progeny nucleocapsid and reverse transcribed into DNA by the co-assembled viral polymerase to form new HBV virions. These mature nucleocapsids containing relaxed circular DNA (rcDNA) can redeliver their genomes to the nucleus of the same cell to build a pool of 10-100 copies of cccDNA molecules, or can interact with envelope proteins at the endoplasmic reticulum / Golgi apparatus and secrete as new infectious virus particles (Pollicino T., et al., Journal of hepatology, 61 (2): P408-417 (2014)). In some embodiments, the target site is in a core family gene or its regulatory element. In some aspects, targeting one or more sites within a core family gene or its regulatory element includes suppressing pgRNA transcripts. In some aspects, suppression of pgRNA transcripts includes silencing of HBV replication.In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650 located between 1590bp-1815bp, 1636bp-1744, 1751bp-1769, 1814bp-1900bp, 1816bp-2455, and 1800bp-1950bp of the HBV genome. In some embodiments, transcription reduction includes a reduction in the total level of hepatitis B virus RNA transcripts. In some embodiments, transcription reduction includes a reduction in hepatitis B virus pre-core ("pre-C") and / or pre-genomic ("pgRNA") RNA levels.

[0205] In some aspects, the target site is a coding region. In some embodiments, the genes involved in HBV replication and / or HBV transcription encode HBV X protein (HBx), S family protein (HBsAg) (such as small surface protein (S-HBs), medium surface protein (M-HBs) or HBV large surface protein (L-HBs)), pre-core protein (HBeAg), HBV core-related antigen (HBcrAg), polymerase, core protein and pre-core protein. In some aspects, the target site is a sequence within the target region, and the target region has the following sequence, which corresponds to the reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650 is located between 1bp-42bp, 43bp-1090bp, 1091bp-1849bp or 1850bp-2455bp or 2455bp-3182bp of the HBV genome.

[0206] In some embodiments, repression of transcription comprises a reduction in hepatitis B virus surface antigen (HBsAg) and / or hepatitis B virus core-related antigen (HBcrAg) protein levels. In some embodiments, repression of transcription comprises a reduction in HBsAg transcripts and / or protein levels by at least 90%. In some embodiments, repression of transcription comprises a reduction in HBcrAg transcripts and / or protein levels from cccDNA by at least 50%.

[0207] In some embodiments, repressing transcription comprises a reduction in the levels of hepatitis B virus pre-core ("pre-C"), pre-genome ("pgRNA"), pre-S1, pre-S2 / S, and HBx.

[0208] In some embodiments, multiple epigenetic modification DNA targeting systems target or are incorporated into a target site in a gene, such as any target site described above. In some embodiments, the target site is positioned in the regulatory DNA element of a gene in a cell (e.g., hepatocyte). In some embodiments, the regulatory DNA element is a sequence that a gene regulatory protein can bind to and affect gene transcription. In some embodiments, the regulatory DNA element is a cis, trans, distal, proximal, upstream, or downstream regulatory DNA element of a gene. In some embodiments, the regulatory DNA element is a promoter or enhancer of a gene. In some embodiments, the target site is positioned in a promoter, enhancer, exon, intron, untranslated region (UTR), 5'UTR, or 3'UTR of a gene. In some embodiments, a promoter is a nucleotide sequence that RNA polymerase binds to to start gene transcription. In some embodiments, a promoter is typically positioned between 100bp and 1000bp of a gene transcription start site, such as a nucleotide sequence positioned in about 100bp, about 500bp, or about 1000bp of a gene transcription start site. In some embodiments, the target site is located within a sequence with an unknown or known function suspected of controlling gene expression.

[0209] In some embodiments, the target site is located within about 50 base pairs (bp), about 100 bp, about 150 bp, about 200 bp, about 250 bp, about 300 bp, about 350 bp, about 400 bp, about 450 bp, about 500 bp, about 600 bp, about 650 bp, about 700 bp, about 750 bp, about 800 bp, about 850 bp, about 900 bp, about 1000 bp, about 1050 bp, about 1100 bp, about 1200 bp, about 1250 bp, about 1300 bp, about 1350 bp, about 1400 bp, about 1450 bp, or about 1500 bp of the transcription start site.

[0210] In some embodiments, the target site is located within a target region located between 1 bp and 3300 bp of the HBV genome. In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO 650 located between 43 bp and 490 bp, 1033 bp and 1749 bp, 1800 bp and 1950 bp, or 2953 bp and 3182 of the HBV genome. In some embodiments, the target site is a sequence within a target region having a sequence corresponding to a reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO 650 located between 1bp-42bp, 491bp-1032bp, 1750bp-1799bp, or 1951bp-2952bp or 3198bp-3182bp of the HBV genome. According to phylogenetic analysis and sequence divergence, HBV can be divided into 10 genotypes (A to J) based on 8% or greater divergence between groups in the complete nucleotide sequence (Norder H, et al., Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes. Virology. 1994 Feb;198(2):489-503; Stuyver L, et al., A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness. J Gen Virol. 2000 Jan;81(Pt 1):67-74, Arauz-Ruiz P, et al., Genotype H: a new Amerindian genotype of hepatitis B virus revealed in Central America. J Gen Virol. 2002 Aug;83(Pt 8):2059-2073)). There is evidence that HBV genotype influences clinical outcome, mutation patterns in the precore and core promoter regions, HBeAg seroconversion rates, and response to interferon therapy.Most genotypes have specific geographic distributions; genotypes A and D are prevalent in Western Europe and North America, whereas genotypes B and C are prevalent in Eastern Asia and Oceania.

[0211] In some embodiments, the target site is at least 70% homologous to all hepatitis B virus genotypes (e.g., genomes). In some embodiments, the target site is at least 70% homologous to at least 500, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000 hepatitis B virus genomes.

[0212] In some embodiments, the target site is at least 70% homologous to at least 1000 hepatitis B virus genomes and contains no more than two mismatches. In some embodiments, the target site comprises a sequence as shown in any one of SEQ ID NO: 1-195, a continuous portion of at least 14 nucleotides (nt) of any one of SEQ ID NO: 1-195, or a complementary sequence of any one of the foregoing. In some embodiments, the target site is a continuous portion of 15, 16, 17, 18 or 19 nucleotides in length of any one of SEQ ID NO: 1-195 or a complementary sequence of any one of the foregoing. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity with all or a continuous portion of the target site sequence described above. In some embodiments, the target site is the sequence set forth in any one of SEQ ID NOs: 1-195.

[0213] In some of any embodiments, the target site is a sequence of 14 to 22 nucleotides. In some of any embodiments, the target site is a sequence of 14 to 19 nucleotides. In some of any embodiments, the target site is a sequence of 14 nucleotides. In some of any embodiments, the target site is a sequence of 15 nucleotides. In some of any embodiments, the target site is a sequence of 16 nucleotides. In some of any embodiments, the target site is a sequence of 17 nucleotides. In some of any embodiments, the target site is a sequence of 18 nucleotides. In some of any embodiments, the target site is a sequence of 19 nucleotides.

[0214] In any of the embodiments provided herein, the target site is complementary to a reference sequence (ie, a specific sequence shown as SEQ ID NO in the reference sequence listing). In some of any of the embodiments, the complementary sequence is the reverse complement of the reference sequence.

[0215] In any of the embodiments provided herein, the target site comprises a reference sequence (i.e., a specific sequence as set forth in a SEQ ID NO in a reference sequence listing). In any of the embodiments provided herein, the target site is a sequence set forth in a reference sequence (i.e., a specific sequence as set forth in a SEQ ID NO in a reference sequence listing).

[0216] In any of the embodiments provided herein, the target site is a continuous portion of at least 14 nucleotides (14 nt) of a reference sequence (i.e., a specific sequence set forth as SEQ ID NO in a reference sequence listing). In some embodiments, the continuous portion is 15 nucleotides. In some embodiments, the continuous portion is 16 nucleotides. In some embodiments, the continuous portion is 17 nucleotides. In some embodiments, the continuous portion is 18 nucleotides. In some embodiments, the continuous portion is 19 nucleotides.

[0217] In some embodiments, the target site is at least 90% homologous to all hepatitis B virus genomes. In some embodiments, the target site is at least 90% homologous to:

[0218] At least 500, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000 Hepatitis B virus genomes.

[0219] In some embodiments, the target site is at least 90% homologous to at least 1000 hepatitis B virus genomes and contains one or two mismatches. In some embodiments, the target site comprises a sequence as shown in any one of SEQ ID NOs: 35-100, a continuous portion of at least 14 nt of any one of SEQ ID NOs: 35-100, or a complementary sequence of any one of the foregoing. In some embodiments, the target site is a continuous portion of 15, 16, 17, 18 or 19 nucleotides in length of any one of SEQ ID NOs: 35-100 or a complementary sequence of any one of the foregoing. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity with all or a continuous portion of the target site sequence described above. In some embodiments, the target site is the sequence set forth in any one of SEQ ID NOs: 35-100.

[0220] In some embodiments, the mismatch is positioned within the first 12 nt of the 5' end of the protospacer adjacent motif (PAM), as indicated by the 'n' in 'nnnnnnnnnnnnNNNNNNNN-NGG'.

[0221] In some embodiments, the target site is at least 90% homologous to at least 1000 hepatitis B virus genomes and contains zero mismatches. In some embodiments, the target site comprises a sequence as shown in any one of SEQ ID NOs: 1-34, a continuous portion of at least 14 nt of any one of SEQ ID NOs: 1-34, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of 15, 16, 17, 18 or 19 nucleotides in length of any one of SEQ ID NOs: 1-34 or a complementary sequence of any one of the foregoing. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity with all or a continuous portion of the target site sequence described above. In some embodiments, the target site is a sequence as shown in any one of SEQ ID NOs: 1-34.

[0222] In any of the embodiments herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 175, 138, 192, 152, 118, 125, 185, 63, 116, 124, 35, 82, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence to any of the foregoing. In some embodiments, the target site is a contiguous portion of 15, 16, 17, 18, or 19 nucleotides in length of any one of SEQ ID NOs: 175, 138, 192, 152, 118, 125, 185, 63, 116, 124, 35, 82, or a complementary sequence to any of the foregoing. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or a contiguous portion of a target site sequence as described above. In some embodiments, the target site is a sequence set forth in any one of SEQ ID NOs: 175, 138, 192, 152, 118, 125, 185, 63, 116, 124, 35, 82. In some embodiments, the decrease in gene expression or the change in transcript level in a cell is greater than 90% compared to the gene level in a control cell.

[0223] In any of the embodiments herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NO: 5, 10, 12, 18, 22, 26, 29, 38, 56, 61, 62, 63, 68, 72, 79, 80, 82, 84, 98, 99, 116, 118, 121, 124, 125, 135, 138, 143, 150, 152, 158, 164, 175, 176, 182, 185, 189, 190, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a contiguous portion of any of SEQ ID NO: 5, 10, 12, 18, 22, 26, 29, 38, 56, 61, 62, 63, 68, 72, 75, 79, 80, 82, 84, 98, 99, 116, 118, 121, 124, 125, 135, 138, 143, 150, 152, 158, 164, 175, 176, 182, 185, 189, 190, 192, or the complement of any of the foregoing. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or a contiguous portion of a target site sequence as described above. In some embodiments, the target site is a sequence set forth in any one of SEQ ID NO: 5, 10, 12, 18, 22, 26, 29, 38, 56, 61, 62, 63, 68, 72, 75, 79, 80, 82, 84, 98, 99, 116, 118, 121, 124, 125, 135, 138, 143, 150, 152, 158, 164, 175, 176, 182, 185, 189, 190 or 192. In some embodiments, the reduction in gene expression or the change in transcript levels in a cell is greater than 80% compared to the level of the gene in a control cell.

[0224] In any of the embodiments herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NO: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. In some embodiments, the target site is a contiguous portion of any one of SEQ ID NO: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192, or the complement of any of the foregoing. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or a contiguous portion of a target site sequence described above. In some embodiments, the target site is a sequence set forth in any one of SEQ ID NO: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, or 192. In some embodiments, the decrease in gene expression or the change in transcript levels in the cell is greater than 75% compared to the level of the gene in a control cell.

[0225] In any of the embodiments herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 22, 63, 75, 99, 116, 124, 138, 143, 150, 152, 175, 176, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence to any of the foregoing. In some embodiments, the target site comprises a sequence of SEQ ID NOs: 22, 63, 75, 99, 116, 124, 138, 143, 150, 152, 175, 176, 192, or a complementary sequence to any of the foregoing, that is 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or a contiguous portion of a target site sequence as described above. In some embodiments, the target site is a sequence set forth in any one of SEQ ID NOs: 22, 63, 75, 99, 116, 124, 138, 143, 150, 152, 175, 176 or 192.

[0226] In any of the embodiments herein, the target site or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence to any of the foregoing. In some embodiments, the target site is a contiguous portion of 15, 16, 17, 18, or 19 nucleotides in length of any one of SEQ ID NOs: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192, or a complementary sequence to any of the foregoing. In some embodiments, the target site is a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or a contiguous portion of a target site sequence as described above. In some embodiments, the target site is a sequence set forth in any one of SEQ ID NOs: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185 or 192.

[0227] In some embodiments, the target site or each of the target sites comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 1028-1055, a contiguous portion of at least 12 nt thereof, or a complementary sequence to any of the foregoing. In some embodiments, the target site is a contiguous portion of 13, 14, 16, 16, 17, or 18 nucleotides in length of any one of SEQ ID NOs: 1028-1055, or a complementary sequence to any of the foregoing. In some embodiments, the target site is a sequence as set forth in any one of SEQ ID NOs: 1028-1055.

[0228] In some embodiments, the target site or each of the target sites comprises a sequence as shown in SEQ ID NO: 22, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a continuous portion of 14-19 nucleotides (nt) in length of the sequence as shown in SEQ ID NO: 22, or a complementary sequence of the foregoing. In some embodiments, the target site is a sequence as shown in SEQ ID NO: 22. In some embodiments, the target site can be targeted by a DNA targeting system provided herein. In some embodiments, the DNA binding domain is dCas9, which is dSpCas9, and is used in combination with a complementary gRNA to target the target site. In some embodiments, the gRNA has a spacer sequence as shown in SEQ ID NO: 217, or a continuous portion thereof that is complementary to the target site. In some embodiments, the gRNA further comprises a scaffold sequence of the dSpCas9 as shown in SEQ ID NO: 587. In some embodiments, the DNA targeting system comprises a dSpCas9 fusion protein having an effector domain as described herein and a gRNA as shown in SEQ ID NO: 22 (e.g., HBVg_22).

[0229] In some embodiments, the target site or each of the target sites comprises a sequence as shown in SEQ ID NO: 63, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a continuous portion of 14-20 nucleotides (nt) in length of the sequence as shown in SEQ ID NO: 63, or a complementary sequence of the foregoing. In some embodiments, the target site is a sequence as shown in SEQ ID NO: 63. In some embodiments, the target site can be targeted by a DNA targeting system provided herein. In some embodiments, the DNA binding domain is dCas9, which is dSpCas9, and is used in combination with a complementary gRNA to target the target site. In some embodiments, the gRNA has a spacer sequence as shown in SEQ ID NO: 217, or a continuous portion thereof that is complementary to the target site. In some embodiments, the gRNA further comprises a scaffold sequence of SpCas9 as shown in SEQ ID NO: 587. In some embodiments, the DNA targeting system comprises a dSpCas9 fusion protein with an effector domain as described herein and a gRNA as shown in SEQ ID NO: 63 (e.g., HBVg_63).

[0230] In any embodiment herein, the target site or each of the target sites comprises the sequence set forth in SEQ ID NO: 1045, a contiguous portion of at least 12 nucleotides (nt) thereof, or the complementary sequence of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a contiguous portion of 12-18 nucleotides (nt) in length of the sequence set forth in SEQ ID NO: 1045, or the complementary sequence of the foregoing. In some embodiments, the target site is the sequence set forth in SEQ ID NO: 1045. In some embodiments, the DNA binding domain is an eZFP for targeting the target site. In some embodiments, the ZFP comprises the recognition motifs set forth in SEQ ID NO: 822, 823, 824, 825, 826, and 827. In some embodiments, the eZFP has the sequence set forth in SEQ ID NO: 709. In some embodiments, the eZFP is an eZFP designated as eZFP_18.

[0231] In any embodiment herein, the target site or each of the target sites comprises the sequence set forth in SEQ ID NO: 1046, a contiguous portion of at least 12 nucleotides (nt) thereof, or the complementary sequence of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a contiguous portion of 12-18 nucleotides (nt) in length of the sequence set forth in SEQ ID NO: 1046, or the complementary sequence of the foregoing. In some embodiments, the target site is the sequence set forth in SEQ ID NO: 1046. In some embodiments, the DNA binding domain is an eZFP that targets the target site. In some embodiments, the ZFP comprises the recognition motif set forth in SEQ ID NO: 828, 829, 830, 831, 832, and 833. In some embodiments, the eZFP has the sequence set forth in SEQ ID NO: 710. In some embodiments, the eZFP is the eZFP designated as eZFP_19.

[0232] In any embodiment herein, the target site or each of the target sites comprises the sequence set forth in SEQ ID NO: 1052, a contiguous portion of at least 12 nucleotides (nt) thereof, or the complementary sequence of the foregoing. In any embodiment herein, the target site or each of the target sites comprises a contiguous portion of 12-18 nucleotides (nt) in length of the sequence set forth in SEQ ID NO: 1052, or the complementary sequence of the foregoing. In some embodiments, the target site is the sequence set forth in SEQ ID NO: 1052. In some embodiments, the DNA binding domain is an eZFP for targeting the target site. In some embodiments, the ZFP comprises the recognition motif set forth in SEQ ID NO: 864, 865, 866, 867, 868, and 869. In some embodiments, the eZFP has the sequence set forth in SEQ ID NO: 716. In some embodiments, the eZFP is an eZFP designated as eZFP_25.

[0233] In some embodiments, the target site is present in covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA) and / or integrated in human genomic DNA. In some embodiments, the targeted target site results in silencing of HBV replication (e.g., reduced HBV replication) and / or HBV transcription.

[0234] In some embodiments, provided herein are multiplex epigenetic modification DNA targeting systems that target a combination of at least two target genes or their regulatory DNA elements as described herein. In some embodiments, multiplex epigenetic modification DNA targeting systems target two, three, four, five, six or more target genes or their regulatory DNA elements as described herein.

[0235] In some embodiments, in the multiple epigenetic modification DNA targeting system provided, each target site is in a different HBV gene. In some embodiments, each target site is in the same HBV gene.

[0236] In some embodiments, provided herein are multiplex epigenetic modification DNA targeting systems that target any combination of genes and / or their regulatory elements described herein.

[0237] In some embodiments, provided herein are multiple epigenetic modification DNA targeting systems that target a first gene or its regulatory element and a second gene or its regulatory element. In some embodiments, the first gene or its regulatory element is selected from the group consisting of polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions, and any coding regions within the HBV genome, and the second gene or its regulatory element is selected from the group consisting of polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions, and any coding regions within the HBV genome, and the first gene or its regulatory element is different from the second gene or its regulatory element. The first target site and the second target site can be any target site as described above.

[0238] In some embodiments, provided herein are multiple epigenetic modification DNA targeting systems targeting a first regulatory element and a second regulatory element. In some embodiments, the first regulatory element and the second regulatory element are selected from the combinations listed in Table 1. Table 1. Combinations of first and second regulatory elements targeted by the multiplex epigenetic modification DNA targeting system provided herein. First regulating element Second regulatory element L-HBs promoter M-HBs promoter L-HBs promoter S-HBs promoter L-HBs promoter X promoter / Enhl promoter L-HBs promoter Basic core promoter / Enh2 enhancer M-HBs promoter S-HBs promoter M-HBs promoter X promoter / Enhl promoter M-HBs promoter Basic core promoter / Enh2 enhancer S-HBs promoter X promoter / Enhl promoter S-HBs promoter Basic core promoter / Enh2 enhancer X promoter / Enh1 promoter Basic core promoter / Enh2 enhancer

[0239] In some embodiments, provided herein are multiplex epigenetic modification DNA targeting systems that target a first gene or its regulatory element, a second gene or its regulatory element, and a third gene or its regulatory element. In some embodiments, the first gene or its regulatory element is selected from the group consisting of a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, a transcript processing control region, and any coding region within the HBV genome; the second gene or its regulatory element is selected from the group consisting of a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, a transcript processing control region, and any coding region within the HBV genome; the third gene or its regulatory element is selected from the group consisting of a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, and a transcript processing control region; and the first gene or its regulatory element, the second gene or its regulatory element, and the third gene or its regulatory element are different from each other. The first target site, the second target site, and the third target site can be any target site as described above.

[0240] In some embodiments, provided herein are multiple epigenetic modification DNA targeting systems that target a first regulatory element, a second regulatory element, and a third regulatory element. In some embodiments, the first regulatory element is selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, Enh1 enhancer, and Enh2 enhancer, the second regulatory element is selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, Enh1 enhancer, and Enh2 enhancer, the third regulatory element is selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, Enh1 enhancer, and Enh2 enhancer, and the first regulatory element, the second regulatory element, and the third regulatory element are different. In some embodiments, the first regulatory element is the Enh1 enhancer, the second regulatory element is selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, and Enh2 enhancer, and the third regulatory element is selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, and Enh2 enhancer, and the second regulatory element and the third regulatory element are different. In some embodiments, the first regulatory element is the Enh1 enhancer, the second regulatory element is L-HBs, and the third regulatory element is selected from the group consisting of M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, and Enh2 enhancer.

[0241] In some embodiments, the first regulatory element, the second regulatory element, and the third regulatory element are selected from the combination listed in Table 2. Table 2. Combinations of first, second, and third regulatory elements targeted by the multiplex epigenetic modification DNA targeting system provided herein. First regulating element Second regulatory element The third regulatory element L-HBs promoter M-HBs promoter S-HBs promoter L-HBs promoter M-HBs promoter X promoter / Enh1 promoter L-HBs promoter M-HBs promoter Basic core promoter / Enh2 enhancer L-HBs promoter S-HBs promoter X promoter / Enh1 promoter L-HBs promoter S-HBs promoter Basic core promoter / Enh2 enhancer L-HBs promoter X promoter / Enh1 promoter Basic core promoter / Enh2 enhancer M-HBs promoter S-HBs promoter X promoter / Enh1 promoter M-HBs promoter S-HBs promoter Basic core promoter / Enh2 enhancer M-HBs promoter X promoter / Enh1 promoter Basic core promoter / Enh2 enhancer S-HBs promoter X promoter / Enh1 promoter Basic core promoter / Enh2 enhancer

[0242] In some embodiments, provided herein are multiple epigenetic modification DNA targeting systems that target a first gene or its regulatory element, a second gene or its regulatory element, a third gene or its regulatory element, and a fourth gene or its regulatory element. In some embodiments, the first gene or its regulatory element is selected from the group consisting of polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions, and any coding regions within the HBV genome; the second gene or its regulatory element is selected from the group consisting of polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions, and any coding regions within the HBV genome; the third gene or its regulatory element is selected from the group consisting of polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions, and any coding regions within the HBV genome; The element is selected from the group consisting of a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, and a transcript processing control region; the fourth gene or its regulatory element is selected from the group consisting of a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, and a transcript processing control region; and the first gene or its regulatory element, the second gene or its regulatory element, the third gene or its regulatory element, and the fourth gene or its regulatory element are different from each other. The first target site, the second target site, the third target site, and the fourth target site can be any target site as described above.

[0243] In some embodiments, provided herein are multiple epigenetic modification DNA targeting systems targeting the same gene or its regulatory elements. For example, two or more multiple epigenetic modification DNA targeting systems target the same or common gene or its regulatory elements. In some embodiments, the gene or its regulatory elements are selected from polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions and any coding regions within the HBV genome, and the second gene or its regulatory elements are selected from polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions and any coding regions within the HBV genome. In some embodiments, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, or at least 30 multiplex epigenetic modification DNA targeting systems target the same gene or its regulatory element.

[0244] In some embodiments, the target site for multiplex editing (e.g., by a multiplex epigenetic modification DNA targeting system described herein) is a sequence set forth in any one of SEQ ID NOs: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, and 192. In some embodiments, the target site for multiplex editing (e.g., by a multiplex epigenetic modification DNA targeting system described herein) is a sequence set forth in SEQ ID NO: 22. The target site can be any target site as described above. B. CRISPR-based DNA targeting system

[0245] Provided herein are epigenetic DNA targeting systems based on CRISPR / Cas systems, i.e., CRISPR / Cas-based DNA targeting systems capable of binding to target sites in target genes or their regulatory elements. In some embodiments, the epigenetic DNA targeting systems provided are multiplex epigenetic DNA targeting systems based on CRISPR / Cas systems, i.e., CRISPR / Cas-based DNA targeting systems capable of targeting target sites in a combination of target genes or their regulatory elements.

[0246] In some embodiments, the CRISPR / Cas DNA binding domain is nuclease-free, such as including dCas (e.g., dCas9), so that the system binds to the target site in the target gene or its regulatory element without mediating nucleic acid cleavage at the target site. In some embodiments, the DNA targeting system does not introduce gene disruption or DNA breakage. The DNA targeting system based on CRISPR / Cas can be used to regulate the expression of target genes in cells (such as hepatocytes). In some embodiments, the target gene or its regulatory element may include any target gene or its regulatory element as described herein, including any target gene or its regulatory element described in Section 1A above. In some embodiments, the target site of the target gene or its regulatory element may include any target site as described herein, including any target site described in Section 1A above. In some embodiments, the DNA targeting system based on CRISPR / Cas may include any known Cas enzyme, and is typically nuclease-free or dCas. In some embodiments, the DNA targeting system based on CRISPR / Cas includes: a fusion protein of a Cas protein or its variant without nuclease activity and an effector domain (e.g., a transcriptional repressor) that reduces gene transcription, and at least one gRNA.

[0247] The CRISPR system (also known as the CRISPR / Cas system or the CRISPR-Cas system) refers to a conserved microbial nuclease system found in bacterial and archaeal genomes that provides a form of acquired immunity against invading phages and plasmids. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) refers to a locus containing multiple repetitive DNA elements separated by non-repetitive DNA sequences called spacers. Spacers are short sequences of foreign DNA incorporated between CRISPR repeat sequences in the genome as a "memory" of past exposures. The spacer encodes the DNA targeting portion of the RNA molecule that confers specificity to the CRISPR system for nucleic acid cutting. The CRISPR locus contains or is adjacent to: one or more CRISPR-associated (Cas) genes, which can act as an RNA-guided nuclease-mediated cutting; and non-protein-coding DNA elements that encode RNA molecules capable of programming CRISPR-mediated nucleic acid cutting specificity.

[0248] In the type II CRISPR / Cas system with the Cas protein Cas9, two RNA molecules and the Cas9 protein form a ribonucleoprotein (RNP) complex to guide the Cas9 nuclease activity. CRISPR RNA (crRNA) contains a spacer sequence that is complementary to the target nucleic acid sequence (target site) and encodes the sequence specificity of the complex. The transactivating crRNA (tracrRNA) base pairs with a portion of the crRNA and forms a structure complexed with the Cas9 protein, thereby forming a Cas / RNA RNP complex.

[0249] Naturally occurring CRISPR / Cas systems, such as systems with Cas9, have been engineered to allow efficient programming of Cas / RNA RNP to target the desired sequence in the cell of interest for use in gene editing and regulating gene expression. TracrRNA and crRNA have been engineered to form a single chimeric guide RNA molecule, commonly referred to as guide RNA (gRNA), such as described in WO 2013 / 176772A1, WO 2014 / 093661A2, WO 2014 / 093655A2, Jinek, M. et al. Science 337(6096):816-21(2012) or Cong, L. et al. Science 339(6121):819-23(2013). The spacer sequence of gRNA can be selected by the user to target Cas / gRNA RNP complex to the desired locus, such as the desired target site in the target gene and / or its regulatory element.

[0250] Cas protein is also engineered to allow targeting of Cas / gRNA RNP without inducing cutting at the target site. Mutations in Cas protein can reduce or eliminate the nuclease activity of Cas protein, thereby causing Cas protein to lose catalytic activity. Cas protein with reduced or eliminated nuclease activity is referred to as inactivated Cas (dCas) or Cas (iCas) protein without nuclease activity, which are referred to interchangeably herein. Exemplary inactivated Cas9 (dCas9) derived from Streptococcus pyogenes contains silent mutations (D10A and H840A) of RuvC and HNH nuclease domains, such as described in WO 2013 / 176772A1, WO 2014 / 093661A2, Jinek, M. et al. Science 337(6096):816-21(2012) and Qi, L. et al. Cell 152(5):1173-83(2013). Exemplary dCas variants derived from the Cas12 system (i.e., Cpf1) are described in, for example, WO 2017 / 189308A1 and Zetsche, B. et al. Cell 163(3):759-71(2015). Conserved domains that mediate nucleic acid cleavage, such as RuvC and HNH endonuclease domains, are readily identified in Cas orthologs and can be mutated to generate inactive variants, for example, as described in Zetsche, B. et al. Cell 163(3):759-71(2015).

[0251] dCas fusion proteins with transcriptional and / or epigenetic regulators have been used as a versatile platform for ectopic regulation of gene expression in target cells. These include fusions of Cas with effector domains, such as transcriptional activators or transcriptional repressors. For example, fusion of dCas9 with transcriptional activators (such as VP64, a polypeptide consisting of four tandem copies of VP16, VP16 is a 16-amino acid transcriptional activation domain of herpes simplex virus) can result in robust induction of gene expression. Alternatively, fusion of dCas9 with transcriptional repressors (such as KRAB (Krüppel associated box)) can result in robust repression of gene expression. Various dCas fusion proteins with transcriptional and epigenetic regulators can be engineered for regulating gene expression, for example as described in WO 2014 / 197748, WO 2016 / 130600, WO 2017 / 180915, WO 2021 / 226555, WO 2013 / 176772, WO 2014 / 152432, WO 2014 / 093661, WO 2021 / 247570, Adli, M. Nat. Commun. 9, 1911 (2018), Perez-Pinera, P. et al. Nat. Methods 10, 973-976 (2013), Mali, P. et al. Nat. Biotechnol. 31, 833-838 (2013), Maeder, ML et al. Nat. Methods 10, 977-979 (2013), Gilbert, LA et al. Cell 154(2): 442-451 (2013) and JK et al. Cell 184(9):2503-2519(2021).

[0252] In some aspects, a DNA targeting system is provided, the DNA targeting system comprising a fusion protein, the fusion protein comprising a DNA binding domain and an effector domain, the DNA binding domain comprising a Cas protein or its variant without nuclease activity, the effector domain being used to reduce transcription or induce transcriptional repression (i.e., transcriptional repressor) when targeting a target gene or its regulatory element in a targeting cell (e.g., a hepatocyte). In such embodiments, the DNA targeting system further comprises one or more gRNAs, which are provided in combination with dCas proteins or their variants or provided as a complex for targeting the DNA targeting system to a target gene or its regulatory element. In some embodiments, the fusion protein is guided to the specific target site sequence of the target gene or its regulatory element by a guide RNA, wherein the effector domain mediates targeting epigenetic modification to reduce or repress the transcription of the target gene. In some embodiments, the combination of gRNA guides the fusion protein to a combination of target site sequences in a combination of a gene or its regulatory element, wherein the effector domain mediates targeting epigenetic modification to reduce or repress the transcription of a combination of target genes. As further described below, any of the various effector domains for reducing or repressing transcription can be used. 1. CRISPR-based DNA binding domain

[0253] In some aspects, the DNA binding domain comprises a CRISPR-associated (Cas) protein or a variant thereof, or is derived from a Cas protein or a variant thereof, and is nuclease-inactive (i.e., it is a dCas protein).

[0254] In some embodiments, the Cas protein is derived from a Class 1 CRISPR system (i.e., a multi-Cas protein system), such as a Type I, Type III, or Type IV CRISPR system. In some embodiments, the Cas protein is derived from a Class 2 CRISPR system (i.e., a single Cas protein system), such as a Type II, Type V, or Type VI CRISPR system. In some embodiments, the Cas protein is from a Type V CRISPR system. In some embodiments, the Cas protein is derived from a Cas12 protein (i.e., Cpf1) or a variant thereof, such as described in WO 2017 / 189308A1 and Zetsche, B. et al. Cell. 163(3):759-71(2015). In some embodiments, the Cas protein is derived from a Type II CRISPR system. In some embodiments, the Cas protein is derived from a Cas9 protein or a variant thereof, e.g., as described in WO 2013 / 176772A1, WO 2014 / 152432A2, WO 2014 / 093661A2, WO 2014 / 093655A2, Jinek, M. et al. Science 337(6096):816-21 (2012), Mali, P. et al. Science 339(6121):823-6 (2013), Cong, L. et al. Science 339(6121):819-23 (2013), Perez-Pinera, P. et al. Nat. Methods 10, 973-976 (2013), or Mali, P. et al. Nat. Biotechnol. 31, 833-838 (2013). Various CRISPR / Cas systems and related Cas proteins for use in gene editing and regulation have been described, for example, in Moon, SB et al. Exp. Mol. Med. 51, 1-11 (2019), Zhang, FQ Rev. Biophys. 52, E6 (2019), and Makarova KS et al. Methods Mol. Biol. 1311:47-75 (2015).

[0255] In some embodiments, the dCas9 protein may include a sequence derived from a naturally occurring Cas9 molecule or a variant thereof. In some embodiments, the dCas9 protein may include a sequence derived from a naturally occurring Cas9 molecule or a variant thereof, and the naturally occurring Cas9 molecule is from Streptococcus pyogenes (S.pyogenes), Streptococcus thermophilus (S.thermophilus), Staphylococcus aureus (S.aureus), Campylobacter jejuni (C.jejuni), Neisseria meningitidis (N.meningitidis), Francisella novicida (F.novicida), Streptococcus canis (S.canis), Staphylococcus auricularis (S.auricularis). In some embodiments, the dCas9 protein includes a sequence derived from a naturally occurring Staphylococcus aureus Cas9 molecule. In some embodiments, the dCas9 protein includes a sequence derived from a naturally occurring Streptococcus pyogenes Cas9 molecule.

[0256] Non-limiting examples of Cas9 orthologs from other bacterial strains include, but are not limited to, Cas proteins identified in: Acaryochloris marina MBIC11017; Acetohalobium arabaticum DSM 5501; Acidithiobacillus caldus; Acidithiobacillus ferrooxidans ATCC 23270; Alicyclobacillus acidocaldarius LAA1; Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446; Allochromatium vinosum DSM 180; Ammonifex degensii KC4; Anabaena variabilis ATCC 29413; Arthrospira maxima CS-328; Arthrospira platensis Paraca strain; Arthrospira sp. PCC 8005; Bacillus pseudomycoides DSM 12442; Bacillus selenitireducens MLS10; Burkholderiales bacteria 1_1_47; Caldicelulosiruptor becscii DSM 6725; Candidatus Desulforudis audaxviator MP104C; Caldicellulosiruptor hydrothermalis 108; Clostridium phage c-st; Clostridium botulinum A3 Loch Maree strain; Clostridium botulinum Ba4657; Clostridium difficile QCD-63q42; Crocosphaera watsonii WH 8501; Cyanothece sp.) ATCC 51142; Cyanobacterium sp. CCY0110; Cyanobacterium sp. PCC 7424; Cyanobacterium sp. PCC 7822; Exiguobacterium sibiricum 255-15; Finegoldia magna ATCC 29328; Ktedonobacter racemifer DSM 44963; Lactobacillus delbrueckii subsp. bulgaricus PB2003 / 044-T3-4; Lactobacillus salivarius ATCC 11741; Listeria innocua; Lyngbya sp. PCC 8106; Marinobacter sp.) ELB17; Methanohalobium evestigatum Z-7303; Microcystis phage Ma-LMM01; Microcystis aeruginosa NIES-843; Microscilla marina ATCC 23134; Microcoleus chthonoplastes PCC 7420; Neisseria meningitidis; Nitrosococcus halophilus Nc4; Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111; Nodularia sp. umigena CCY9414; Nostoc sp. PCC 7120; Oscillatori sp. PCC 6506; Pelotomaculum_thermopropionicum SI; Petrotoga mobilis SJ95; Polaromonas naphthalenivorans CJ2; Polaromonas sp.)JS666; Pseudoalteromonas haloplanktis TAC125; Streptomyces pristinaespiralis ATCC 25486; Streptomyces thermophilus; Streptomyces viridochromogenes DSM 40736; Streptosporangium roseum DSM 43021; Synechococcus sp. PCC 7335; and Thermosiphoafricanus TCF52B (Chylinski et al., RNA Biol., 2013; 10(5):726-737).

[0257] In some aspects, the Cas protein is a variant lacking nuclease activity (i.e., a dCas protein). In some embodiments, the Cas protein mutates so that the nuclease activity is reduced or eliminated. Such Cas proteins are interchangeably referred to herein as inactivated Cas or inactive Cas (dCas) or Cas (iCas) proteins without nuclease activity. In some embodiments, the variant Cas protein is a variant Cas9 protein lacking nuclease activity or as an inactivated Cas9 (dCas9 or iCas9) protein.

[0258] In some embodiments, the Cas9 protein or variant thereof is derived from a Staphylococcus aureus Cas9 (SaCas9) protein or a variant thereof. In some embodiments, the variant Cas9 is a Staphylococcus aureus dCas9 protein (dSaCas9) comprising at least one amino acid mutation selected from D10A and N580A, with reference to the numbering of positions in SEQ ID NO: 596. In some embodiments, the variant Cas9 protein comprises the sequence set forth in SEQ ID NO: 597, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0259] In some embodiments, the Cas9 protein or variant thereof is derived from a Streptococcus pyogenes Cas9 (SpCas9) protein or a variant thereof. In some embodiments, the variant Cas9 is a Streptococcus pyogenes dCas9 (dSpCas9) protein comprising at least one amino acid mutation selected from D10A and H840A, with reference to the numbering of positions of SEQ ID NO: 598. In some embodiments, the variant Cas9 protein comprises the sequence set forth in SEQ ID NO: 599, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. 2. Guide RNA

[0260] In some embodiments, Cas protein (e.g., dCas9) is provided in combination with one or more guide RNAs (gRNAs) or as a complex. In some aspects, gRNA is a nucleic acid that promotes specific targeting or homing of the gRNA / Cas RNP complex to the target site (such as any of those described above) of a target gene and / or its regulatory element. In some embodiments, the target site of gRNA can be referred to as a protospacer.

[0261] Provided herein are gRNAs such as gRNAs that target or bind to a target site or its DNA regulatory element (such as any of those described in Section 1A above). In some embodiments, the gRNA is capable of compounding with a Cas protein or a variant thereof. In some embodiments, the gRNA comprises a gRNA spacer sequence (i.e., a spacer sequence or a guide sequence) that is capable of hybridizing with a target site or is complementary to a target site, such as Section 1A or any target site further described below. In some embodiments, the gRNA comprises a scaffold sequence that is compounded or bound to a Cas protein.

[0262] In some embodiments, gRNA provided herein is chimeric gRNA.Generally, gRNA can be unimolecular (i.e., composed of a single RNA molecule) or modular (comprising more than one, and generally two independent RNA molecules). Modular gRNA can be engineered to be unimolecular, wherein the sequence from an independent modular RNA molecule is included in a single gRNA molecule, sometimes referred to as a chimeric gRNA, a synthetic gRNA, or a single gRNA. In some embodiments, chimeric gRNA is a fusion of two non-coding RNA sequences, i.e., a crRNA sequence and a tracrRNA sequence, such as described in WO 2013 / 176772A1 or Jinek, M. et al. Science 337(6096):816-21(2012). In some embodiments, chimeric gRNA simulates the naturally occurring crRNA involved in type II effector systems: tracrRNA duplexes, wherein naturally occurring crRNA: tracrRNA duplexes serve as guides for Cas9 protein.

[0263] In some aspects, the spacer sequence of a gRNA is a polynucleotide sequence comprising at least a portion thereof having sufficient complementarity to a target site or its DNA regulatory element (e.g., any of those described in Section IA) to hybridize with the target site in the target gene and / or its regulatory element and guide sequence-specific binding of the CRISPR complex to the target site. Complete complementarity is not necessarily required if there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex. In some embodiments, the gRNA comprises a spacer sequence that is, for example, at least 80%, 85%, 90%, 95%, 98%, 99% or 100% complementary (e.g., completely complementary) to the target site. The chain of the target nucleic acid comprising the target site sequence may be referred to as the "complementary chain" of the target nucleic acid.

[0264] In some embodiments, the length of the gRNA spacer sequence is between about 14 nucleotides (nt) and about 26nt, or between 16nt and 22nt. In some embodiments, the length of the gRNA spacer sequence is 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt or 22nt, 23nt, 24nt, 25nt or 26nt. In some embodiments, the length of the gRNA spacer sequence is 18nt, 19nt, 20nt, 21nt or 22nt. In some embodiments, the length of the gRNA spacer sequence is 19nt.

[0265] The target site of gRNA can be referred to as a protospacer. In some aspects, the spacer is designed to target a protospacer with a specific protospacer adjacent motif (PAM), the protospacer adjacent motif being the sequence next to the protospacer, which facilitates Cas binding specificity and / or is necessary for Cas binding specificity. Different CRISPR / Cas systems have different PAM requirements for targeting. For example, in some embodiments, Streptococcus pyogenes Cas9 uses PAM 5'-NGG-3' (SEQ ID NO: 629), wherein N is any nucleotide. Staphylococcus aureus Cas9 uses PAM 5'-NNGRRT-3' (SEQ ID NO: 630), wherein N is any nucleotide, and R is G or A. Neisseria meningitidis Cas9 uses PAM 5'-NNNNGATT-3' (SEQ ID NO: 631), wherein N is any nucleotide. jejuni Cas9 uses PAM 5'-NNNNRYAC-3' (SEQ ID NO: 632), wherein N is any nucleotide, R is G or A, and Y is C or T. Streptococcus thermophilus uses PAM 5'-NNAGAAW-3' (SEQ ID NO: 633), wherein N is any nucleotide, and W is A or T. Francisella novicida Cas9 uses PAM 5'-NGG-3' (SEQ ID NO: 634), wherein N is any nucleotide. Treponema denticola Cas9 uses PAM 5'-NAAAAC-3' (SEQ ID NO: 635), wherein N is any nucleotide. Cas12a (also known as Cpf1) from various species uses PAM 5'-TTTV-3' (SEQ ID NO: 636). Cas proteins can use or be engineered to use PAMs different from those listed above. For example, the mutant SpCas9 protein can use PAM 5'-NGG-3' (SEQ ID NO: 629), 5'-NGAN-3' (SEQ ID NO: 637), 5'-NGNG-3' (SEQ ID NO: 638), 5'-NGAG-3' (SEQ ID NO: 639), or 5'-NGCG-3' (SEQ ID NO: 640). In some embodiments, the protospacer for the gRNA complexed with S. pyogenes Cas9 or a variant thereof is shown in SEQ ID NO: 588. In some embodiments, the protospacer for the gRNA complexed with S. aureus Cas9 or a variant thereof is shown in SEQ ID NO: 589.

[0266] The spacer sequence may be selected to reduce the degree of secondary structure within the spacer sequence.Secondary structure may be determined by any suitable polynucleotide folding algorithm.

[0267] In some embodiments, gRNA (including guide sequence) will contain the base uracil (U), and the DNA encoding the gRNA molecule will contain the base thymine (T). Although not wishing to be bound by theory, in some embodiments, it is believed that the complementarity of the guide sequence to the target sequence contributes to the specificity of the interaction of the gRNA molecule / Cas molecule complex with the target nucleic acid. It should be understood that in the guide sequence and target sequence pair, the uracil base in the guide sequence will be paired with the adenine base in the target sequence.

[0268] In some embodiments, one, more than one, or all nucleotides of a gRNA may be modified, for example, to make the gRNA less susceptible to degradation and / or to improve biocompatibility. As non-limiting examples, the backbone of a gRNA may be modified with phosphorothioate or one or more other modifications. In some cases, the nucleotides of a gRNA may comprise a 2' modification, such as a 2-acetylation, such as a 2' methylation, or one or more other modifications.

[0269] Methods of designing gRNAs and exemplary targeting domains can include, for example, those described in International PCT Publication Nos. WO 2014 / 197748A2, WO 2016 / 130600A2, WO 2017 / 180915A2, WO 2021 / 226555A2, WO 2013 / 176772A1, WO 2014 / 152432A2, WO 2014 / 093661A2, WO 2014 / 093655A2, WO 2015 / 089427A1, WO 2016 / 049258A2, WO 2016 / 123578A1, WO 2021 / 076744A1, WO 2014 / 191128A1, WO 2015 / 161276A2, WO 2017 / 193107A2 and WO 2017 / 093969A1.

[0270] In some embodiments, provided herein is gRNA targeting present in the target site in covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA).In some respects, target site can be any HBV genomic sequence that is best suited for setting up DNA methylation, and the DNA methylation causes the silencing of HBV RNA transcription.

[0271] In some embodiments, the target site is at or near a gene or its regulatory element that participates in controlling HBV replication and / or HBV transcription. In some aspects, the target site is at or near a promoter. In some aspects, the target site is near an enhancer region. In some aspects, the target site is at or near a transcript processing control region. In some aspects, the target site can be any gene that is most suitable for setting up DNA methylation to silence HBV transcription.

[0272] In some embodiments, the gRNA targets a target site comprising a sequence selected from any one of SEQ ID NOs: 1-34 as shown in Table 3, a contiguous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing.

[0273] In some embodiments, the gRNA targets a target site comprising a sequence selected from any one of SEQ ID NOs: 35-100 as shown in Table 4, or at least a 14 nt contiguous portion thereof, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing.

[0274] In some embodiments, the gRNA targets a target site comprising a sequence selected from any one of SEQ ID NOs: 101-195 as shown in Table 5, a contiguous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing.

[0275] In some embodiments, the gRNA further comprises a scaffold sequence as shown in SEQ ID NO: 587. In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence shown in SEQ ID NO: 587 (GUUUAAGAGCUAUGCU GGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC), or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or part of the scaffold sequence. In some embodiments, the scaffold sequence is shown in SEQ ID NO: 587.

[0276] In some embodiments, the gRNA comprises a sequence selected from any one of SEQ ID NOs: 391-585 as shown in Table 6, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any one of SEQ ID NOs: 391-585. In some embodiments, the gRNA is shown in any one of SEQ ID NOs: 391-585.

[0277] In some embodiments, the gRNA comprises a sequence selected from any one of SEQ ID NOs: 391-424, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing.

[0278] In some embodiments, the gRNA comprises a sequence selected from any one of SEQ ID NOs: 425-490, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing.

[0279] In some embodiments, the gRNA comprises a sequence selected from any one of SEQ ID NOs: 490-585, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing.

[0280] In some embodiments, any of the provided gRNA sequences is complexed with or provided in combination with Cas9. In some embodiments, Cas9 is dCas9. In some embodiments, dCas9 is dSpCas9, such as the dSpCas9 set forth in SEQ ID NO: 599. Table 3. Target site sequences and gRNA spacers with >90% HBV genome conservation and no mismatches (HBV0) Table 4. Target site sequences and gRNA spacers with >90% HBV genome conservation and 1-2 mismatches (HBV1) Table 5. Target site sequences and gRNA spacers with 70%-90% HBV genome conservation and up to 2 mismatches (HBV2) Table 6. gRNA targeting genes

[0281] In some embodiments, the gRNA provided herein targets a target site in the hepatitis B virus genome. In some embodiments, gRNA targets a site between 0-3300bp of the HBV genome. In some embodiments, gRNA targets a site located at 43bp-490bp, 1033bp-1749bp, 1800bp-1950bp, or 2953bp-3182 of the HBV genome corresponding to the position of the reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650. In some embodiments, the gRNA targets a site located between 1 bp-42 bp, 491 bp-1032 bp, 1750 bp-1799 bp, or 1951 bp-2952 bp of the HBV genome corresponding to the position of the reference hepatitis B virus genome (hepatitis B virus subtype ayw, complete genome, GenBank: U95551.1) SEQ ID NO: 650. In some embodiments, the gRNA targets a site at or near a regulatory element involved in HBV replication and / or transcription. In some embodiments, the gRNA targets a polymerase gene, an S family gene, an X gene, or a core family gene. In some embodiments, the gRNA targets the M / S-HBs promoter region, the X promoter region, the basic core promoter region, or the L-HBs promoter region. In some embodiments, the gRNA targets the Enh1 or Enh2 enhancer region. In some embodiments, the gRNA targets the HBV coding region.

[0282] In some embodiments, the gRNA provided herein comprises a sequence selected from any one of SEQ ID NOs: 196-229, a contiguous portion of at least 14 nucleotides (e.g., 14, 15, 16, 17, 18, or 19 nucleotides) thereof, a complementary sequence of any of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the gRNA comprises a spacer sequence comprising: a sequence selected from any one of SEQ ID NOs: 230-295, a contiguous portion of at least 14 nt (e.g., 14, 15, 16, 17, 18, or 19 nucleotides) thereof, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the gRNA comprises a spacer sequence comprising: a sequence selected from any one of SEQ ID NOs: 296-390, a continuous portion of at least 14 nt (e.g., 14, 15, 16, 17, 18, or 19 nucleotides), or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence set forth in SEQ ID NO: 587, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO: 587. In some embodiments, the gRNA comprising a spacer sequence and a scaffold sequence comprises a sequence selected from any one of SEQ ID NOs: 391-585, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a portion thereof.

[0283] In some embodiments, the gRNA comprises a spacer sequence comprising: a sequence selected from any one of SEQ ID NOs: 370, 333, 387, 347, 313, 320, 380, 256, 258, 311, 319, 230, 272, a contiguous portion of at least 14 nucleotides (e.g., 14, 15, 16, 17, 18, or 19 nucleotides) thereof, a complementary sequence of any one of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity thereto. In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence set forth in SEQ ID NO:587, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:587. In some embodiments, the gRNA comprising a spacer sequence and a scaffold sequence comprises a sequence selected from any one of SEQ ID NOs: 565, 528, 542, 508, 515, 575, 515, 453, 506, 514, 425, or 472, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity thereto. In some embodiments, the gRNA is shown in SEQ ID NOs: 565, 528, 542, 508, 515, 575, 515, 453, 506, 514, 425, or 472.

[0284] In some embodiments, the gRNA comprises a spacer sequence comprising: a sequence selected from the group consisting of SEQ ID NO: 200, 205, 207, 213, 217, 221, 224, 233, 251, 256, 257, 258, 263, 267, 274, 275, 277, 279, 293, 294, 311, 313, 316, 319, 320, 330, 333, 338, 345, 347, 353, 359, 370, 371, 377, 380, 384, 385, 387, a continuous portion of at least 14 nucleotides (e.g., 14, 15, 16, 17, 18, or 19 nucleotides) thereof, a complementary sequence of any of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity thereto. In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence shown in SEQ ID NO: 587, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity thereto. In some embodiments, the gRNA comprising a spacer sequence and a scaffold sequence comprises a sequence selected from SEQ ID 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity thereof.In some embodiments, the gRNA comprises a spacer sequence comprising: a sequence selected from the group consisting of SEQ ID NO: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 370, 371, 377, 380, 384, 385, 387, a contiguous portion of at least 14 nucleotides (e.g., 14, 15, 16, 17, 18, or 19 nucleotides) thereof, a complementary sequence of any of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity thereto. In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence set forth in SEQ ID NO: 587, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO: 587. In some embodiments, the gRNA comprising the spacer sequence and the scaffold sequence comprises a sequence selected from the group consisting of SEQ ID NO: NO:369, 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 4 69, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 5 33, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580, 582, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity thereto.In some embodiments, the gRNA is set forth in SEQ ID NO: 369, 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580, or 582.

[0285] In some embodiments, the gRNA comprises a spacer sequence comprising: a sequence selected from any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, a contiguous portion of at least 14 nucleotides (e.g., 14, 15, 16, 17, 18, or 19 nucleotides) thereof, a complement of any of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the gRNA comprises a spacer sequence comprising: the sequence of SEQ ID NO: 217, a contiguous portion of at least 14 nucleotides (e.g., 14, 15, 16, 17, 18, or 19 nucleotides) thereof, a complementary sequence to any of the foregoing, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO: 217. In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence set forth in SEQ ID NO:587, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO:587. In some embodiments, the gRNA comprising a spacer sequence and a scaffold sequence comprises a sequence selected from any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or part of the sequence. In some embodiments, the multiple epigenetic modification DNA targeting system for epigenetic modification of at least two genes and / or their regulatory elements is provided and comprises any of the aforementioned gRNAs complexed with a Cas protein (such as a Cas9 protein). In some embodiments, Cas9 is dCas9. In some embodiments, the dCas9 is dSpCas9 (such as the dSpCas9 shown in SEQ ID NO: 599) or a variant and / or fusion thereof.

[0286] In some embodiments, provided herein are combinations of gRNAs. In some embodiments, provided herein are multiplex epigenetic modification DNA targeting systems comprising a combination of gRNAs.

[0287] In some embodiments, the combination of gRNAs comprises at least two gRNAs targeting at least two different genes or their regulatory elements. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene or its regulatory element and a second gRNA targeting a second gene or its regulatory element. In some embodiments, the first gRNA targets a gene or its regulatory element selected from the following: polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions, and any coding regions within the HBV genome, and the second gRNA targets a gene or its regulatory element selected from the following: polymerase genes, S family genes, X genes, core family genes, pre-S1 promoters, pre-S2 promoters, X promoters, basic core promoters, Enh1 enhancers, Enh2 enhancers, transcript processing control regions, and any coding regions within the HBV genome, and the first gRNA and the second gRNA target different genes or their regulatory elements. In some embodiments, the first gRNA targets the Enh1 enhancer, while the second gRNA targets a gene selected from the group consisting of the L-HBs promoter, the M-HBs promoter, the S-HBs promoter, the X promoter, the basal core promoter, the S gene promoter, and the Enh2 enhancer. In some embodiments, the first gRNA targets the Enh1 enhancer, while the second gRNA targets the L-HBs promoter. In some embodiments, the first gRNA and the second gRNA target a combination of two genes selected from the combination of genes listed in Table 1. In some embodiments, the first gRNA and the second gRNA are each independently selected from any gRNA described herein.

[0288] In some embodiments, the combination of gRNAs comprises at least three gRNAs targeting at least three different genes or their regulatory elements. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene, a second gRNA targeting a second gene, and a third gRNA targeting a third gene. In some embodiments, the combination of gRNAs comprises at least three gRNAs targeting at least three different genes or their regulatory elements. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene or its regulatory element, a second gRNA targeting a second gene or its regulatory element, and a third gRNA targeting a third gene or its regulatory element. In some embodiments, the first gRNA targets a gene or its regulatory element selected from the group consisting of: a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, a transcript processing control region, and any coding region within the HBV genome; the second gRNA targets a gene or its regulatory element selected from the group consisting of: a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, a transcript processing control region, and any coding region within the HBV genome; the third gRNA targets a gene or its regulatory element selected from the group consisting of: a polymerase gene, an S family gene, an X gene, a core family gene, a pre-S1 promoter, a pre-S2 promoter, an X promoter, a basal core promoter, an Enh1 enhancer, an Enh2 enhancer, a transcript processing control region, and any coding region within the HBV genome; and the first gRNA, the second gRNA, and the third gRNA target different genes or their regulatory elements. In some embodiments, the first gRNA targets the Enh1 enhancer, the second gRNA targets a gene selected from the group consisting of the L-HBs promoter, the M-HBs promoter, the S-HBs promoter, the X promoter, the basal core promoter, the S gene promoter, the Enh1 enhancer, and the Enh2 enhancer, the third gRNA targets a gene selected from the group consisting of the L-HBs promoter, the M-HBs promoter, the S-HBs promoter, the X promoter, the basal core promoter, the S gene promoter, the Enh1 enhancer, and the Enh2 enhancer, and the second and third gRNAs target different genes. In some embodiments, the first gRNA targets the Enh1 enhancer, the second gRNA targets the L-HBs promoter, and the third gRNA targets a gene selected from the group consisting of the M-HBs promoter, the S-HBs promoter, the X promoter, the basal core promoter, the S gene promoter, and the Enh2 enhancer. In some embodiments, the first gRNA, the second gRNA, and the third gRNA target a combination of three genes selected from the combination of genes listed in Table 2.In some embodiments, the first gRNA, the second gRNA, and the third gRNA are each independently selected from any gRNA described herein.

[0289] In some embodiments, the combination of gRNAs comprises at least four gRNAs targeting at least four different genes or their regulatory elements. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene, a second gRNA targeting a second gene, a third gRNA targeting a third gene, and a fourth gRNA targeting a fourth gene. In some embodiments, the combination of gRNAs comprises at least four gRNAs targeting at least four different genes or their regulatory elements. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene or its regulatory element, a second gRNA targeting a second gene or its regulatory element, a third gRNA targeting a third gene or its regulatory element, and a fourth gRNA targeting a third gene or its regulatory element. In some embodiments, the first gRNA targets a gene or its regulatory element selected from the following: polymerase genes, S family genes, X genes, core family genes, pre-S1 promoter, pre-S2 promoter, X promoter, basal core promoter, Enh1 enhancer, Enh2 enhancer, transcript processing control region and any coding region in the HBV genome; the second gRNA targets a gene or its regulatory element selected from the following: polymerase genes, S family genes, X genes, core family genes, pre-S1 promoter, pre-S2 promoter, X promoter, basal core promoter, Enh1 enhancer, Enh2 enhancer, transcript processing control region and any coding region in the HBV genome; the third gRNA targets a gene or its regulatory element selected from the following: Regulatory elements: polymerase genes, S family genes, X genes, core family genes, pre-S1 promoter, pre-S2 promoter, X promoter, basal core promoter, Enh1 enhancer, Enh2 enhancer, transcript processing control region, and any coding region within the HBV genome; the fourth gRNA targets a gene or its regulatory element selected from the following: polymerase genes, S family genes, X genes, core family genes, pre-S1 promoter, pre-S2 promoter, X promoter, basal core promoter, Enh1 enhancer, Enh2 enhancer, transcript processing control region, and any coding region within the HBV genome; and the first gRNA, the second gRNA, the third gRNA, and the fourth gRNA target different genes or their regulatory elements.In some embodiments, the first gRNA targets the Enh1 enhancer, the second gRNA targets a gene selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, S gene promoter, Enh1 enhancer, and Enh2 enhancer, the third gRNA targets a gene selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, S gene promoter, Enh1 enhancer, and Enh2 enhancer, the fourth gRNA targets a gene selected from the group consisting of L-HBs promoter, M-HBs promoter, S-HBs promoter, X promoter, basal core promoter, S gene promoter, Enh1 enhancer, and Enh2 enhancer, and the first, second, third, and fourth gRNAs target different genes or their regulatory elements. In some embodiments, the first, second, third, and fourth gRNAs target four genes or combinations of their regulatory elements selected from the genes listed in Table 2 or combinations of their regulatory elements. In some embodiments, the first gRNA, the second gRNA, the third gRNA, and the fourth gRNA are each independently selected from any gRNA described herein.

[0290] In some embodiments, the combination of gRNAs comprises at least five gRNAs targeting at least five different genes or their regulatory elements. In some embodiments, the combination of gRNAs comprises at least six gRNAs targeting at least six different genes and / or their regulatory elements. In some embodiments, the first, second, third, fourth, fifth, and / or sixth gene or its regulatory element is different. C. Engineered zinc finger protein (eZFP)

[0291] In some aspects, provided herein are zinc finger proteins (ZFPs), such as engineered zinc finger proteins (eZFPs). In some embodiments, eZFPs are capable of binding to or binding to target sites in regulatory elements of genes in HBV genes or hepatitis B virus sequences. In some aspects, eZFPs can promote specific targeting of effector domains to achieve transcriptional repression of genes or regulatory elements. In some embodiments, provided herein are epigenetic modification DNA targeting systems comprising fusion proteins comprising eZFPs and one or more other elements (such as effector domains for transcriptional repression). Therefore, in some aspects, for example, in combination with compositions and methods for treating diseases or disorders associated with HBV (such as HBV viral infection, liver disease or cancer), eZFPs contribute to reduced expression of HBV genes or regulatory elements.

[0292] In some embodiments, zinc finger proteins (ZFPs), zinc finger DNA binding proteins, or zinc finger DNA binding domains are domains within proteins or larger proteins that bind to DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain that have a structure stabilized by zinc ion coordination. ZFPs include artificial or engineered ZFPs (eZFPs) containing the following ZFP domains that target specific DNA sequences (typically 9-18 nucleotides long) and are produced by the assembly of individual zinc fingers. ZFPs include those in which a single finger domain is approximately 30 amino acids long and contains an α-helix containing two invariant histidine residues coordinated by zinc to two cysteines of a single β-turn, and the ZFP has two, three, four, five, or six fingers. Typically, the sequence specificity of a ZFP can be altered by making amino acid substitutions at four helical positions (-1, 2, 3, and 6) on the zinc finger recognition helix (also referred to as the zinc finger recognition region). Thus, for example, a ZFP or a molecule containing a ZFP (such as a fusion protein) can be non-naturally occurring, eg, engineered to bind to a selected target site.

[0293] In some embodiments, zinc fingers can be custom designed (i.e., designed by the user) and / or obtained from commercial sources. Various methods for designing zinc finger proteins are available. For example, methods for designing zinc finger proteins to bind to a target DNA sequence of interest are described, for example, in: Liu, Q. et al., PNAS, 94(11):5525-30 (1997); Wright, DA et al., Nat. Protoc., 1(3):1637-52 (2006); Gersbach, CA et al., Acc. Chem. Res., 47(8):2309-18 (2014); Bhakta MS et al., Methods Mol. Biol., 649:3-30 (2010); and Gaj et al., Trends Biotechnol, 31(7):397-405 (2013). In addition, various web-based tools for designing zinc finger proteins that bind to a target DNA sequence of interest are publicly available. See, for example, the Zinc Finger Design Tool website from Scripps, which is available on the World Wide Web at scripps.edu / barbas / zfdesign / zfdesignhome.php. Various commercial services for designing zinc finger proteins that bind to a desired DNA target sequence are also available. See, for example, the commercially available services or kits provided by Creative Biolabs (World Wide Web at creative-biolabs.com / Design-and-Synthesis-of-Artificial-Zinc-Finger-Proteins.html), the Zinc Finger Consortium Modular Assembly Kit provided by Addgene (World Wide Web at addgene.org / kits / zfc-modular-assembly / ), or the Comp oZr custom ZFN service from Sigma Aldrich (World Wide Web at sigmaaldrich.com / life-science / zinc-finger-nuclease-technology / custom-zfn.html).

[0294] In some embodiments, provided herein is an epigenetic modification DNA targeting system comprising a fusion protein comprising an eZFP and one or more other elements (such as an effector domain for transcriptional repression). In some embodiments, at least one DNA binding domain of the epigenetic modification DNA targeting system comprises an engineered zinc finger protein (eZFP). In some embodiments, the epigenetic modification DNA targeting system comprises an engineered zinc finger protein (eZFP) that binds to a target site in one or more HBV genes or their regulatory elements. The target site targeted by any provided eZFP can be any target site as described herein, such as any target site described in Section IA.

[0295] In some embodiments, the target site of the eZFP provided herein (e.g., an eZFP included in a fusion protein of an epigenetic modification DNA targeting system) is in one or more HBV genes or their regulatory elements. In some embodiments, the target site is in a CpG island (e.g., CpG island 1, CpG island 2, CpG island 3) of the HBV genome. In some embodiments, the target site is in CpG island 2 of the HBV genome. In some embodiments, the target site is within a target region of 1033bp-1749bp spanning the HBV genome corresponding to the position of the HBV genome shown in SEQ ID NO: 650. In some embodiments, the target site is within a target region that spans 300 base pairs (bp), 250bp, 200bp, 150bp, 140bp, 130bp, 120bp, 110bp, or 100bp upstream of the HBx start codon. In some embodiments, the target site is within a target region sequence that corresponds to a sequence spanning 1250-1374 bp of the HBV genome as set forth in SEQ ID NO: 650. In some embodiments, the target region has a sequence as set forth in SEQ ID NO: 1068. In some embodiments, the target site is within a target region sequence that corresponds to a sequence spanning 1255-1302 bp of the HBV genome as set forth in SEQ ID NO: 650. In some embodiments, the target region has a sequence as set forth in SEQ ID NO: 1069. In some embodiments, the target site is within a target region sequence that corresponds to a sequence spanning 1260-1300 bp of the HBV genome as set forth in SEQ ID NO: 650. In some embodiments, the target region has a sequence as set forth in SEQ ID NO: 1070.

[0296] In some embodiments, the target site of the eZFP provided herein (e.g., an eZFP included in a fusion protein of an epigenetic modification DNA targeting system) comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1028-1055, a continuous portion of at least 12 nt thereof, or a complementary sequence to any one of the foregoing. In some embodiments, the target site of the eZFP provided herein comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1028-1055. In some embodiments, the target site of the eZFP provided herein comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1045, 1046, or 1052, a continuous portion of at least 12 nt thereof, or a complementary sequence to any one of the foregoing. In some embodiments, the target site comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1045, 1046, or 1052.

[0297] In some embodiments, the target site is contained in double-stranded DNA, such as an HBV sequence integrated into human genomic DNA. In some embodiments, the target site is contained in a covalently closed circular (cccDNA) HBV sequence. In some embodiments, the target site is contained in a relaxed circular DNA (rcDNA) HBV sequence. In some embodiments, the eZFP is capable of binding to the target site. In some embodiments, the eZFP binds to the target site. In some embodiments, the binding is target-specific. For example, in some embodiments, the eZFP binds to the target site and does not bind to other sites comprising different sequences. For example, in some embodiments, the individual eZFP disclosed herein binds to the target site shown in any one of SEQ ID NOs: 1028-1055 and does not bind to different target sites. In some embodiments, the individual eZFP disclosed herein binds to the target site shown in any one of SEQ ID NOs: 1045, 1046, or 1052 and does not bind to different target sites. In some embodiments, the target sites of the eZFPs provided herein comprise the sequences shown in Table 7. Table 7. eZFP target sequences

[0298] In some embodiments, the target site of the eZFP provided herein (e.g., an eZFP included in a fusion protein of an epigenetic modification DNA targeting system) comprises the nucleotide sequence set forth in SEQ ID NO: 1045. In some embodiments, at least a 12 nt continuous portion thereof, or a complementary sequence of any of the foregoing. In some embodiments, the target site of the eZFP provided herein comprises the sequence set forth in SEQ ID NO: 1045.

[0299] In some embodiments, the target site of the eZFP provided herein (e.g., an eZFP included in a fusion protein of an epigenetic modification DNA targeting system) comprises the nucleotide sequence set forth in SEQ ID NO: 1046. In some embodiments, at least a 12 nt continuous portion thereof, or a complementary sequence of any of the foregoing. In some embodiments, the target site of the eZFP provided herein comprises the sequence set forth in SEQ ID NO: 1046.

[0300] In some embodiments, the target site of an eZFP provided herein (e.g., an eZFP included in a fusion protein of an epigenetic modification DNA targeting system) comprises the nucleotide sequence set forth in SEQ ID NO: 1052. In some embodiments, at least a 12 nt continuous portion thereof, or a complementary sequence of any of the foregoing. In some embodiments, the target site of an eZFP provided herein comprises the sequence set forth in SEQ ID NO: 1052.

[0301] In some embodiments, an eZFP comprises a plurality of zinc fingers. In some embodiments, each zinc finger comprises a recognition region. In some embodiments, the recognition regions collectively promote sequence-specific binding of the eZFP, such as sequence-specific binding to a specific target site. In some embodiments, an eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding recognition region F1 to F6 that promotes sequence-specific binding to a specific target site.

[0302] In some embodiments, the characteristics of the eZFPs targeting specific target sites provided herein are shown in Table E4. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from the N-terminus to the C-terminus, each zinc finger comprising a corresponding recognition region F1-F6, as shown in Table E4. In some embodiments, the recognition regions F1-F6 promote specific binding to the target site sequence indicated in Table E4. In some embodiments, the eZFP comprises an amino acid sequence comprising a recognition region, as shown in Table E4. In some embodiments, the eZFP may be encoded by a DNA sequence as shown in Table 8. Table 8. eZFP DNA sequences

[0303] In some embodiments, the eZFP (e.g., an eZFP included in a fusion protein of an epigenetic modification DNA targeting system) comprises a zinc finger protein comprising six zinc fingers sequentially designated F1 to F6 from N-terminus to C-terminus. In some embodiments, the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); 2) F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) F6: DSSHRTR (SEQ ID NO: 731); 3) F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO: 736) F6: QSSDLRR (SEQ ID NO: 737); 4) F1: RSDNLSE (SEQ ID NO: 738) F2: TSSNRKT (SEQ ID NO: 739) F3: DRSHLTR (SEQ ID NO: 740) F4: RSDALTQ (SEQ ID NO: 741) F5: DRSALAR (SEQ ID NO: 742) F6: RRFTLSK (SEQ ID NO: 743); 5) F1: RSDHLSE (SEQ ID NO: 744) F2: QYSGRYY (SEQ ID NO:745)F3:HGQTLNE(SEQ ID NO:746)F4:QSGNLAR(SEQ IDNO:747)F5: RSDSLLR (SEQ ID NO:748)F6: CREYRGK (SEQ ID NO:749);<h2 style=";text-align:left;direction:ltr">6)F1:QSANRTT(SEQ ID NO:750)F2:RSANLTR(SEQ ID NO:751)F3:RSDVLSE(SEQ ID NO:752)F4:TSGHLSR(SEQ ID NO:753)F5:QSSDLSR(SEQ ID NO:754),F6:QWSTRKR(SEQ ID NO:755);7)F1:QSGNLAR(SEQID NO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ ID NO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761);8)F1:NPANLTR(SEQ IDNO:762) F2: QNATRTK(SEQ ID NO:763) F3: QSGHLAR(SEQ ID NO:764) F4: NRHDRAK(SEQ ID NO:765) F5: RSDHLSE(SEQ ID NO:766), F6: QRRSRYK(SEQ ID NO:767);9) F1: QSSDLSR(SEQID NO:768) F2: HRSTRNR(SEQ ID NO:769) F3: RSDVLSA(SEQ ID NO:770) F4: DSRRKN(SEQ ID NO:771) F5: QSGSLTR(SEQ ID NO:772) F6: DQSGLAH(SEQ ID NO:773);10) F1: QNPAQWR(SEQID NO:774) F2: RSADLSR(SEQ ID NO:774) NO:775)F3:TSGSLSR(SEQ ID NO:776)F4:RSDHLSR(SEQ ID NO:777)F5:RSDSLLR(SEQ ID NO:778)F6:QSYDRFQ(SEQ ID NO:779);11)F1:TSGSLSR(SEQID NO:780)F2:RSDHLSR(SEQ ID NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ ID NO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ ID NO:785);<h2 style=";text-align:left;direction:ltr">12) F1: DRSNLSR (SEQID NO: 786) F2: LRQNLIM (SEQID NO: 787) F3: ERGTLAR (SEQ ID NO: 788) F4: RSDALTQ (SEQ ID NO: 789) F5: RSDSLSQ (SEQ ID NO: 790) F6: RKADRTR (SEQ ID NO: 791);13) F1: QYCCLTN (SEQID NO: 792) F2: TSGNLTR (SEQ ID NO: 793) F3: QSSDLSR (SEQ ID NO: 794) F4: FRYYLKR (SEQ ID NO: 795) F5: QSGDLTR (SEQ ID NO: 796) F6: DKGNLTK (SEQ ID NO: 797);14) F1: TSGSLSR (SEQID NO: NO:798) F2:RSDNLTT(SEQ ID NO:799) F3:QSGNLAR(SEQ ID NO:800) F4:DRTTLMR(SEQ ID NO:801) F5:QSGHLAR(SEQ ID NO:802) F6:QLTHLNS(SEQ ID NO:803);15) F1:IKHDLHR(SEQID NO:804) F2:RSANLTR(SEQ ID NO:805) F3:RSDNLAR(SEQ ID NO:806) F4:QNVSRPR(SEQ ID NO:807) F5:RSDDLSK(SEQ ID NO:808) F6:DSSHRTR(SEQ ID NO:809);16) F1:RSDNLAR(SEQID NO:810) F2:QNVSRPR(SEQ ID NO:810) F2:QNVSRPR(SEQ ID NO:810) NO:811)F3:RSDDLSK(SEQ ID NO:812)F4:DSSHRTR(SEQ ID NO:813)F5:TSSNRKT(SEQ ID NO:814)F6:AQWTRAC(SEQ ID NO:815);17)F1:RSDDLSK(SEQID NO:816)F2:DSSHRTR(SEQ ID NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ ID NO:821);<h2 style=";text-align:left;direction:ltr">18) F1: QSAHRKN (SEQID NO: 822) F2: TSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827);19) F1: RSDHLSQ (SEQID NO: 828) F2: ASTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833);20) F1: RSDTLSE (SEQID NO:834)F2:RRWTLVG(SEQ ID NO:835)F3:DRSNLSR(SEQ ID NO:836)F4:QSGDLTR(SEQ ID NO:837)F5:QSSDLSR(SEQ ID NO:838)F6:YHWYLKK(SEQ ID NO:839);21)F1:RSANLAR(SEQID NO:840)F2:RSDNLRE(SEQ ID NO:841)F3:RPYTLRL(SEQ ID NO:842)F4:HRSNLNK(SEQ ID NO:843)F5:QSGSLTR(SEQ ID NO:844)F6:TSANLSR(SEQ ID NO:845);22)F1:RSDDLVR(SEQID NO:846)F2:TSGSLVR(SEQ ID NO:846)F2:TSGSLVR(SEQ ID NO:841) NO:847)F3:RSDKLVR(SEQ ID NO:848)F4:RSDELVR(SEQ ID NO:849)F5:TSHSLTE(SEQ ID NO:850)F6:RADNLTE(SEQ ID NO:851);23)F1:ERSHLRE(SEQID NO:852)F2:TSHSLTE(SEQ ID NO:853)F3:QAGHLAS(SEQ ID NO:854)F4:TSHSLTE(SEQ ID NO:855)F5:DPGHLVR(SEQ ID NO:856)F6:TSGNLVR(SEQ ID NO:857);<h2 style=";text-align:left;direction:ltr">24) F1: RADNLTE (SEQID NO: 858) F2: TSGSLVR (SEQ ID NO: 859) F3: RKDNLKN (SEQ ID NO: 860) F4: QSSSLVR (SEQ ID NO: 861) F5: RSDKLVR (SEQ ID NO: 862) F6: DSGNLRV (SEQ ID NO: 863);25) F1: QSSSLVR (SEQID NO: 864) F2: QSGDLRR (SEQ ID NO: 865) F3: RSDERKR (SEQ ID NO: 866) F4: HRTTLTN (SEQ ID NO: 867) F5: RSDHLTN (SEQ ID NO: 868) F6: TSGELVR (SEQ ID NO: 869);26) F1: QSGDLRR (SEQID NO: 868) NO:870)F2:RSDERKR(SEQ ID NO:871)F3:HRTTLTN(SEQ ID NO:872)F4:RSDHLTN(SEQ ID NO:873)F5:TSGELVR(SEQ ID NO:874)F6:RSDDLVR(SEQ ID NO:875);27)F1:QRAHLER(SEQID NO:876)F2:QLAHLRA(SEQ ID NO:877)F3:DPGHLVR(SEQ ID NO:878)F4:RRSACRR(SEQ ID NO:879)F5:RSDHLTT(SEQ ID NO:880)F6:QSSSLVR(SEQ ID NO:881);28)F1:QSSNLVR(SEQ ID NO:882)F2:RSDDLVR(SEQ ID NO:882)F2:RSDDLVR(SEQ ID NO:882) NO:883)F3:THLDLIR(SEQ ID NO:884)F4:TSGNLTE(SEQ ID NO:885)F5:RRSACRR(SEQ ID NO:886)F6:RNDTLTE(SEQ ID NO:887)。;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0304] In some embodiments, the eZFP (e.g., an eZFP included in a fusion protein of an epigenetic modification DNA targeting system) comprises a sequence as set forth in any one of SEQ ID NOs: 692-719, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by a sequence as set forth in any one of SEQ ID NOs: 888-915, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0305] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_1 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1028, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1028. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 692, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 692. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 888, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 888.

[0306] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_2 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1029, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1029. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) F6: DSSHRTR (SEQ ID NO: 731). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 693, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 693. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 889, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 889.

[0307] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_3 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1030, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1030. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO: 736) F6: QSSDLRR (SEQ ID NO: 737). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 694, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 694. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 890, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 890.

[0308] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_4 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1031, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1031. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDNLSE (SEQ ID NO: 738) F2: TSSNRKT (SEQ ID NO: 739) F3: DRSHLTR (SEQ ID NO: 740) F4: RSDALTQ (SEQ ID NO: 741) F5: DRSALAR (SEQ ID NO: 742) F6: RRFTLSK (SEQ ID NO: 743). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 695, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 695. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 891, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 891.

[0309] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP-5 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1032, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1032. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSE (SEQ ID NO: 744) F2: QYSGRYY (SEQ ID NO: 745) F3: HGQTLNE (SEQ ID NO: 746) F4: QSGNLAR (SEQ ID NO: 747) F5: RSDSLLR (SEQ ID NO: 748) F6: CREYRGK (SEQ ID NO: 749). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 696, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 696. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 892, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 892.

[0310] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_6 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1033, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1033. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: QSANRTT (SEQ ID NO: 750) F2: RSANLTR (SEQ ID NO: 751) F3: RSDVLSE (SEQ ID NO: 752) F4: TSGHLSR (SEQ ID NO: 753) F5: QSSDLSR (SEQ ID NO: 754) F6: QWSTRKR (SEQ ID NO: 755). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 697, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 697. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 893, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 893.

[0311] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP-7 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1034, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1034. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: QSGNLAR (SEQ ID NO: 756) F2: ATCCLAH (SEQ ID NO: 757) F3: RWQYLPT (SEQ ID NO: 758) F4: DRSALAR (SEQ ID NO: 759) F5: RSDNLSE (SEQ ID NO: 760) F6: KRCNLRC (SEQ ID NO: 761). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 698, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 698. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 894, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 894.

[0312] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP-8 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1035, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1035. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: NPANLTR (SEQ ID NO: 762) F2: QNATRTK (SEQ ID NO: 763) F3: QSGHLAR (SEQ ID NO: 764) F4: NRHDRAK (SEQ ID NO: 765) F5: RSDHLSE (SEQ ID NO: 766) F6: QRRSRYK (SEQ ID NO: 767). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 699, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 699. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 895, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 895.

[0313] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP-9 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1036, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1036. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSDLSR (SEQ ID NO: 768) F2: HRSTRNR (SEQ ID NO: 769) F3: RSDVLSA (SEQ ID NO: 770) F4: DSRTRKN (SEQ ID NO: 771) F5: QSGSLTR (SEQ ID NO: 772) F6: DQSGLAH (SEQ ID NO: 773). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 700, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 700. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 896, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 896.

[0314] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_10 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1037, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1037. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: QNPAQWR (SEQ ID NO: 774) F2: RSADLSR (SEQ ID NO: 775) F3: TSGSLSR (SEQ ID NO: 776) F4: RSDHLSR (SEQ ID NO: 777) F5: RSDSLLR (SEQ ID NO: 778) F6: QSYDRFQ (SEQ ID NO: 779). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 701, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 701. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 897, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 897.

[0315] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_11 as described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1038, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1038. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: TSGSLSR (SEQ ID NO: 780) F2: RSDHLSR (SEQ ID NO: 781) F3: RSDSLLR (SEQ ID NO: 782) F4: QSYDRFQ (SEQ ID NO: 783) F5: RSDNLST (SEQ ID NO: 784) F6: DNRDRIK (SEQ ID NO: 785). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 702, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 702. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 898, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 898.

[0316] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_12 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1039, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1039. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: DRSNLSR (SEQ ID NO: 786) F2: LRQNLIM (SEQ ID NO: 787) F3: ERGTLAR (SEQ ID NO: 788) F4: RSDALTQ (SEQ ID NO: 789) F5: RSDSLSQ (SEQ ID NO: 790) F6: RKADRTR (SEQ ID NO: 791). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 703, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 703. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 899, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 899.

[0317] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_13 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1040, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1040. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: QYCCLTN (SEQ ID NO: 792) F2: TSGNLTR (SEQ ID NO: 793) F3: QSSDLSR (SEQ ID NO: 794) F4: FRYYLKR (SEQ ID NO: 795) F5: QSGDLTR (SEQ ID NO: 796) F6: DKGNLTK (SEQ ID NO: 797). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 704, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 704. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 900, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 900.

[0318] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_14 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1041, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1041. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: TSGSLSR (SEQ ID NO: 798) F2: RSDNLTT (SEQ ID NO: 799) F3: QSGNLAR (SEQ ID NO: 800) F4: DRTTLMR (SEQ ID NO: 801) F5: QSGHLAR (SEQ ID NO: 802) F6: QLTHLNS (SEQ ID NO: 803). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 705, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 705. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 901, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 901.

[0319] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_15 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1042, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1042. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: IKHDLHR (SEQ ID NO: 804) F2: RSANLTR (SEQ ID NO: 805) F3: RSDNLAR (SEQ ID NO: 806) F4: QNVSRPR (SEQ ID NO: 807) F5: RSDDLSK (SEQ ID NO: 808) F6: DSSHRTR (SEQ ID NO: 809). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 706, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 706. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 902, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 902.

[0320] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_16 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1043, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1043. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDNLAR (SEQ ID NO: 810) F2: QNVSRPR (SEQ ID NO: 811) F3: RSDDLSK (SEQ ID NO: 812) F4: DSSHRTR (SEQ ID NO: 813) F5: TSSNRKT (SEQ ID NO: 814) F6: AQWTRAC (SEQ ID NO: 815). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 707, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 707. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 903, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 903.

[0321] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_17 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1044, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1044. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDDLSK (SEQ ID NO: 816) F2: DSSHRTR (SEQ ID NO: 817) F3: TSSNRKT (SEQ ID NO: 818) F4: AQWTRAC (SEQ ID NO: 819) F5: RKQTRTT (SEQ ID NO: 820) F6: HRSSLRR (SEQ ID NO: 821). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 708, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 708. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 904, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 904.

[0322] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_18 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1045, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1045. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO: 822) F2: TSSNRKT (SEQ ID NO: 823) F3: RSDNLSA (SEQ ID NO: 824) F4: RNNDRKT (SEQ ID NO: 825) F5: TSGSLSR (SEQ ID NO: 826) F6: QAGHLAK (SEQ ID NO: 827). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 709, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 709. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 905, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 905.

[0323] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_19 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1046, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1046. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO: 828) F2: ASSTRTK (SEQ ID NO: 829) F3: RSDDLTR (SEQ ID NO: 830) F4: QKSNLSS (SEQ ID NO: 831) F5: QSANRTT (SEQ ID NO: 832) F6: QNATRTK (SEQ ID NO: 833). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 710, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 710. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 906, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 906.

[0324] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_20 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1047, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1047. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDTLSE (SEQ ID NO: 834) F2: RRWTLVG (SEQ ID NO: 835) F3: DRSNLSR (SEQ ID NO: 836) F4: QSGDLTR (SEQ ID NO: 837) F5: QSSDLSR (SEQ ID NO: 838) F6: YHWYLKK (SEQ ID NO: 839). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 711, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 711. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 907, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 907.

[0325] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_21 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1048, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1048. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSANLAR (SEQ ID NO: 840) F2: RSDNLRE (SEQ ID NO: 841) F3: RPYTLRL (SEQ ID NO: 842) F4: HRSNLNK (SEQ ID NO: 843) F5: QSGSLTR (SEQ ID NO: 844) F6: TSANLSR (SEQ ID NO: 845). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 712, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 712. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 908, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 908.

[0326] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_22 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1049, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1049. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDDLVR (SEQ ID NO: 846) F2: TSGSLVR (SEQ ID NO: 847) F3: RSDKLVR (SEQ ID NO: 848) F4: RSDELVR (SEQ ID NO: 849) F5: TSHSLTE (SEQ ID NO: 850) F6: RADNLTE (SEQ ID NO: 851). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 713, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 713. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 909, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the eZFP is encoded by the nucleotide sequence set forth in SEQ ID NO: 909.

[0327] In some embodiments, provided herein is an eZFP (e.g., an eZFP contained in a fusion protein of an epigenetic modification DNA targeting system), such as eZFP_23 described herein. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1050, a continuous portion of at least 12 nt thereof, or a complementary sequence of any of the foregoing. In some embodiments, the eZFP targets a target site comprising the nucleotide sequence shown in SEQ ID NO: 1050. In some embodiments, the eZFP comprises six zinc fingers, sequentially designated F1 to F6 from N-terminus to C-terminus, each zinc finger comprising a corresponding zinc finger recognition region F1 to F6, and the amino acid sequence of each zinc finger recognition region is as follows: F1: ERSHLRE (SEQ ID NO: 852) F2: TSHSLTE (SEQ ID NO: 853) F3: QAGHLAS (SEQ ID NO: 854) F4: TSHSLTE (SEQ ID NO: 855) F5: DPGHLVR (SEQ ID NO: 856) F6: TSGNLVR (SEQ ID NO: 857). In some embodiments, the eZFP comprises the amino acid sequence set forth in SEQ ID NO: 714, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ...

Claims

1. An epigenetic modification DNA targeting system, comprising at least one DNA targeting module for repressing transcription of one or more hepatitis B virus (HBV) genes, wherein each of the at least one DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence; and (b) at least one transcriptional repressor effector domain.

2. The epigenetic modification DNA targeting system according to claim 1, wherein the at least one DNA binding domain comprises a clustered regularly interspaced short palindromic repeats-associated (Cas)-guide RNA (gRNA) combination, the combination comprising (a) a Cas protein or a variant thereof and (b) at least one gRNA capable of associating with the Cas protein to target the Cas protein to the target site; a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a meganuclease; a homing endonuclease; or an I-SceI enzyme or a variant thereof, optionally wherein the DNA binding domain comprises a catalytically inactive variant of any one of the foregoing.

3. The epigenetic modification DNA targeting system according to claim 1 or 2, wherein the hepatitis B virus DNA sequence is an HBV gene or a regulatory element thereof.

4. The epigenetic modification DNA targeting system according to any one of claims 1 to 3, wherein the at least one DNA targeting module comprises multiple DNA targeting modules for targeting multiple target sites of one or more HBV genes or regulatory elements thereof.

5. The epigenetic modification DNA targeting system according to claim 4, wherein the plurality of DNA targeting modules comprises at least a first DNA targeting module and a second DNA targeting module, wherein: (1) the first DNA targeting module represses transcription of a first HBV gene, wherein the first DNA targeting module comprises a first fusion protein comprising (a) a DNA binding domain for targeting a target site of the first gene or its regulatory DNA element; and (b) at least one transcriptional repressor domain; and (2) the second DNA targeting module represses transcription of a second HBV gene, wherein the second DNA targeting module comprises a second fusion protein comprising (a) a DNA binding domain for targeting a target site of the second gene or its regulatory DNA element; and (b) at least one transcriptional repressor domain, optionally wherein: The first DNA-targeting module and the second DNA-targeting module have the same fusion protein, such that the first fusion protein and the second fusion protein are identical, and wherein the DNA-binding domain of the fusion protein is a Clustered Regularly Interspaced Short Palindromic Repeats-associated (Cas) protein or a variant thereof capable of associating with a first guide RNA (gRNA) and a second gRNA, wherein The first DNA targeting module comprises the first gRNA targeting a target site of a first HBV gene or a regulatory element thereof, and the second DNA targeting module comprises the second gRNA targeting a target site of a second HBV gene or a regulatory element thereof.

6. An epigenetic modification DNA targeting system for suppressing the transcription of one or more hepatitis B virus (HBV) genes, wherein the DNA targeting system comprises: (a) a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats-associated (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain; and (b) a plurality of guide RNAs (gRNAs), the plurality of guide RNAs comprising at least a first gRNA and a second gRNA, wherein the first gRNA targets a target site of a first HBV gene or its regulatory element, and the second gRNA targets a target site of a second HBV gene or its regulatory element, The first gene and the second gene or their regulatory elements regulate hepatitis B virus replication and / or HBV transcription.

7. The epigenetic modification DNA targeting system according to claim 6, wherein the DNA targeting system further comprises a third gRNA targeting a target site of a third gene or its regulatory element, wherein the third gene or its regulatory element regulates hepatitis B virus replication and / or HBV transcription, Optionally wherein the system further comprises a fourth gRNA targeting a target site of a fourth gene or its regulatory element, optionally a fifth gRNA targeting a fifth gene or its regulatory element, and / or optionally a sixth gRNA targeting a target site of a sixth gene or its regulatory element, The gene or its regulatory element regulates hepatitis B virus replication and / or HBV transcription.

8. The epigenetic modification DNA targeting system according to claim 7, wherein the first gene, the second gene, the third gene, the fourth gene, the fifth gene and / or the sixth gene or their regulatory elements are different.

9. An epigenetic modification DNA targeting system for suppressing the transcription of one or more hepatitis B virus (HBV) genes, wherein the DNA targeting system comprises: (a) a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats-associated (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain; and (b) a plurality of guide RNAs (gRNAs) that target a plurality of target sites of a plurality of genes or their regulatory elements, The multiple genes or their regulatory elements regulate hepatitis B virus replication and / or HBV transcription.

10. An epigenetic modification DNA targeting system comprising a single DNA targeting module for repressing the transcription of more than one hepatitis B virus (HBV) gene, Wherein the DNA targeting module comprises: (a) a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats-associated (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain; and (b) guide RNAs (gRNAs) targeting multiple target sites of multiple genes or their regulatory elements, The multiple genes or their regulatory elements regulate hepatitis B virus replication and / or HBV transcription.

11. The epigenetic modification DNA targeting system according to any one of claims 1 to 10, wherein repressing transcription results in reduced HBV replication and / or reduced HBV protein levels.

12. The epigenetic modification DNA targeting system according to any one of claims 1 to 11, wherein the DNA targeting system does not introduce gene disruption or DNA breakage.

13. The epigenetic modification DNA targeting system according to any one of claims 1-9 and 11-12, wherein the at least one DNA binding module comprises a plurality of DNA binding modules that together target a plurality of target sites in the HBV DNA sequence, optionally wherein each DNA binding module targets a different target site in the HBV DNA sequence.

14. The epigenetic modification DNA targeting system according to any one of claims 4, 5, and 9-13, wherein the multiple target sites are 2, 3, 4, 5, or 6 different target sites.

15. The epigenetic modification DNA targeting system according to any one of claims 4, 5, and 9-14, wherein each of the multiple target sites is in a different HBV gene or its regulatory element.

16. The epigenetic modification DNA targeting system according to any one of claims 1 to 14, wherein each target site is in the same HBV gene or its regulatory element.

17. The epigenetic modification DNA targeting system according to any one of claims 1-5 and 11-16, wherein the system comprises 2 to 10 DNA targeting modules.

18. The epigenetic modification DNA targeting system according to any one of claims 1 to 5 and 11 to 17, wherein any two or more of the DNA targeting modules have the same fusion protein, or wherein any two or more of the DNA targeting modules comprise different fusion proteins.

19. The epigenetic modification DNA targeting system according to any one of claims 1-5 and 11-18, wherein the DNA binding domain of each DNA targeting module comprises a fusion protein comprising a clustered regularly interspaced short palindromic repeats-associated (Cas) protein or a variant thereof and at least one transcriptional repressor effector domain, and wherein each DNA targeting module comprises a unique gRNA.

20. The epigenetic modification DNA targeting system according to any one of claims 1 to 19, wherein the target site or each of the target sites exists in the form of covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA), and / or in HBV viral DNA integrated in human genomic DNA.

21. The epigenetic modification DNA targeting system according to any one of claims 1 to 20, wherein the target site or each of the target sites is present at or near a gene or a regulatory element thereof involved in controlling HBV replication and / or HBV transcription.

22. The epigenetic modification DNA targeting system according to claim 21, wherein the gene involved in controlling HBV replication and / or HBV transcription encodes a polymerase, an envelope protein, a capsid protein, a transcription factor or a transcriptional transactivator.

23. The epigenetic modification DNA targeting system according to claim 21 or claim 22, wherein the gene involved in controlling HBV replication and / or HBV transcription is a polymerase gene, an S family gene, an X gene or a core family gene.

24. The epigenetic modification DNA targeting system according to any one of claims 1 to 23, wherein at least one target site is in a gene encoding the X gene of the hepatitis B virus X protein (HBx) or a regulatory element thereof.

25. The epigenetic modification DNA targeting system according to any one of claims 1 to 24, wherein the target site or each of the target sites is at or near a regulatory element of an HBV gene involved in controlling HBV replication and / or HBV transcription.

26. The epigenetic modification DNA targeting system of claim 25, wherein the regulatory element is a promoter region.

27. The epigenetic modification DNA targeting system according to claim 26, wherein the promoter region is a pre-S1 promoter, a pre-S2 promoter, an X promoter or a basic core promoter.

28. The epigenetic modification DNA targeting system of claim 25, wherein the regulatory element is an enhancer region. The epigenetic modification DNA targeting system according to claim 28 , wherein the enhancer region is an Enh1 or Enh2 enhancer region.

30. The epigenetic modification DNA targeting system of claim 25, wherein the regulatory element is a transcript processing control region.

31. The epigenetic modification DNA targeting system according to any one of claims 1 to 24, wherein the or each of the target sites is in the coding region of the HBV gene.

32. The epigenetic modification DNA targeting system of any one of claims 1-31, wherein the or each of the target sites is located within 500 base pairs (bp), within 1000 bp, or within 1500 bp of the transcription start site.

33. The epigenetic modification DNA targeting system according to any one of claims 1 to 32, wherein the target site or each of the target sites is located within a target region located between 0-3300 base pairs (bp) of the HBV genome, optionally at base pairs between 0-3182 bp corresponding to the position of the HBV genome shown in SEQ ID NO:

650.

34. The epigenetic modification DNA targeting system according to any one of claims 1 to 33, wherein the target site or each of the target sites is located within a target region having a sequence corresponding to a sequence located at base pairs between 43bp-490bp, 1033bp-1749bp, 1800bp-1950bp, or 2953bp-3182bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

35. The epigenetic modification DNA targeting system according to any one of claims 1 to 33, wherein the target site or each of the target sites is located within a target region having a sequence corresponding to a sequence located at base pairs between 1 bp-42 bp, 491 bp-1032 bp, 1750 bp-1799 bp, or 1951 bp-2952 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

36. The epigenetic modification DNA targeting system according to any one of claims 1 to 33, wherein the target site or each of the target sites is in a CpG island of the HBV genome.

37. The epigenetic modification DNA targeting system according to any one of claims 1 to 33 and 36, wherein the target site or each of the target sites is located within a target region having a sequence corresponding to a sequence located at base pairs between 67 bp-392 bp, 1033 bp-1749 bp, or 2215 bp-2490 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

38. The epigenetic modification DNA targeting system of any one of claims 1-33, 36, and 37, wherein the or each of the target sites is located within a target region having a sequence corresponding to a sequence located at base pairs between 1033 bp and 1749 bp in the hepatitis B virus sequence with reference to the nucleotide position of SEQ ID NO:

650.

39. The epigenetic modification DNA targeting system of any one of claims 1 to 37, wherein the or each of the target sites is within a target region positioned within 300 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx).

40. An epigenetic modification DNA targeting system comprising at least one DNA targeting module for repressing transcription of one or more hepatitis B virus (HBV) genes, wherein each of the at least one DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site within a target region spanning 300 base pairs upstream of the start codon of hepatitis B virus X protein (HBx); and (b) at least one transcriptional repressor effector domain.

41. The epigenetic modification DNA targeting system according to any one of claims 1 to 40, wherein the or each of the target sites is located in the HBx basic core promoter region.

42. The epigenetic modification DNA targeting system according to any one of claims 1 to 40, wherein the or each of the target sites is located within the HBx promoter / enhancer region.

43. The epigenetic modification DNA targeting system of any one of claims 1 to 42, wherein the or each of the target sites is within a target region spanning within 250 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx).

44. The epigenetic modification DNA targeting system according to any one of claims 1 to 43, wherein the target site or each of the target sites is within a target region having a sequence corresponding to a sequence located at base pairs between 1060-1480 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

45. The epigenetic modification DNA targeting system of any one of claims 1 to 44, wherein the or each of the target sites is within a target region spanning within 150 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx).

46. The epigenetic modification DNA targeting system of any one of claims 1 to 45, wherein the or each of the target sites is within a target region spanning within 120 base pairs upstream of the start codon of hepatitis B virus X protein (HBx).

47. The epigenetic modification DNA targeting system according to any one of claims 1 to 46, wherein the target site or each of the target sites is within a target region having a sequence corresponding to a sequence located at base pairs between 1250-1374 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

48. The epigenetic modification DNA targeting system of any one of claims 1 to 47, wherein the target site or each of the target sites is within a target region having a sequence corresponding to a sequence located at base pairs between 1255-1302 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

49. The epigenetic modification DNA targeting system according to any one of claims 1 to 48, wherein the target site or each of the target sites is within a target region having a sequence corresponding to a sequence located at base pairs between 1260-1300 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

50. The epigenetic modification DNA targeting system of any one of claims 1-49, wherein the or each of the target sites is at least 70% homologous to all hepatitis B virus genomes.

51. The epigenetic modification DNA targeting system of any one of claims 1-50, wherein the or each of the target sites is at least 70% homologous to at least 1000 hepatitis B virus genomes.

52. The epigenetic modification DNA targeting system of any one of claims 1-51, wherein the or each of the target sites is at least 70% homologous to at least 1000 hepatitis B virus genomes and contains no more than two mismatches.

53. The epigenetic modification DNA targeting system of any one of claims 1 to 52, wherein the target site or each of the target sites comprises a sequence as shown in any one of SEQ ID NOs: 1 to 195, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any one of the foregoing.

54. The epigenetic modification DNA targeting system of any one of claims 1 to 53, wherein the target site or each of the target sites comprises a sequence as shown in any one of SEQ ID NOs: 175, 138, 192, 152, 118, 125, 185, 63, 116, 124, 35, 82, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any one of the foregoing.

55. The epigenetic modification DNA targeting system of any one of claims 1 to 54, wherein the target site or each of the target sites comprises a sequence shown in any one of SEQ ID NOs: 175, 138, 192, 152, 118, 125, 185, 63, 116, 124, 35, 82.

56. The epigenetic modification DNA targeting system of any one of claims 1-53, wherein the target site or each of the target sites comprises a sequence as shown in any one of SEQ ID NO: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any one of the foregoing.

57. The epigenetic modification DNA targeting system of any one of claims 1-53 and 56, wherein the target site or each of the target sites comprises a sequence as shown in any one of SEQ ID NOs: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192.

58. The epigenetic modification DNA targeting system of any one of claims 1 to 53, wherein the target site or each of the target sites is represented by any one of SEQ ID NOs: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence of any one of the foregoing.

59. The epigenetic modification DNA targeting system of any one of claims 1-53 and 58, wherein the target site or each of the target sites is shown in any one of SEQ ID NOs: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192.

60. The epigenetic modification DNA targeting system according to any one of claims 1 to 53 and 56 to 59, wherein the target site or each of the target sites comprises the sequence shown in SEQ ID NO: 22, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence of any of the foregoing, optionally wherein the target site is as shown in SEQ ID NO:

22.

61. The epigenetic modification DNA targeting system according to any one of claims 1 to 53 and 56 to 59, wherein the target site or each of the target sites comprises the sequence shown in SEQ ID NO: 63, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence of any of the foregoing, optionally wherein the target site is as shown in SEQ ID NO:

63.

62. The epigenetic modification DNA targeting system according to any one of claims 2 to 53, wherein the gRNA or each of the gRNAs comprises a gRNA spacer sequence comprising a sequence shown in any one of SEQ ID NOs: 196 to 390.

63. The epigenetic modification DNA targeting system of claim 62, wherein the gRNA or each of the gRNAs further comprises the sequence shown in SEQ ID NO:

587.

64. The epigenetic modification DNA targeting system according to any one of claims 2-53, 62 and 63, wherein the gRNA or each of the gRNAs comprises a sequence shown in any one of SEQ ID NOs: 391-585.

65. The epigenetic modification DNA targeting system according to any one of claims 2-53 and 62-64, wherein the gRNA or each of the gRNAs is shown in any one of SEQ ID NOs: 391-585.

66. The epigenetic modification DNA targeting system according to any one of claims 2-53 and 62-64, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 370, 333, 387, 347, 313, 320, 380, 256, 258, 311, 319, 230, 272, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any one of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 565, 528, 542, 508, 515, 575, 515, 453, 506, 514, 425, or 472.

67. The epigenetic modification DNA targeting system of any one of claims 2-53 and 62-66, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 370, 333, 387, 347, 313, 320, 380, 256, 258, 311, 319, 230, 272, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 565, 528, 542, 508, 515, 575, 515, 453, 506, 514, 425, or 472.

68. The epigenetic modification DNA targeting system according to any one of claims 2-53 and 62-65, wherein the gRNA or each of the gRNAs comprises SEQ ID NO: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 370, 371, 377, 380, 384, 385, 387, a contiguous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in SEQ ID Any one of NO: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582.

69. The epigenetic modification DNA targeting system according to any one of claims 2-53, 62-65 and 68, wherein the gRNA or each of the gRNAs comprises SEQ ID NO: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 370, 371, 377, 380, 384, 385 or 387, optionally wherein the gRNA or each of the gRNAs is as shown in SEQ ID Any one of NO: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582.

70. The epigenetic modification DNA targeting system according to any one of claims 2-53 and 62-65, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any one of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582.

71. The epigenetic modification DNA targeting system of any one of claims 2-53, 62-65, and 70, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582.

72. The epigenetic modification DNA targeting system according to any one of claims 2-53, 62-65 and 68-71, wherein the gRNA or each of the gRNAs comprises the sequence shown in SEQ ID NO: 217, a contiguous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing, optionally wherein the gRNA or each of the gRNAs comprises the sequence shown in SEQ ID NO: 217, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO:

412.

73. The epigenetic modification DNA targeting system according to any one of claims 2-53, 62-65 and 68-71, wherein the gRNA or each of the gRNAs comprises the sequence shown in SEQ ID NO: 258, a contiguous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing, optionally wherein the gRNA or each of the gRNAs comprises the sequence shown in SEQ ID NO: 258, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO:

453.

74. The epigenetic modification DNA targeting system of any one of claims 1-73, wherein the or each of the target sites is at least 90% homologous to all hepatitis B virus genomes.

75. The epigenetic modification DNA targeting system of any one of claims 1-74, wherein the or each of the target sites is at least 90% homologous to at least 1000 hepatitis B virus genomes.

76. The epigenetic modification DNA targeting system of any one of claims 1 to 75, wherein the or each of the target sites is at least 90% homologous to at least 1000 hepatitis B virus genomes and comprises at most two mismatches, optionally one or two mismatches.

77. The epigenetic modification DNA targeting system of any one of claims 1-53, 62-65, and 74-76, wherein the target site or each of the target sites comprises a sequence as shown in any one of SEQ ID NOs: 35-100, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any one of the foregoing.

78. The epigenetic modification DNA targeting system of any one of claims 2-53, 62-65, and 74-77, wherein the gRNA or each of the gRNAs comprises a gRNA spacer sequence comprising a sequence shown in any one of SEQ ID NOs: 230-295.

79. The epigenetic modification DNA targeting system of claim 78, wherein the gRNA or each of the gRNAs further comprises the sequence shown in SEQ ID NO:

587.

80. The epigenetic modification DNA targeting system according to any one of claims 2-53, 62-65 and 74-79, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 230-295, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 425-490.

81. The epigenetic modification DNA targeting system of any one of claims 52-80, wherein the at most two mismatches are located in the first 12nt on the 5' end of the gRNA protospacer.

82. The epigenetic modification DNA targeting system of any one of claims 1-51 and 53-73, 75 and 77-81, wherein the or each of the target sites is at least 90% homologous to at least 1000 hepatitis B virus genomes and contains zero mismatches.

83. The epigenetic modification DNA targeting system of any one of claims 1-53, 62-65, 74-76, and 82, wherein the target site comprises a sequence shown in any one of SEQ ID NOs: 1-34, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any one of the foregoing.

84. The epigenetic modification DNA targeting system of any one of claims 2-53, 62-65, 74-76, 82, and 83, wherein the gRNA or each of the gRNAs comprises a gRNA spacer sequence comprising a sequence shown in SEQ ID NOs: 196-229.

85. The epigenetic modification DNA targeting system of any one of claims 62-84, wherein the gRNA spacer sequence has a length between 14 nt and 24 nt or between 16 nt and 22 nt.

86. The epigenetic modification DNA targeting system of any one of claims 62-85, wherein the gRNA spacer sequence has a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

87. The epigenetic modification DNA targeting system of any one of claims 62-86, wherein the gRNA spacer sequence comprises modified nucleotides to increase stability.

88. The epigenetic modification DNA targeting system of any one of claims 2-53, 62, 74-76, and 82-87, wherein the at least one gRNA further comprises the sequence shown in SEQ ID NO:

587.

89. The epigenetic modification DNA targeting system of any one of claims 2-53, 62, 74-76, and 82-88, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 196-229, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 391-424.

90. The epigenetic modification DNA targeting system of any one of claims 2-53, 62, 74-76, and 82-89, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582.

91. The epigenetic modification DNA targeting system of any one of claims 2-53, 62, 74-76, and 82-90, wherein the gRNA comprises the sequence shown in SEQ ID NO: 217, optionally wherein the gRNA is as shown in SEQ ID NO:

412.

92. The epigenetic modification DNA targeting system of any one of claims 2-91, wherein the Cas protein or variant thereof is a Cas9 protein or a variant thereof.

93. The epigenetic modification DNA targeting system of any one of claims 2-92, wherein the Cas protein or variant thereof is a Cas12 protein or a variant thereof.

94. The epigenetic modification DNA targeting system of any one of claims 2-93, wherein the Cas protein or a variant thereof is a variant Cas protein, wherein the variant Cas protein lacks nuclease activity or is an inactivated Cas (dCas) protein.

95. The epigenetic modification DNA targeting system of any one of claims 2-94, wherein the variant Cas protein is a variant Cas9 protein that lacks nuclease activity or is an inactivated Cas9 (dCas9) protein.

96. The epigenetic modification DNA targeting system of any one of claims 2-95, wherein the Cas9 protein or variant thereof is a Staphylococcus aureus Cas9 (SaCas9) protein or a variant thereof.

97. The epigenetic modification DNA targeting system of claim 96, wherein the variant Cas9 is a Staphylococcus aureus dCas9 protein (dSaCas9) comprising at least one amino acid mutation selected from D10A and N580A, with reference to the numbering of positions of SEQ ID NO:

596.

98. The epigenetic modification DNA targeting system of claim 96 or 97, wherein the variant Cas9 protein comprises the sequence shown in SEQ ID NO: 597, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:

597.

99. The epigenetic modification DNA targeting system of any one of claims 2-95, wherein the Cas9 protein or variant thereof is a Streptococcus pyogenes Cas9 (SpCas9) protein or a variant thereof.

100. The epigenetic modification DNA targeting system of claim 99, wherein the variant Cas9 is a Streptococcus pyogenes dCas9 (dSpCas9) protein comprising at least one amino acid mutation selected from D10A and H840A, as numbered with reference to positions of SEQ ID NO:

598.

101. The epigenetic modification DNA targeting system of claim 99 or 100, wherein the variant Cas9 protein comprises the sequence shown in SEQ ID NO: 599, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

102. The epigenetic modification DNA targeting system of any one of claims 1-5, 11-18, 20-33, 34-61, wherein the at least one DNA binding domain comprises an engineered zinc finger protein (eZFP).

103. The epigenetic modification DNA targeting system of any one of claims 1-5, 11-18, 20-33, 34-61 and 102, wherein the at least one DNA binding domain is an eZFP.

104. The epigenetic modification DNA targeting system according to any one of claims 1-54, 11-18, 20-33, 34-61, 102 and 103, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, 1052, a continuous portion of at least 12 nt thereof, or a complementary sequence of any one of the foregoing.

105. The epigenetic modification DNA targeting system according to any one of claims 1-54, 11-18, 20-33, 34-61 and 102-104, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, and 1052.

106. The epigenetic modification DNA targeting system according to any one of claims 102 to 105, wherein the zinc finger protein comprises six zinc fingers denoted as F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); <h2 style=";text-align:left;direction:ltr">2)F1:RSDVLST(SEQ ID NO:726)F2:DNSSRTR(SEQ ID NO:727)F3:RPYTLRL(SEQ ID NO:728)F4:DSSHRTR(SEQ ID NO:729)F5:RSDHLSQ(SEQ ID NO:730)F6:DSSHRTR(SEQ ID NO:731); <h2 style=";text-align:left;direction:ltr"> 3)F1:RSDHLSQ(SEQ ID NO:732)F2:QSADRTK(SEQ ID NO:733)F3:RSDHLSQ(SEQ ID NO:734)F4:RRSDLKR(SEQ ID NO:735)F5:RSDHLSR(SEQ ID NO:736)F6:QSSDLRR(SEQ ID NO:737); <h2 style=";text-align:left;direction:ltr"> 4)F1:RSDNLSE(SEQ ID NO:738)F2:TSSNRKT(SEQ ID NO:739)F3:DRSHLTR(SEQ ID NO:740)F4:RSDALTQ(SEQ ID NO:741)F5:DRSALAR(SEQ ID NO:742)F6:RRFTLSK(SEQ ID NO:743); <h2 style=";text-align:left;direction:ltr"> 5)F1:RSDHLSE(SEQ ID NO:744)F2:QYSGRYY(SEQ ID NO:745)F3:HGQTLNE(SEQ ID NO:746)F4:QSGNLAR(SEQ ID NO:747)F5:RSDSLLR(SEQ ID NO:748)F6:CREYRGK(SEQ ID NO:749); <h2 style=";text-align:left;direction:ltr"> 6)F1:QSANRTT(SEQ ID NO:750)F2:RSANLTR(SEQ ID NO:751)F3:RSDVLSE(SEQ ID NO:752)F4:TSGHLSR(SEQ ID NO:753)F5:QSSDLSR(SEQ ID NO:754)F6:QWSTRKR(SEQ ID NO:755); <h2 style=";text-align:left;direction:ltr"> 7)F1:QSGNLAR(SEQ ID NO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ ID NO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761); <h2 style=";text-align:left;direction:ltr">8)F1:NPANLTR(SEQ ID NO:762)F2:QNATRTK(SEQ ID NO:763)F3:QSGHLAR(SEQ ID NO:764)F4:NRHDRAK(SEQ ID NO:765)F5:RSDHLSE(SEQ ID NO:766)F6:QRRSRYK(SEQ ID NO:767); <h2 style=";text-align:left;direction:ltr"> 9)F1:QSSDLSR(SEQ ID NO:768)F2:HRSTRNR(SEQ ID NO:769)F3:RSDVLSA(SEQ ID NO:770)F4:DSRTRKN(SEQ ID NO:771)F5:QSGSLTR(SEQ ID NO:772)F6:DQSGLAH(SEQ ID NO:773); <h2 style=";text-align:left;direction:ltr"> 10)F1:QNPAQWR(SEQ ID NO:774)F2:RSADLSR(SEQ ID NO:775)F3:TSGSLSR(SEQ ID NO:776)F4:RSDHLSR(SEQ ID NO:777)F5:RSDSLLR(SEQ ID NO:778)F6:QSYDRFQ(SEQ IDNO:779); <h2 style=";text-align:left;direction:ltr"> 11)F1:TSGSLSR(SEQ ID NO:780)F2:RSDHLSR(SEQ ID NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ ID NO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ IDNO:785); <h2 style=";text-align:left;direction:ltr"> 12)F1:DRSNLSR(SEQ ID NO:786)F2:LRQNLIM(SEQ ID NO:787)F3:ERGTLAR(SEQ IDNO:788)F4:RSDALTQ(SEQ ID NO:789)F5:RSDSLSQ(SEQ ID NO:790)F6:RKADRTR(SEQ IDNO:791); <h2 style=";text-align:left;direction:ltr"> 13)F1:QYCCLTN(SEQ ID NO:792)F2:TSGNLTR(SEQ ID NO:793)F3:QSSDLSR(SEQ IDNO:794)F4:FRYYLKR(SEQ ID NO:795)F5:QSGDLTR(SEQ ID NO:796)F6:DKGNLTK(SEQ IDNO:797); <h2 style=";text-align:left;direction:ltr">14) F1:TSGSLSR(SEQ ID NO:798) F2:RSDNLTT(SEQ ID NO:799) F3:QSGNLAR(SEQ ID NO:800) F4:DRTTLMR(SEQ ID NO:801) F5:QSGHLAR(SEQ ID NO:802) F6:QLTHLNS(SEQ IDNO:803); <h2 style=";text-align:left;direction:ltr"> 15) F1: IKHDLHR(SEQ ID NO: 804) F2: RSANLTR(SEQ ID NO: 805) F3: RSDNLAR(SEQ ID NO: 806) F4: QNVSRPR(SEQ ID NO: 807) F5: RSDDLSK(SEQ ID NO: 808) F6: DSSHRTR(SEQ ID NO: 809); <h2 style=";text-align:left;direction:ltr"> 16)F1:RSDNLAR(SEQ ID NO:810)F2:QNVSRPR(SEQ ID NO:811)F3:RSDDLSK(SEQ ID NO:812)F4:DSSHRTR(SEQ ID NO:813)F5:TSSNRKT(SEQ ID NO:814)F6:AQWTRAC(SEQ IDNO:815); <h2 style=";text-align:left;direction:ltr"> 17)F1:RSDDLSK(SEQ ID NO:816)F2:DSSHRTR(SEQ ID NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ IDNO:821); <h2 style=";text-align:left;direction:ltr"> 18) F1: QSAHRKN(SEQ ID NO: 822) F2: TSNRKT(SEQ ID NO: 823) F3: RSDNLSA(SEQ ID NO: 824) F4: RNNDRKT(SEQ ID NO: 825) F5: TSGSLSR(SEQ ID NO: 826) F6: QAGHLAK(SEQ ID NO: 827); <h2 style=";text-align:left;direction:ltr"> 19)F1:RSDHLSQ(SEQ ID NO:828)F2:ASSTRTK(SEQ ID NO:829)F3:RSDDLTR(SEQ IDNO:830)F4:QKSNLSS(SEQ ID NO:831)F5:QSANRTT(SEQ ID NO:832)F6:QNATRTK(SEQ) IDNO:833); <h2 style=";text-align:left;direction:ltr">20)F1:RSDTLSE(SEQ ID NO:834)F2:RRWTLVG(SEQ ID NO:835)F3:DRSNLSR(SEQ ID NO:836)F4:QSGDLTR(SEQ ID NO:837)F5:QSSDLSR(SEQ ID NO:838)F6:YHWYLKK(SEQ IDNO:839); <h2 style=";text-align:left;direction:ltr"> 21)F1:RSANLAR(SEQ ID NO:840)F2:RSDNLRE(SEQ ID NO:841)F3:RPYTLRL(SEQ ID NO:842)F4:HRSNLNK(SEQ ID NO:843)F5:QSGSLTR(SEQ ID NO:844)F6:TSANLSR(SEQ IDNO:845); <h2 style=";text-align:left;direction:ltr"> 22) F1:RSDDLVR(SEQ ID NO:846) F2:TSGSLVR(SEQ ID NO:847) F3:RSDKLVR(SEQ ID NO:848) F4:RSDELVR(SEQ ID NO:849) F5:TSHSLTE(SEQ ID NO:850) F6:RADNLTE(SEQ IDNO:851); <h2 style=";text-align:left;direction:ltr"> 23) F1:ERSHLRE(SEQ ID NO:852) F2:TSHSLTE(SEQ ID NO:853) F3:QAGHLAS(SEQ ID NO:854) F4:TSHSLTE(SEQ ID NO:855) F5:DPGHLVR(SEQ ID NO:856) F6:TSGNLVR(SEQ IDNO:857); <h2 style=";text-align:left;direction:ltr"> 24) F1:RADNLTE(SEQ ID NO:858) F2:TSGSLVR(SEQ ID NO:859) F3:RKDNLKN(SEQ ID NO:860) F4:QSSSLVR(SEQ ID NO:861) F5:RSDKLVR(SEQ ID NO:862) F6:DSGNLRV(SEQ IDNO:863); <h2 style=";text-align:left;direction:ltr"> 25)F1:QSSSLVR(SEQ ID NO:864)F2:QSGDLRR(SEQ ID NO:865)F3:RSDERKR(SEQ IDNO:866)F4:HRTTLTN(SEQ ID NO:867)F5:RSDHLTN(SEQ ID NO:868)F6:TSGELVR(SEQ IDNO:869); 26) F1: QSGDLRR (SEQ ID NO: 870) F2: RSDERKR (SEQ ID NO: 871) F3: HRTTLTN (SEQ ID NO: 872) F4: RSDHLTN (SEQ ID NO: 873) F5: TSGELVR (SEQ ID NO: 874) F6: RSDDLVR (SEQ ID NO: 875); and 28) F1: QSSNLVR (SEQ ID NO: 882) F2: RSDDLVR (SEQ ID NO: 883) F3: THLDLIR (SEQ ID NO: 884) F4: TSGNLTE (SEQ ID NO: 885) F5: RRSACRR (SEQ ID NO: 886) F6: RNDTLTE (SEQ ID NO: 887).

107. The epigenetic modification DNA targeting system according to any one of claims 102 to 106, wherein the zinc finger protein comprises six zinc fingers denoted as F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO:822) F2: TSSNRKT (SEQ ID NO:823) F3: RSDNLSA (SEQ ID NO:824) F4: RNNDRKT (SEQ ID NO:825) F5: TSGSLSR (SEQ ID NO:826) F6: QAGHLAK (SEQ ID NO:827).

108. The epigenetic modification DNA targeting system according to any one of claims 102 to 106, wherein the zinc finger protein comprises six zinc fingers denoted as F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO:828) F2: ASSTRTK (SEQ ID NO:829) F3: RSDDLTR (SEQ ID NO:830) F4: QKSNLSS (SEQ ID NO:831) F5: QSANRTT (SEQ ID NO:832) F6: QNATRTK (SEQ ID NO:833).

109. The epigenetic modification DNA targeting system according to any one of claims 102 to 106, wherein the zinc finger protein comprises six zinc fingers denoted as F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO:864) F2: QSGDLRR (SEQ ID NO:865) F3: RSDERKR (SEQ ID NO:866) F4: HRTTLTN (SEQ ID NO:867) F5: RSDHLTN (SEQ ID NO:868) F6: TSGELVR (SEQ ID NO:869).

110. An epigenetic modification DNA targeting system, comprising: a) an eZFP that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses transcription of one or more HBV genes, wherein the zinc finger protein comprises six zinc fingers denoted as F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); 2) F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) F6: DSSHRTR (SEQ ID NO: 731); 3) F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO: 736) F6: QSSDLRR (SEQ ID NO: 737); <h2 style=";text-align:left;direction:ltr">4)F1:RSDNLSE(SEQ ID NO:738)F2:TSSNRKT(SEQ ID NO:739)F3:DRSHLTR(SEQ ID NO:740)F4:RSDALTQ(SEQ ID NO:741)F5:DRSALAR(SEQ ID NO:742)F6:RRFTLSK(SEQ ID NO:743); <h2 style=";text-align:left;direction:ltr"> 5)F1:RSDHLSE(SEQ ID NO:744)F2:QYSGRYY(SEQ ID NO:745)F3:HGQTLNE(SEQ ID NO:746)F4:QSGNLAR(SEQ ID NO:747)F5:RSDSLLR(SEQ ID NO:748)F6:CREYRGK(SEQ ID NO:749); <h2 style=";text-align:left;direction:ltr"> 6)F1:QSANRTT(SEQ ID NO:750)F2:RSANLTR(SEQ ID NO:751)F3:RSDVLSE(SEQ ID NO:752)F4:TSGHLSR(SEQ ID NO:753)F5:QSSDLSR(SEQ ID NO:754)F6:QWSTRKR(SEQ ID NO:755); <h2 style=";text-align:left;direction:ltr"> 7)F1:QSGNLAR(SEQ ID NO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ ID NO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761); <h2 style=";text-align:left;direction:ltr"> 8)F1:NPANLTR(SEQ ID NO:762)F2:QNATRTK(SEQ ID NO:763)F3:QSGHLAR(SEQ ID NO:764)F4:NRHDRAK(SEQ ID NO:765)F5:RSDHLSE(SEQ ID NO:766)F6:QRRSRYK(SEQ ID NO:767); <h2 style=";text-align:left;direction:ltr"> 9)F1:QSSDLSR(SEQ ID NO:768)F2:HRSTRNR(SEQ ID NO:769)F3:RSDVLSA(SEQ ID NO:770)F4:DSRTRKN(SEQ ID NO:771)F5:QSGSLTR(SEQ ID NO:772)F6:DQSGLAH(SEQ ID NO:773); <h2 style=";text-align:left;direction:ltr">10)F1:QNPAQWR(SEQ ID NO:774)F2:RSADLSR(SEQ ID NO:775)F3:TSGSLSR(SEQ ID NO:776)F4:RSDHLSR(SEQ ID NO:777)F5:RSDSLLR(SEQ ID NO:778)F6:QSYDRFQ(SEQ IDNO:779); <h2 style=";text-align:left;direction:ltr"> 11)F1:TSGSLSR(SEQ ID NO:780)F2:RSDHLSR(SEQ ID NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ ID NO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ IDNO:785); <h2 style=";text-align:left;direction:ltr"> 12)F1:DRSNLSR(SEQ ID NO:786)F2:LRQNLIM(SEQ ID NO:787)F3:ERGTLAR(SEQ IDNO:788)F4:RSDALTQ(SEQ ID NO:789)F5:RSDSLSQ(SEQ ID NO:790)F6:RKADRTR(SEQ IDNO:791); <h2 style=";text-align:left;direction:ltr"> 13)F1:QYCCLTN(SEQ ID NO:792)F2:TSGNLTR(SEQ ID NO:793)F3:QSSDLSR(SEQ IDNO:794)F4:FRYYLKR(SEQ ID NO:795)F5:QSGDLTR(SEQ ID NO:796)F6:DKGNLTK(SEQ IDNO:797); <h2 style=";text-align:left;direction:ltr"> 14) F1:TSGSLSR(SEQ ID NO:798) F2:RSDNLTT(SEQ ID NO:799) F3:QSGNLAR(SEQ ID NO:800) F4:DRTTLMR(SEQ ID NO:801) F5:QSGHLAR(SEQ ID NO:802) F6:QLTHLNS(SEQ IDNO:803); <h2 style=";text-align:left;direction:ltr"> 15) F1: IKHDLHR(SEQ ID NO: 804) F2: RSANLTR(SEQ ID NO: 805) F3: RSDNLAR(SEQ ID NO: 806) F4: QNVSRPR(SEQ ID NO: 807) F5: RSDDLSK(SEQ ID NO: 808) F6: DSSHRTR(SEQ ID NO: 809); <h2 style=";text-align:left;direction:ltr">16)F1:RSDNLAR(SEQ ID NO:810)F2:QNVSRPR(SEQ ID NO:811)F3:RSDDLSK(SEQ ID NO:812)F4:DSSHRTR(SEQ ID NO:813)F5:TSSNRKT(SEQ ID NO:814)F6:AQWTRAC(SEQ IDNO:815); <h2 style=";text-align:left;direction:ltr"> 17)F1:RSDDLSK(SEQ ID NO:816)F2:DSSHRTR(SEQ ID NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ IDNO:821); <h2 style=";text-align:left;direction:ltr"> 18) F1: QSAHRKN(SEQ ID NO: 822) F2: TSNRKT(SEQ ID NO: 823) F3: RSDNLSA(SEQ ID NO: 824) F4: RNNDRKT(SEQ ID NO: 825) F5: TSGSLSR(SEQ ID NO: 826) F6: QAGHLAK(SEQ ID NO: 827); <h2 style=";text-align:left;direction:ltr"> 19)F1:RSDHLSQ(SEQ ID NO:828)F2:ASSTRTK(SEQ ID NO:829)F3:RSDDLTR(SEQ IDNO:830)F4:QKSNLSS(SEQ ID NO:831)F5:QSANRTT(SEQ ID NO:832)F6:QNATRTK(SEQ) IDNO:833); <h2 style=";text-align:left;direction:ltr"> 20)F1:RSDTLSE(SEQ ID NO:834)F2:RRWTLVG(SEQ ID NO:835)F3:DRSNLSR(SEQ ID NO:836)F4:QSGDLTR(SEQ ID NO:837)F5:QSSDLSR(SEQ ID NO:838)F6:YHWYLKK(SEQ IDNO:839); <h2 style=";text-align:left;direction:ltr"> 21)F1:RSANLAR(SEQ ID NO:840)F2:RSDNLRE(SEQ ID NO:841)F3:RPYTLRL(SEQ ID NO:842)F4:HRSNLNK(SEQ ID NO:843)F5:QSGSLTR(SEQ ID NO:844)F6:TSANLSR(SEQ IDNO:845); <h2 style=";text-align:left;direction:ltr">22) F1:RSDDLVR(SEQ ID NO:846) F2:TSGSLVR(SEQ ID NO:847) F3:RSDKLVR(SEQ ID NO:848) F4:RSDELVR(SEQ ID NO:849) F5:TSHSLTE(SEQ ID NO:850) F6:RADNLTE(SEQ IDNO:851); <h2 style=";text-align:left;direction:ltr"> 23) F1:ERSHLRE(SEQ ID NO:852) F2:TSHSLTE(SEQ ID NO:853) F3:QAGHLAS(SEQ ID NO:854) F4:TSHSLTE(SEQ ID NO:855) F5:DPGHLVR(SEQ ID NO:856) F6:TSGNLVR(SEQ IDNO:857); <h2 style=";text-align:left;direction:ltr"> 24) F1:RADNLTE(SEQ ID NO:858) F2:TSGSLVR(SEQ ID NO:859) F3:RKDNLKN(SEQ ID NO:860) F4:QSSSLVR(SEQ ID NO:861) F5:RSDKLVR(SEQ ID NO:862) F6:DSGNLRV(SEQ IDNO:863); <h2 style=";text-align:left;direction:ltr"> 25)F1:QSSSLVR(SEQ ID NO:864)F2:QSGDLRR(SEQ ID NO:865)F3:RSDERKR(SEQ IDNO:866)F4:HRTTLTN(SEQ ID NO:867)F5:RSDHLTN(SEQ ID NO:868)F6:TSGELVR(SEQ IDNO:869); <h2 style=";text-align:left;direction:ltr"> 26)F1:QSGDLRR(SEQ ID NO:870)F2:RSDERKR(SEQ ID NO:871)F3:HRTTLTN(SEQ ID NO:872)F4:RSDHLTN(SEQ ID NO:873)F5:TSGELVR(SEQ ID NO:874)F6:RSDDLVR(SEQ IDNO:875); <h2 style=";text-align:left;direction:ltr"> 27) F1: QRAHLER(SEQ ID NO: 876) F2: QLAHLRA(SEQ ID NO: 877) F3: DPGHLVR(SEQ ID NO: 878) F4: RRSACRR(SEQ ID NO: 879) F5: RSDHLTT(SEQ ID NO: 880) F6: QSSSLVR(SEQ IDNO: 881); 28) F1: QSSNLVR (SEQ ID NO: 882) F2: RSDDLVR (SEQ ID NO: 883) F3: THLDLIR (SEQ ID NO: 884) F4: TSGNLTE (SEQ ID NO: 885) F5: RRSACRR (SEQ ID NO: 886) F6: RNDTLTE (SEQ ID NO: 887).

111. The epigenetic modification DNA targeting system according to any one of claims 102-110, wherein the engineered zinc finger protein comprises a sequence as shown in any one of SEQ ID NOs: 692-719 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

112. The epigenetic modification DNA targeting system according to any one of claims 102-111, wherein the engineered zinc finger protein is encoded by a sequence shown in any one of SEQ ID NOs: 888-915, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

113. An epigenetic modification DNA targeting system, comprising: a) an engineered zinc finger protein that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses transcription of one or more HBV genes, wherein the zinc finger protein comprises six zinc fingers denoted as F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO:822) F2: TSSNRKT (SEQ ID NO:823) F3: RSDNLSA (SEQ ID NO:824) F4: RNNDRKT (SEQ ID NO:825) F5: TSGSLSR (SEQ ID NO:826) F6: QAGHLAK (SEQ ID NO:827).

114. The epigenetic modification DNA targeting system according to any one of claims 102-113, wherein the eZFP comprises the sequence shown in SEQ ID NO: 709 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

115. The epigenetic modification DNA targeting system according to any one of claims 102-114, wherein the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO:

709.

116. The epigenetic modification DNA targeting system according to any one of claims 102-115, wherein the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 905 or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

117. The epigenetic modification DNA targeting system according to any one of claims 102-116, wherein the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO:

905.

118. An epigenetic modification DNA targeting system comprising: a) an engineered zinc finger protein that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses transcription of one or more HBV genes, The zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from the N-terminus to the C-terminus, and the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO:828) F2: ASSTRTK (SEQ ID NO:829) F3: RSDDLTR (SEQ ID NO:830) F4: QKSNLSS (SEQ ID NO:831) F5: QSANRTT (SEQ ID NO:832) F6: QNATRTK (SEQ ID NO:833).

119. The epigenetic modification DNA targeting system according to any one of claims 102-112 and 118, wherein the engineered zinc finger protein comprises the sequence shown in SEQ ID NO: 710 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

120. The epigenetic modification DNA targeting system according to any one of claims 102-112, 118 or 119, wherein the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO:

710.

121. The epigenetic modification DNA targeting system of claims 102-112 and 118-120, wherein the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 906, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

122. The epigenetic modification DNA targeting system according to any one of claims 102-112 and 118-121, wherein the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO:

906.

123. An epigenetic modification DNA targeting system comprising: a) an engineered zinc finger protein that binds to a target site in one or more HBV genes or their regulatory elements; and b) at least one effector domain that represses transcription of one or more HBV genes, The zinc finger protein comprises six zinc fingers represented as F1 to F6 in order from the N-terminus to the C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO:864) F2: QSGDLRR (SEQ ID NO:865) F3: RSDERKR (SEQ ID NO:866) F4: HRTTLTN (SEQ ID NO:867) F5: RSDHLTN (SEQ ID NO:868) F6: TSGELVR (SEQ ID NO:869).

124. The epigenetic modification DNA targeting system of any one of claims 102-112 and 123, wherein the engineered zinc finger protein comprises the sequence shown in SEQ ID NO: 716 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

125. The epigenetic modification DNA targeting system according to any one of claims 102-112, 123 or 124, wherein the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO:

716.

126. The epigenetic modification DNA targeting system according to any one of claims 102-112 and 123-125, wherein the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 912 or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

127. The epigenetic modification DNA targeting system according to any one of claims 102-112 and 123-126, wherein the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO:

912.

128. The epigenetic modification DNA targeting system of any one of claims 1-127, wherein the at least one effector domain induces transcriptional repression.

129. The epigenetic modification DNA targeting system of any one of claims 1-128, wherein the at least one effector domain is a DNA methyltransferase.

130. The epigenetic modification DNA targeting system of any one of claims 1-129, wherein the at least one effector domain comprises a DNA methyltransferase and a repressor domain capable of recruiting a heterochromatin inducing factor, or optionally wherein the heterochromatin inducing factor comprises a histone methyltransferase.

131. The epigenetic modification DNA targeting system of any one of claims 1-130, wherein the at least one effector domain comprises a DNA methyltransferase and a histone methyltransferase.

132. The epigenetic modification DNA targeting system according to any one of claims 1 to 131, wherein at least one effector domain is selected from a KRAB repressor domain, an ERF repressor domain, an Mxi1 repressor domain, a SID4X repressor domain, a Mad-SID repressor domain, a LSD1 repressor domain, or DNMT3A, DNMT3A-3L, a DNMT3A / L-KRAB fusion repressor domain, a DNMT3B domain binding protein, an EZH2 repressor domain, or a LSD1 repressor domain, or a variant of any one of the foregoing.

133. The epigenetic modification DNA targeting system of any one of claims 1-132, wherein the at least one effector domain comprises a sequence selected from any one of SEQ ID NOs: 590 or 600-608, 651, 661, 664, 665, 666, 668, and 669, or a domain thereof, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

134. The epigenetic modification DNA targeting system of any one of claims 1-133, wherein the at least one effector domain comprises a KRAB domain or a variant thereof.

135. The epigenetic modification DNA targeting system of any one of claims 1 to 134, wherein the at least one effector domain comprises the sequence shown in SEQ ID NO: 590, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

136. The epigenetic modification DNA targeting system of any one of claims 1-134, wherein the at least one effector domain comprises a DNMT3A / L domain or a variant thereof.

137. The epigenetic modification DNA targeting system of any one of claims 1-136, wherein: The at least one effector domain comprises the sequence shown in SEQ ID NO: 604 and 607, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing; or The at least one effector domain comprises the sequence shown in SEQ ID NO:651, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:

651.

138. The epigenetic modification DNA targeting system of any one of claims 1-137, wherein the fusion protein comprises a DNMT3A / 3L-dCas9-KRAB fusion protein.

139. The epigenetic modification DNA targeting system of any one of claims 1-138, wherein the fusion protein comprises the sequence shown in SEQ ID NO: 645, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

140. The epigenetic modification DNA targeting system of any one of claims 1-139, wherein the at least one effector domain is fused to the N-terminus, C-terminus, or both the N-terminus and C-terminus of the DNA binding domain or a component thereof.

141. The epigenetic modification DNA targeting system according to any one of claims 1-101 or 138-140, wherein the fusion protein is encoded by the sequence shown in SEQ ID NO: 680, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

142. The epigenetic modification DNA targeting system according to any one of claims 1-101 or 138-140, wherein the fusion protein is encoded by the sequence shown in SEQ ID NO:

680.

143. The epigenetic modification DNA targeting system of any one of claims 1-5, 11-18, 20-33, 34-61, and 102-140, wherein the fusion protein is encoded by a sequence shown in any one of SEQ ID NOs: 916-943, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

144. The epigenetic modification DNA targeting system of claims 1-5, 11-18, 20-33, 34-61, 102-140, and 143, wherein the fusion protein comprises a sequence as set forth in any one of SEQ ID NOs: 944-971, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

145. The epigenetic modification DNA targeting system of any one of claims 1-5, 11-18, 20-33, 34-61, 102-140, and 143-144, wherein the fusion protein comprises the sequence shown in any one of SEQ ID NO: 961, 962, or 968.

146. The epigenetic modification DNA targeting system of any one of claims 1-5, 11-18, 20-33, 34-61, 102-140, and 143-145, wherein the fusion protein comprises a DNMT3A / 3L-eZFP-KRAB fusion protein.

147. The epigenetic modification DNA targeting system of any one of claims 1-4, 11-18, 20-33, 34-61, 102-140, and 143-146, wherein the fusion protein is encoded by a sequence shown in any one of SEQ ID NOs: 972-999, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

148. The epigenetic modification DNA targeting system of any one of claims 1-5, 11-18, 20-33, 34-61, 102-140, and 143-147, wherein the fusion protein is encoded by a sequence shown in any one of SEQ ID NOs: 933, 934, or 940, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

149. The epigenetic modification DNA targeting system of any one of claims 1-5, 11-18, 20-33, 34-61, 102-140, and 143-148, wherein the fusion protein comprises a sequence as shown in any one of SEQ ID NOs: 1000-1027, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

150. The epigenetic modification DNA targeting system of any one of claims 1-4, 11-18, 20-33, 34-61, 102-140, and 143-149, wherein the fusion protein comprises a sequence as shown in any one of SEQ ID NOs: 1017, 1018, or 1024, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

151. The epigenetic modification DNA targeting system of any one of claims 1-150, wherein the fusion protein further comprises one or more nuclear localization signals (NLS).

152. The epigenetic modification DNA targeting system of any one of claims 1-151, wherein the fusion protein further comprises one or more linkers connecting two or more of: the DNA binding domain, the at least one effector domain, and the one or more nuclear localization signals.

153. The epigenetic modification DNA targeting system of any one of claims 1-152, wherein the DNA targeting system targets all hepatitis B virus genomes.

154. The epigenetic modification DNA targeting system of any one of claims 1-153, wherein the DNA targeting system targets at least 70% of all hepatitis B virus genomes.

155. The epigenetic modification DNA targeting system of any one of claims 1-154, wherein the DNA targeting system targets at least 60% of all hepatitis B virus genomes.

156. The epigenetic modification DNA targeting system of any one of claims 1-155, wherein the DNA targeting system targets at least 50% of all hepatitis B virus genomes.

157. The epigenetic modification DNA targeting system of any one of claims 1-156, wherein the DNA targeting system is incapable of introducing gene disruption or DNA breakage at or near the target site.

158. The epigenetic modification DNA targeting system of any one of claims 1-157, wherein repressing transcription of one or more HBV genes results in a decrease in RNA levels and / or protein levels from HBV DNA sequences.

159. The epigenetic modification DNA targeting system of any one of claims 1-158, wherein repressing transcription comprises a reduction in the level of total hepatitis B virus RNA transcripts.

160. The epigenetic modification DNA targeting system of any one of claims 1-159, wherein repression of transcription comprises reduction of the levels of Hepatitis B virus pre-core ("pre-C"), pre-genome ("pgRNA"), pre-S1, pre-S2 / S, and HBx.

161. The epigenetic modification DNA targeting system of any one of claims 1-160, wherein repressing transcription comprises a reduction in HBx levels.

162. The epigenetic modification DNA targeting system of any one of claims 1-161, wherein repressing transcription comprises a reduction in hepatitis B virus surface antigen (HBsAg) and / or hepatitis B virus core-related antigen (HbcrAg) protein levels.

163. The epigenetic modification DNA targeting system of any one of claims 1-162, wherein repressing transcription comprises a reduction of HBsAg transcript and / or protein levels by at least 90%.

164. The epigenetic modification DNA targeting system of any one of claims 1-163, wherein repressing transcription comprises a reduction of HbcrAg transcript and / or protein levels from cccDNA by at least 50%.

165. A guide RNA (gRNA) that binds to a target site in a hepatitis B virus DNA sequence.

166. The gRNA of claim 165, wherein the hepatitis B virus DNA sequence is a hepatitis B virus (HBV) gene or a regulatory element thereof.

167. The gRNA of claim 165 or claim 166, wherein the target site exists in the form of covalently closed circular DNA (cccDNA), relaxed circular DNA (rcDNA), and / or is integrated into human genomic DNA.

168. The gRNA of any one of claims 165-167, wherein the target site is at or near a gene or regulatory element thereof involved in controlling HBV replication and / or HBV transcription.

169. The gRNA of claim 168, wherein the gene involved in controlling HBV replication and / or HBV transcription encodes a polymerase, an envelope protein, a capsid protein, a transcription factor, or a transcriptional transactivator.

170. The gRNA of claim 168 or claim 169, wherein the gene involved in controlling HBV replication and / or HBV transcription is a polymerase gene, an S family gene, an X gene, or a core family gene.

171. The gRNA of any one of claims 165-170, wherein the target site is in a gene encoding the X gene of the Hepatitis B virus X protein (HBx) or a regulatory element thereof.

172. The gRNA of any one of claims 165-171, wherein the target site is at or near a regulatory element involved in controlling HBV replication and / or HBV transcription.

173. The gRNA of claims 166-172, wherein the regulatory element is a promoter region.

174. The gRNA of claim 173, wherein the promoter region is a pre-S1 promoter, a pre-S2 promoter, an X promoter, or a basic core promoter.

175. The gRNA of any one of claims 166-172, wherein the regulatory element is an enhancer region.

176. The gRNA of claim 175, wherein the enhancer region is an Enh1 or Enh2 enhancer region.

177. The gRNA of any one of claims 166-172, wherein the regulatory element is a transcript processing control region.

178. The gRNA of any one of claims 165-171, wherein the target site is a coding region.

179. The gRNA of any one of claims 165-178, wherein the target site is located within 500 bp, within 1000 bp, or within 1500 bp of the transcription start site.

180. The gRNA of any one of claims 165-179, wherein the target site is located within a target region having a sequence corresponding to a sequence positioned between 0-3300 base pairs (bp) of the HBV genome, optionally at base pairs between 0-3189 bp of the HBV genome, with reference to the HBV genome shown in SEQ ID NO:

650.

181. The gRNA of any one of claims 165-180, wherein the target site is located within a target region having a sequence corresponding to a sequence located at base pairs between 43bp-490bp, 1033bp-1749bp, 1800bp-1950bp, or 2953bp-3182bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

182. The gRNA of any one of claims 165-181, wherein the target site is located within a target region having a sequence corresponding to a sequence located at base pairs between 1bp-42bp, 491bp-1032bp, 1750bp-1799bp or 1951bp-2952bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

183. The gRNA of any one of claims 165-182, wherein the target site is in a CpG island of the HBV genome.

184. The gRNA of any one of claims 165-183, wherein the target site is located within a target region having a sequence corresponding to a sequence located at base pairs between 67bp-392bp, 1033bp-1749bp, or 2215bp-2490bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

185. The gRNA of any one of claims 165-184, wherein the target site is located within a target region having a sequence corresponding to a sequence located at base pairs between 1033bp-1749bp of the HBV genome of the reference HBV genome shown in SEQ ID NO:

650.

186. The gRNA of any one of claims 165-185, wherein the target site is within a target region spanning within 300 base pairs upstream of the start codon of hepatitis B virus X protein (HBx).

187. A gRNA (gRNA) that binds to a target site within a target region spanning 300 base pairs upstream of the start codon of hepatitis B virus X protein (HBx).

188. The gRNA of any one of claims 165-187, wherein the target site is located in the HBx basic core promoter region.

189. The gRNA of any one of claims 165-187, wherein the target site is located within the HBx promoter / enhancer region.

190. The gRNA of any one of claims 165-189, wherein the target site is within a target region spanning within 250 base pairs upstream of the start codon of hepatitis B virus X protein (HBx).

191. The gRNA of any one of claims 165-190, wherein the target site is within a target region having a sequence corresponding to a sequence located at base pairs between 1060-1480 bp of the HBV genome of the reference HBV genome shown in SEQ ID NO:

650.

192. The gRNA of any one of claims 165-191, wherein the target site is within a target region spanning within 150 base pairs upstream of the start codon of hepatitis B virus X protein (HBx).

193. The gRNA of any one of claims 165-192, wherein the target site is within a target region spanning within 120 base pairs upstream of the start codon of hepatitis B virus X protein (HBx).

194. The gRNA of any one of claims 165-193, wherein the target site is within a target region having a sequence corresponding to a sequence located at base pairs between 1250-1374 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

195. The gRNA of any one of claims 165-194, wherein the target site is within a target region having a sequence corresponding to a sequence located at base pairs between 1255-1302 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

196. The gRNA of any one of claims 165-195, wherein the target site is within a target region having a sequence corresponding to a sequence located at base pairs between 1260-1300 bp of the HBV genome of the reference HBV genome shown in SEQ ID NO:

650.

197. The gRNA of any one of claims 165-196, wherein the gRNA comprises SEQ ID NO: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 369, 370, 371, 377, 380, 384, 385 or 387, a contiguous portion of at least 14 nucleotides thereof, or the complement of any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in SEQ ID Any one of NO: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582.

198. The gRNA of any one of claims 165-196, wherein the gRNA is as shown in any one of SEQ ID NOs: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580, or 582.

199. The gRNA of any one of claims 165-198, wherein the gRNA comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any one of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, or 582.

200. The gRNA of any one of claims 165-199, wherein the gRNA comprises a sequence shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, or 582.

201. The gRNA of any one of claims 165-200, wherein the gRNA comprises the sequence shown in SEQ ID NO: 217, a contiguous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO:

412.

202. The gRNA of any one of claims 165-201, wherein the gRNA comprises the sequence shown in SEQ ID NO:

412.

203. A CRISPR Cas-guide RNA (gRNA) combination, comprising: (a) a clustered regularly interspaced short palindromic repeats-associated (Cas) protein or a variant thereof; and (b) at least one gRNA according to any one of claims 165-202, which targets the Cas protein or its variant to a target site in a target site in a hepatitis B virus DNA sequence.

204. The CRISPR Cas-gRNA combination of claim 203, wherein the Cas protein or variant thereof is a Cas9 protein or a variant thereof.

205. The CRISPR Cas-gRNA combination of claim 203 or claim 204, wherein the Cas protein or variant thereof is a variant Cas protein, wherein the variant Cas protein lacks nuclease activity or is an inactivated Cas (dCas) protein.

206. The CRISPR Cas-gRNA combination of claims 203-205, wherein the variant Cas protein is a variant Cas9 protein that lacks nuclease activity or is an inactivated Cas9 (dCas9) protein.

207. The CRISPR Cas-gRNA combination of any one of claims 203-206, wherein the Cas9 protein or variant thereof is a Staphylococcus aureus Cas9 (SaCas9) protein or a variant thereof.

208. The CRISPR Cas-gRNA combination of claim 207, wherein the variant Cas9 is a Staphylococcus aureus dCas9 protein (dSaCas9) comprising at least one amino acid mutation selected from D10A and N580A, with reference to the position numbering of SEQ ID NO:

596.

209. The CRISPR Cas-gRNA combination of claim 207 or claim 208, wherein the variant Cas9 protein comprises the sequence shown in SEQ ID NO: 597, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

210. The CRISPR Cas-gRNA combination of any one of claims 203-206, wherein the Cas9 protein or variant thereof is a Streptococcus pyogenes Cas9 (SpCas9) protein or a variant thereof.

211. The CRISPR Cas-gRNA combination of claim 210, wherein the variant Cas9 is a Streptococcus pyogenes dCas9 (dSpCas9) protein comprising at least one amino acid mutation selected from D10A and H840A, with reference to the numbering of positions of SEQ ID NO:

598.

212. The CRISPR Cas-gRNA combination of claim 210 or claim 211, wherein the variant Cas9 protein comprises the sequence shown in SEQ ID NO: 599, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

213. A polynucleotide encoding the epigenetic modification DNA targeting system of any one of claims 1-164 or a fusion protein of the DNA targeting system of any one of claims 1-164, the gRNA of any one of claims 165-202, the CRISPR Cas-gRNA combination of any one of claims 203-212, or a portion or component of any of the foregoing.

214. A plurality of polynucleotides encoding the epigenetic modification DNA targeting system of any one of claims 1-164 or a fusion protein of the DNA targeting system of any one of claims 1-164, the gRNA of any one of claims 165-202, the CRISPR Cas-gRNA combination of any one of claims 203-212, or a portion or component of any of the foregoing.

215. A vector comprising the polynucleotide according to claim 213.

216. A vector comprising a plurality of polynucleotides according to claim 214.

217. The vector of any one of claims 215 or 216, wherein the vector is a viral vector.

218. The vector of claim 217, wherein the vector is an adeno-associated virus (AAV) vector.

219. The vector of claim 218, wherein the vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9.

220. The vector of claim 219, wherein the vector is a lentiviral vector.

221. The vector of claim 215 or claim 216, wherein the vector is a non-viral vector.

222. The vector of claim 221, wherein the non-viral vector is selected from the group consisting of: lipid nanoparticles, liposomes, exosomes, or cell penetrating peptides.

223. The vector of any one of claims 215-222, wherein the vector exhibits tropism for hepatitis B virus-infected cells, optionally wherein the infected cells are hepatocytes.

224. The vector of any one of claims 215-223, wherein the vector comprises one vector or two or more vectors.

225. A method for promoting epigenetic modification within a target region in a hepatitis B virus sequence, the method comprising introducing an epigenetic modification DNA targeting system that targets a target site within the target region into an HBV-infected cell containing a hepatitis virus sequence.

226. A method for increasing CpG methylation within a target region in a hepatitis B virus sequence, the method comprising introducing an epigenetic modification DNA targeting system targeted to a target site within the target region into an HBV-infected cell comprising a hepatitis virus sequence.

227. A method for promoting epigenetic modification of a target region in a hepatitis B virus sequence, the method comprising introducing into an HBV-infected cell comprising a hepatitis B virus sequence an epigenetic modification DNA targeting system according to any one of claims 1-164, a gRNA according to any one of claims 165-202, a CRISPR Cas-gRNA combination according to any one of claims 203-212, a polynucleotide according to claim 213, a plurality of polynucleotides according to claim 214, a vector according to any one of claims 215-224, or a part or component of any one of the foregoing.

228. A method for increasing CpG methylation of a target region in a hepatitis B virus sequence, the method comprising introducing into an HBV-infected cell comprising a hepatitis B virus sequence an epigenetic modification DNA targeting system according to any one of claims 1-164, a gRNA according to any one of claims 165-202, a CRISPR Cas-gRNA combination according to any one of claims 203-212, a polynucleotide according to claim 213, a plurality of polynucleotides according to claim 214, a vector according to any one of claims 215-224, or a part or component of any one of the foregoing.

229. The method of any one of claims 225-228, wherein the target region comprises a contiguous nucleotide sequence within a sequence corresponding to a sequence at base pairs between 1033 bp-1749 bp in the hepatitis B virus sequence located at a nucleotide position with reference to SEQ ID NO:

650.

230. A method for reducing transcription of one or more genes in an HBV-infected cell comprising a hepatitis B virus sequence, the method comprising introducing into the cell an epigenetic modification DNA targeting system that induces targeted CpG methylation within the hepatitis B virus sequence at a nucleotide position with reference to SEQ ID NO:

650.

231. A method for reducing hepatitis B virus infection in HBV-infected cells, the method comprising introducing an epigenetic modification DNA targeting system into a cell containing a hepatitis B virus sequence, wherein the epigenetic modification DNA targeting system induces targeted CpG methylation within a target region in the hepatitis B virus sequence at a nucleotide position with reference to SEQ ID NO:

650.

232. The method of any one of claims 225-231, wherein the epigenetic modification DNA targeting system comprises at least one DNA targeting module comprising a fusion protein comprising (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence; and (b) at least one effector domain comprising a DNA methyltransferase effector domain.

233. The method of any one of claims 226 and 228-232, wherein the region of CpG methylation is within 500 base pairs of the target region.

234. The method of claims 225-233, wherein the introducing occurs in vivo or ex vivo in a subject.

235. The method of any one of claims 225-234, wherein the cell is a mammalian cell.

236. The method of any one of claims 225-235, wherein the cell is a human cell.

237. The method of any one of claims 225-236, wherein the cells contain integrated HBV DNA.

238. The method of any one of claims 225-237, wherein the cells are hepatocytes comprising a pool of cell-free HBV cccDNA.

239. The method of any one of claim 238, wherein the hepatocytes express HBV proteins, wherein the HBV proteins are HBsAg, HBeAg, or HBcrAg, or a combination thereof.

240. A method for reducing hepatitis virus infection in a subject, the method comprising administering to a subject infected with hepatitis B an epigenetic modification DNA targeting system that increases CpG methylation within a target region in a hepatitis B virus sequence, wherein the epigenetic modification DNA targeting system comprises (a) a DNA binding domain for targeting a target site in a hepatitis B virus DNA sequence; and (b) at least one effector domain comprising a DNA methyltransferase effector domain.

241. The method of any one of claims 225-240, wherein the target region is a region containing CpG in the HBV genome.

242. The method of any one of claims 225-241, wherein the target region comprises a contiguous nucleotide sequence corresponding to a sequence located at base pairs between 67bp-392bp, 1033bp-1749bp, or 2215bp-2490bp in the hepatitis B virus sequence with reference to the nucleotide position of SEQ ID NO:

650.

243. The method of any one of claims 225-242, wherein the target region comprises a contiguous nucleotide sequence corresponding to a sequence located at base pairs between 1033 bp-1749 bp in the hepatitis B virus sequence with reference to the nucleotide position of SEQ ID NO:

650.

244. The method of any one of claims 225-243, wherein the target region is located within 300 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx).

245. The method of any one of claims 225-244, wherein the target region is within the HBx basic core promoter region.

246. The method of any one of claims 225-245, wherein the target region is within the HBx promoter / enhancer region.

247. The method of any one of claims 225-246, wherein the target region is within 250 base pairs upstream of the hepatitis B virus X protein (HBx) start codon.

248. The method of any one of claims 225-247, wherein the target region comprises a contiguous nucleotide sequence corresponding to a sequence between base pairs 1060 bp-1480 bp in the hepatitis B virus sequence located at the nucleotide position with reference to SEQ ID NO:

650.

249. The method of any one of claims 225-248, wherein the target region is within 150 base pairs upstream of the hepatitis B virus X protein (HBx) start codon.

250. The method of any one of claims 225-249, wherein the target region is within 120 base pairs upstream of the start codon of the hepatitis B virus X protein (HBx).

251. The method of any one of claims 225-250, wherein the target region comprises a contiguous nucleotide sequence corresponding to a sequence between base pairs 1250 bp-1374 bp in the hepatitis B virus sequence located at the nucleotide position with reference to SEQ ID NO:

650.

252. The method of any one of claims 225-251, wherein the target region comprises a contiguous nucleotide sequence corresponding to a sequence between base pairs 1260 bp-1300 bp in the hepatitis B virus sequence located at the nucleotide position with reference to SEQ ID NO:

650.

253. The method of claims 225-252, wherein the DNA binding domain comprises a clustered regularly interspaced short palindromic repeats-associated (Cas)-guide RNA (gRNA) combination comprising (a) a Cas protein or a variant thereof and (b) at least one gRNA; a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a meganuclease; a homing endonuclease; or an I-SceI enzyme or a variant thereof, optionally wherein the DNA binding domain comprises a catalytically inactive variant of any one of the foregoing.

254. The method of any one of claims 225-253, comprising a CRISPR Cas-guide RNA (gRNA) combination comprising: (a) a clustered regularly interspaced short palindromic repeats-associated (Cas) protein or a variant thereof; and (b) at least one gRNA according to any one of claims 165-202, which targets the Cas protein or its variant to a target site in a target site in a hepatitis B virus DNA sequence.

255. The method of any one of claims 225-254, wherein the or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 5, 6, 12, 18, 22, 26, 29, 38, 42, 43, 51, 56, 61, 63, 68, 72, 75, 79, 82, 84, 88, 89, 98, 99, 113, 116, 121, 124, 125, 118, 130, 133, 135, 138, 143, 150, 152, 155, 158, 164, 165, 175, 176, 182, 185, 189, 190, 192, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of any of the foregoing.

256. The method of any one of claims 225-255, wherein the or each of the target sites comprises a sequence as set forth in any one of SEQ ID NOs: 12, 18, 20, 22, 26, 27, 46, 50, 63, 66, 73, 79, 185, 192, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence to any one of the foregoing.

257. The method of any one of claims 225-256, wherein the or each of the target sites comprises the sequence shown in SEQ ID NO: 22, a contiguous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing.

258. The method of any one of claims 225-257, wherein the gRNA or each of the gRNAs comprises SEQ ID NO: 200, 201, 207, 217, 221, 224, 233, 237, 238, 246, 251, 256, 258, 263, 267, 274, 270, 277, 279, 283, 284, 293, 294, 308, 311, 313, 316, 319, 320, 325, 328, 330, 333, 338, 345, 347, 350, 353, 359, 360, 370, 371, 377, 380, 384, 385, 387, a contiguous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in SEQ ID Any one of NO: 395, 402, 408, 412, 416, 419, 428, 432, 433, 441, 446, 451, 453, 458, 462, 465, 469, 472, 474, 478, 479, 488, 489, 503, 506, 508, 511, 514, 515, 520, 523, 525, 575, 528, 533, 540, 542, 545, 548, 554, 555, 565, 566, 572, 579, 580 or 582.

259. The method of any one of claims 225-258, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NOs: 207, 213, 215, 217, 221, 222, 241, 245, 258, 261, 268, 274, 380, 387, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any one of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NOs: 402, 408, 410, 412, 416, 417, 436, 440, 453, 456, 463, 469, 575, 582.

260. The method of any one of claims 225-259, wherein the gRNA or each of the gRNAs comprises a sequence as shown in any one of SEQ ID NO: 217, a contiguous portion of at least 14 nucleotides thereof, or a complementary sequence to any of the foregoing, optionally wherein the gRNA or each of the gRNAs is as shown in any one of SEQ ID NO:

412.

261. The method of any one of claims 225-253, wherein the at least one DNA binding domain comprises an engineered zinc finger protein (eZFP).

262. The method of any one of claims 225-253 or 261, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, 1052, a contiguous portion of at least 12 nt thereof, or a complementary sequence of any one of the foregoing.

263. The method of any one of claims 225-253 or 261-262, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, and 1052.

264. The method of any one of claims 225-263, wherein at least one effector domain is a DNA methyltransferase.

265. The method of any one of claims 225-264, wherein at least one effector domain comprises a DNA methyltransferase and a repressor domain capable of recruiting a heterochromatin inducing factor, or optionally wherein the heterochromatin inducing factor comprises a histone methyltransferase.

266. The method of any one of claims 225-265, wherein the at least one effector domain comprises a DNA methyltransferase and a histone methyltransferase.

267. The method of any one of claims 225-266, wherein the at least one effector domain comprises a DNMT3A / L domain or a variant thereof.

268. The method of any one of claims 225-267, wherein the at least one effector domain comprises the sequence set forth in SEQ ID NO:651, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

269. The method of any one of claims 225-268, wherein the at least one effector domain further comprises a KRAB domain or a variant thereof.

270. The method of any one of claims 225-269, wherein the at least one effector domain further comprises the sequence set forth in SEQ ID NO:590, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

271. The method of any one of claims 225-270, wherein the DNA targeting system comprises a DNMT3A / 3L-dCas9-KRAB domain or a variant thereof.

272. The method of any one of claims 225-271, wherein the DNA targeting system comprises the sequence shown in SEQ ID NO: 645, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

273. The method of any one of claims 225-260 or 264-272, wherein the DNA targeting system comprises the sequence shown in SEQ ID NO: 680, a portion thereof, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing.

274. The method of any one of claims 225-260 or 264-273, wherein the DNA targeting system comprises the sequence shown in SEQ ID NO:

680.

275. A method for suppressing transcription of one or more genes in a hepatitis B virus-infected cell, the method comprising introducing into the hepatitis B virus-infected cell an epigenetic modification DNA targeting system according to any one of claims 1-164, a gRNA according to any one of claims 165-202, a CRISPR Cas-gRNA combination according to any one of claims 203-212, a polynucleotide according to claim 213, a plurality of polynucleotides according to claim 214, a vector according to any one of claims 215-224, or a part or component of any one of the foregoing.

276. The method of claims 225-275, wherein the DNA targeting system epigenetically modifies the one or more genes.

277. The method of claims 225-275, wherein transcription of the one or more genes is reduced compared to a comparable cell not subjected to the method.

278. The method of claim 277, wherein transcription of the one or more genes is reduced by at least about 1.25-fold, 1.5-fold, 1.75-fold, 2.0-fold, 2.5-fold, 2.75-fold, 3.0-fold, 3.5-fold, 3.75-fold, 4.0-fold, 4.5-fold, 4.75-fold, 5.0-fold, 5.25-fold, 5.5-fold, 5.75-fold, or 6-fold.

279. The method of any one of claims 225-278, wherein suppressing transcription of the one or more genes results in reduced HBV replication and / or HBV transcription.

280. The method of any one of claims 225-279, wherein the HBV-infected cell is a mammalian cell.

281. The method of any one of claims 225-280, wherein the HBV-infected cells are human cells.

282. The method of any one of claims 225-281, wherein the cells contain integrated HBV DNA.

283. The method of any one of claims 225-282, wherein the cells are hepatocytes comprising a pool of cell-free HBV cccDNA.

284. The method of any one of claims 225-283, wherein the hepatocytes express HBV proteins, wherein the HBV proteins are HBsAg and / or HBeAg.

285. The method of any one of claims 225-284, wherein the HBV-infected cells are present in a subject.

286. The method of any one of claims 225-285, wherein the subject is human.

287. The method of any one of claims 225-286, wherein the subject has HBV viral infection.

288. The method of any one of claims 225-287, wherein the subject has hepatocytes containing integrated HBV DNA.

289. The method of any one of claims 225-288, wherein the subject has hepatocytes comprising a pool of cell-free HBV cccDNA.

290. The method of any one of claims 225-289, wherein the subject has hepatocytes that express HBV proteins, wherein the HBV proteins are HBsAg, HBeAg, or HBcrAg, and combinations thereof.

291. The method of any one of claims 225-290, wherein the subject suffers from a disease, condition, or disorder associated with the HBV viral infection.

292. The method of any one of claims 291, wherein the disease, condition, or disorder is liver disease or cancer.

293. The method of any one of claim 291 or claim 292, wherein the disease, condition, or disorder is acute hepatitis, chronic hepatitis, liver failure, or cirrhosis.

294. The method of any one of claims 291-293, wherein the disease, condition or disorder is cancer, optionally wherein the cancer is hepatocellular carcinoma.

295. A pharmaceutical composition comprising the carrier of any one of claims 215-224.

296. The pharmaceutical composition of claim 295, wherein the carrier is conjugated to an amino sugar derivative of galactose, optionally wherein the carrier is conjugated to an N-acetylgalactosamine (GalNAc) moiety.

297. A pharmaceutical composition comprising the epigenetic modification DNA targeting system of any one of claims 1-164 or the fusion protein of any one of claims 1-164, the gRNA of any one of claims 165-202, the CRISPR Cas-gRNA combination of any one of claims 203-212, the polynucleotide of claim 213, the multiple polynucleotides of claim 214, the vector of any one of claims 215-224, or a part or component of any of the foregoing.

298. The pharmaceutical composition of claims 295-297, for use in treating HBV viral infection in a subject.

299. A pharmaceutical composition according to any one of claims 295-298, wherein the subject suffers from a disease, condition or disorder associated with the HBV viral infection.

300. The pharmaceutical composition of claims 295-299 for use in treating a disease, disorder or condition associated with HBV viral infection in a subject.

301. A pharmaceutical composition according to any one of claims 295-300, for use in the preparation of a medicament for treating HBV viral infection in a subject.

302. The pharmaceutical composition for use according to any one of claims 298-301, wherein the HBV viral infection is associated with a disease, disorder or condition.

303. A pharmaceutical composition according to any one of claims 295-300, for use in the preparation of a medicament for treating a disease, condition or disorder associated with HBV viral infection in a subject.

304. The pharmaceutical composition of claim 299, 300, 302 or 303, wherein the disease, condition or disorder is liver disease or cancer.

305. The pharmaceutical composition of claim 299, 300, 302 or 303, wherein the disease, condition or disorder is acute hepatitis, chronic hepatitis, liver failure or cirrhosis.

306. The pharmaceutical composition of claim 299, 300, 302, 303 or 304, wherein the disease, condition or disorder is cancer, optionally hepatocellular carcinoma.

307. The pharmaceutical composition of any one of claims 295-306, wherein the pharmaceutical composition is to be administered to the subject in vivo.

308. The pharmaceutical composition of any one of claims 295-307, wherein after administration of the pharmaceutical composition, transcription of one or more HBV genes is repressed in cells of the subject.

309. A pharmaceutical composition according to claim 308, wherein the one or more HBV genes are involved in controlling HBV replication and / or HBV transcription.

310. The pharmaceutical composition of claim 308 or 309, wherein the one or more genes are polymerase genes, S family genes, X genes, or core family genes.

311. A method for treating a disease, condition or disorder in a subject in need thereof, comprising administering to the subject an epigenetic modification DNA targeting system according to any one of claims 1-164, a gRNA according to any one of claims 165-202, a CRISPR Cas-gRNA combination according to any one of claims 203-212, a polynucleotide according to claim 213, a plurality of polynucleotides according to claim 214, a vector according to any one of claims 215-224, a pharmaceutical composition according to any one of claims 297-310, or a portion or component of any of the foregoing.

312. A method of reducing hepatitis B virus infection in a subject, the method comprising administering to a subject having hepatitis B virus infection an epigenetic modification DNA targeting system according to any one of claims 1-164, a gRNA according to any one of claims 165-202, a CRISPR Cas-gRNA combination according to any one of claims 203-212, a polynucleotide according to claim 213, a plurality of polynucleotides according to claim 214, a vector according to any one of claims 215-224, a pharmaceutical composition according to any one of claims 297-310, or a portion or component of any of the foregoing.

313. An engineered zinc finger protein (eZFP) that binds to a target site in one or more HBV genes or their regulatory elements, wherein the target site is within a target region having a sequence corresponding to a sequence located at base pairs between 1033bp-1749bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

314. The eZFP of claim 313, wherein the target site is within a target region spanning within 300 base pairs upstream of the start codon of the Hepatitis B virus X protein (HBx).

315. The eZFP of claim 313 or claim 314, wherein the target site is located in the HBx basic core promoter region.

316. The eZFP of claim 313 or claim 314, wherein the target site is located within the HBx promoter / enhancer region.

317. The eZFP of any one of claims 313-316, wherein the target site is within a target region spanning within 250 base pairs upstream of the start codon of the Hepatitis B virus X protein (HBx).

318. The eZFP of any one of claims 313-317, wherein the target site is within a target region having a sequence corresponding to a sequence located between base pairs 1060-1480 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

319. The eZFP of any one of claims 313-318, wherein the target site is within a target region spanning within 150 base pairs upstream of the start codon of the Hepatitis B virus X protein (HBx).

320. The eZFP of any one of claims 313-319, wherein the target site is within a target region spanning within 120 base pairs upstream of the start codon of the Hepatitis B virus X protein (HBx).

321. The eZFP of any one of claims 313-320, wherein the target site is within a target region having a sequence corresponding to a sequence located between base pairs 1250-1374 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO:

650.

322. The eZFP of any one of claims 313-321, wherein the target site is within a target region having a sequence corresponding to a sequence located between base pairs 1255-1302 bp of the HBV genome with reference to the HBV genome set forth in SEQ ID NO:

650.

323. The eZFP of any one of claims 313-322, wherein the target site is within a target region having a sequence corresponding to a sequence located between base pairs 1260-1300 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

324. The eZFP of claim 323, wherein the target site is within a target region having a sequence corresponding to a sequence located between base pairs 1255 bp-1290 bp of the HBV genome with reference to the HBV genome shown in SEQ ID NO:

650.

325. The eZFP of any one of claims 313-324, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1028-1055, at least a 12 nt contiguous portion thereof, or a complementary sequence of any one of the foregoing.

326. The eZFP of any one of claims 313-325, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1028-1055.

327. The eZFP of any one of claims 313-326, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, or 1052, at least a 12 nt contiguous portion thereof, or a complementary sequence of any one of the foregoing.

328. The eZFP of any one of claims 313-326, wherein the target site comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1045, 1046, or 1052.

329. The eZFP of any one of claims 313-328, wherein the zinc finger protein comprises six zinc fingers designated F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); <h2 style=";text-align:left;direction:ltr">2)F1:RSDVLST(SEQ ID NO:726)F2:DNSSRTR(SEQ ID NO:727)F3:RPYTLRL(SEQ ID NO:728)F4:DSSHRTR(SEQ ID NO:729)F5:RSDHLSQ(SEQ ID NO:730)F6:DSSHRTR(SEQ ID NO:731); <h2 style=";text-align:left;direction:ltr"> 3)F1:RSDHLSQ(SEQ ID NO:732)F2:QSADRTK(SEQ ID NO:733)F3:RSDHLSQ(SEQ ID NO:734)F4:RRSDLKR(SEQ ID NO:735)F5:RSDHLSR(SEQ ID NO:736)F6:QSSDLRR(SEQ ID NO:737); <h2 style=";text-align:left;direction:ltr"> 4)F1:RSDNLSE(SEQ ID NO:738)F2:TSSNRKT(SEQ ID NO:739)F3:DRSHLTR(SEQ ID NO:740)F4:RSDALTQ(SEQ ID NO:741)F5:DRSALAR(SEQ ID NO:742)F6:RRFTLSK(SEQ ID NO:743); <h2 style=";text-align:left;direction:ltr"> 5)F1:RSDHLSE(SEQ ID NO:744)F2:QYSGRYY(SEQ ID NO:745)F3:HGQTLNE(SEQ ID NO:746)F4:QSGNLAR(SEQ ID NO:747)F5:RSDSLLR(SEQ ID NO:748)F6:CREYRGK(SEQ ID NO:749); <h2 style=";text-align:left;direction:ltr"> 6)F1:QSANRTT(SEQ ID NO:750)F2:RSANLTR(SEQ ID NO:751)F3:RSDVLSE(SEQ ID NO:752)F4:TSGHLSR(SEQ ID NO:753)F5:QSSDLSR(SEQ ID NO:754)F6:QWSTRKR(SEQ ID NO:755); <h2 style=";text-align:left;direction:ltr"> 7)F1:QSGNLAR(SEQ ID NO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ ID NO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761); <h2 style=";text-align:left;direction:ltr">8)F1:NPANLTR(SEQ ID NO:762)F2:QNATRTK(SEQ ID NO:763)F3:QSGHLAR(SEQ ID NO:764)F4:NRHDRAK(SEQ ID NO:765)F5:RSDHLSE(SEQ ID NO:766)F6:QRRSRYK(SEQ ID NO:767); <h2 style=";text-align:left;direction:ltr"> 9)F1:QSSDLSR(SEQ ID NO:768)F2:HRSTRNR(SEQ ID NO:769)F3:RSDVLSA(SEQ ID NO:770)F4:DSRTRKN(SEQ ID NO:771)F5:QSGSLTR(SEQ ID NO:772)F6:DQSGLAH(SEQ ID NO:773); <h2 style=";text-align:left;direction:ltr"> 10)F1:QNPAQWR(SEQ ID NO:774)F2:RSADLSR(SEQ ID NO:775)F3:TSGSLSR(SEQ ID NO:776)F4:RSDHLSR(SEQ ID NO:777)F5:RSDSLLR(SEQ ID NO:778)F6:QSYDRFQ(SEQ IDNO:779); <h2 style=";text-align:left;direction:ltr"> 11)F1:TSGSLSR(SEQ ID NO:780)F2:RSDHLSR(SEQ ID NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ ID NO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ IDNO:785); <h2 style=";text-align:left;direction:ltr"> 12)F1:DRSNLSR(SEQ ID NO:786)F2:LRQNLIM(SEQ ID NO:787)F3:ERGTLAR(SEQ IDNO:788)F4:RSDALTQ(SEQ ID NO:789)F5:RSDSLSQ(SEQ ID NO:790)F6:RKADRTR(SEQ IDNO:791); <h2 style=";text-align:left;direction:ltr"> 13)F1:QYCCLTN(SEQ ID NO:792)F2:TSGNLTR(SEQ ID NO:793)F3:QSSDLSR(SEQ IDNO:794)F4:FRYYLKR(SEQ ID NO:795)F5:QSGDLTR(SEQ ID NO:796)F6:DKGNLTK(SEQ IDNO:797); <h2 style=";text-align:left;direction:ltr">14) F1:TSGSLSR(SEQ ID NO:798) F2:RSDNLTT(SEQ ID NO:799) F3:QSGNLAR(SEQ ID NO:800) F4:DRTTLMR(SEQ ID NO:801) F5:QSGHLAR(SEQ ID NO:802) F6:QLTHLNS(SEQ IDNO:803); <h2 style=";text-align:left;direction:ltr"> 15) F1: IKHDLHR(SEQ ID NO: 804) F2: RSANLTR(SEQ ID NO: 805) F3: RSDNLAR(SEQ ID NO: 806) F4: QNVSRPR(SEQ ID NO: 807) F5: RSDDLSK(SEQ ID NO: 808) F6: DSSHRTR(SEQ ID NO: 809); <h2 style=";text-align:left;direction:ltr"> 16)F1:RSDNLAR(SEQ ID NO:810)F2:QNVSRPR(SEQ ID NO:811)F3:RSDDLSK(SEQ ID NO:812)F4:DSSHRTR(SEQ ID NO:813)F5:TSSNRKT(SEQ ID NO:814)F6:AQWTRAC(SEQ IDNO:815); <h2 style=";text-align:left;direction:ltr"> 17)F1:RSDDLSK(SEQ ID NO:816)F2:DSSHRTR(SEQ ID NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ IDNO:821); <h2 style=";text-align:left;direction:ltr"> 18) F1: QSAHRKN(SEQ ID NO: 822) F2: TSNRKT(SEQ ID NO: 823) F3: RSDNLSA(SEQ ID NO: 824) F4: RNNDRKT(SEQ ID NO: 825) F5: TSGSLSR(SEQ ID NO: 826) F6: QAGHLAK(SEQ ID NO: 827); <h2 style=";text-align:left;direction:ltr"> 19)F1:RSDHLSQ(SEQ ID NO:828)F2:ASSTRTK(SEQ ID NO:829)F3:RSDDLTR(SEQ IDNO:830)F4:QKSNLSS(SEQ ID NO:831)F5:QSANRTT(SEQ ID NO:832)F6:QNATRTK(SEQ) IDNO:833); <h2 style=";text-align:left;direction:ltr">20)F1:RSDTLSE(SEQ ID NO:834)F2:RRWTLVG(SEQ ID NO:835)F3:DRSNLSR(SEQ ID NO:836)F4:QSGDLTR(SEQ ID NO:837)F5:QSSDLSR(SEQ ID NO:838)F6:YHWYLKK(SEQ IDNO:839); <h2 style=";text-align:left;direction:ltr"> 21)F1:RSANLAR(SEQ ID NO:840)F2:RSDNLRE(SEQ ID NO:841)F3:RPYTLRL(SEQ ID NO:842)F4:HRSNLNK(SEQ ID NO:843)F5:QSGSLTR(SEQ ID NO:844)F6:TSANLSR(SEQ IDNO:845); <h2 style=";text-align:left;direction:ltr"> 22) F1:RSDDLVR(SEQ ID NO:846) F2:TSGSLVR(SEQ ID NO:847) F3:RSDKLVR(SEQ ID NO:848) F4:RSDELVR(SEQ ID NO:849) F5:TSHSLTE(SEQ ID NO:850) F6:RADNLTE(SEQ IDNO:851); <h2 style=";text-align:left;direction:ltr"> 23) F1:ERSHLRE(SEQ ID NO:852) F2:TSHSLTE(SEQ ID NO:853) F3:QAGHLAS(SEQ ID NO:854) F4:TSHSLTE(SEQ ID NO:855) F5:DPGHLVR(SEQ ID NO:856) F6:TSGNLVR(SEQ IDNO:857); <h2 style=";text-align:left;direction:ltr"> 24) F1:RADNLTE(SEQ ID NO:858) F2:TSGSLVR(SEQ ID NO:859) F3:RKDNLKN(SEQ ID NO:860) F4:QSSSLVR(SEQ ID NO:861) F5:RSDKLVR(SEQ ID NO:862) F6:DSGNLRV(SEQ IDNO:863); <h2 style=";text-align:left;direction:ltr"> 25)F1:QSSSLVR(SEQ ID NO:864)F2:QSGDLRR(SEQ ID NO:865)F3:RSDERKR(SEQ IDNO:866)F4:HRTTLTN(SEQ ID NO:867)F5:RSDHLTN(SEQ ID NO:868)F6:TSGELVR(SEQ IDNO:869); 26) F1: QSGDLRR (SEQ ID NO: 870) F2: RSDERKR (SEQ ID NO: 871) F3: HRTTLTN (SEQ ID NO: 872) F4: RSDHLTN (SEQ ID NO: 873) F5: TSGELVR (SEQ ID NO: 874) F6: RSDDLVR (SEQ ID NO: 875); and 28) F1: QSSNLVR (SEQ ID NO: 882) F2: RSDDLVR (SEQ ID NO: 883) F3: THLDLIR (SEQ ID NO: 884) F4: TSGNLTE (SEQ ID NO: 885) F5: RRSACRR (SEQ ID NO: 886) F6: RNDTLTE (SEQ ID NO: 887).

330. The eZFP of any one of claims 313-329, wherein the zinc finger protein comprises six zinc fingers designated F1 to F6 in order from N-terminus to C-terminus, and wherein the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO:822) F2: TSSNRKT (SEQ ID NO:823) F3: RSDNLSA (SEQ ID NO:824) F4: RNNDRKT (SEQ ID NO:825) F5: TSGSLSR (SEQ ID NO:826) F6: QAGHLAK (SEQ ID NO:827).

331. The eZFP of any one of claims 313-329, wherein the zinc finger protein comprises six zinc fingers designated F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO:828) F2: ASSTRTK (SEQ ID NO:829) F3: RSDDLTR (SEQ ID NO:830) F4: QKSNLSS (SEQ ID NO:831) F5: QSANRTT (SEQ ID NO:832) F6: QNATRTK (SEQ ID NO:833).

332. The eZFP of any one of claims 313-329, wherein the zinc finger protein comprises six zinc fingers designated F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO:864) F2: QSGDLRR (SEQ ID NO:865) F3: RSDERKR (SEQ ID NO:866) F4: HRTTLTN (SEQ ID NO:867) F5: RSDHLTN (SEQ ID NO:868) F6: TSGELVR (SEQ ID NO:869).

333. An eZFP that binds to a target site in one or more HBV genes or regulatory elements thereof, wherein the zinc finger protein comprises six zinc fingers denoted as F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: 1) F1: SEADRSR (SEQ ID NO: 720) F2: DRSNLTR (SEQ ID NO: 721) F3: QSSDLSR (SEQ ID NO: 722) F4: YHWYLKK (SEQ ID NO: 723) F5: RSDSLSV (SEQ ID NO: 724) F6: QNANRKT (SEQ ID NO: 725); 2) F1: RSDVLST (SEQ ID NO: 726) F2: DNSSRTR (SEQ ID NO: 727) F3: RPYTLRL (SEQ ID NO: 728) F4: DSSHRTR (SEQ ID NO: 729) F5: RSDHLSQ (SEQ ID NO: 730) F6: DSSHRTR (SEQ ID NO: 731); 3) F1: RSDHLSQ (SEQ ID NO: 732) F2: QSADRTK (SEQ ID NO: 733) F3: RSDHLSQ (SEQ ID NO: 734) F4: RRSDLKR (SEQ ID NO: 735) F5: RSDHLSR (SEQ ID NO: 736) F6: QSSDLRR (SEQ ID NO: 737); 4) F1: RSDNLSE (SEQ ID NO: 738) F2: TSSNRKT (SEQ ID NO: 739) F3: DRSHLTR (SEQ ID NO: 740) F4: RSDALTQ (SEQ ID NO: 741) F5: DRSALAR (SEQ ID NO: 742) F6: RRFTLSK (SEQ ID NO: 743); <h2 style=";text-align:left;direction:ltr">5)F1:RSDHLSE(SEQ ID NO:744)F2:QYSGRYY(SEQ ID NO:745)F3:HGQTLNE(SEQ ID NO:746)F4:QSGNLAR(SEQ ID NO:747)F5:RSDSLLR(SEQ ID NO:748)F6:CREYRGK(SEQ ID NO:749); <h2 style=";text-align:left;direction:ltr"> 6)F1:QSANRTT(SEQ ID NO:750)F2:RSANLTR(SEQ ID NO:751)F3:RSDVLSE(SEQ ID NO:752)F4:TSGHLSR(SEQ ID NO:753)F5:QSSDLSR(SEQ ID NO:754)F6:QWSTRKR(SEQ ID NO:755); <h2 style=";text-align:left;direction:ltr"> 7)F1:QSGNLAR(SEQ ID NO:756)F2:ATCCLAH(SEQ ID NO:757)F3:RWQYLPT(SEQ ID NO:758)F4:DRSALAR(SEQ ID NO:759)F5:RSDNLSE(SEQ ID NO:760)F6:KRCNLRC(SEQ ID NO:761); <h2 style=";text-align:left;direction:ltr"> 8)F1:NPANLTR(SEQ ID NO:762)F2:QNATRTK(SEQ ID NO:763)F3:QSGHLAR(SEQ ID NO:764)F4:NRHDRAK(SEQ ID NO:765)F5:RSDHLSE(SEQ ID NO:766)F6:QRRSRYK(SEQ ID NO:767); <h2 style=";text-align:left;direction:ltr"> 9)F1:QSSDLSR(SEQ ID NO:768)F2:HRSTRNR(SEQ ID NO:769)F3:RSDVLSA(SEQ ID NO:770)F4:DSRTRKN(SEQ ID NO:771)F5:QSGSLTR(SEQ ID NO:772)F6:DQSGLAH(SEQ ID NO:773); <h2 style=";text-align:left;direction:ltr"> 10)F1:QNPAQWR(SEQ ID NO:774)F2:RSADLSR(SEQ ID NO:775)F3:TSGSLSR(SEQ ID NO:776)F4:RSDHLSR(SEQ ID NO:777)F5:RSDSLLR(SEQ ID NO:778)F6:QSYDRFQ(SEQ IDNO:779); <h2 style=";text-align:left;direction:ltr">11)F1:TSGSLSR(SEQ ID NO:780)F2:RSDHLSR(SEQ ID NO:781)F3:RSDSLLR(SEQ ID NO:782)F4:QSYDRFQ(SEQ ID NO:783)F5:RSDNLST(SEQ ID NO:784)F6:DNRDRIK(SEQ IDNO:785); <h2 style=";text-align:left;direction:ltr"> 12)F1:DRSNLSR(SEQ ID NO:786)F2:LRQNLIM(SEQ ID NO:787)F3:ERGTLAR(SEQ IDNO:788)F4:RSDALTQ(SEQ ID NO:789)F5:RSDSLSQ(SEQ ID NO:790)F6:RKADRTR(SEQ IDNO:791); <h2 style=";text-align:left;direction:ltr"> 13)F1:QYCCLTN(SEQ ID NO:792)F2:TSGNLTR(SEQ ID NO:793)F3:QSSDLSR(SEQ IDNO:794)F4:FRYYLKR(SEQ ID NO:795)F5:QSGDLTR(SEQ ID NO:796)F6:DKGNLTK(SEQ IDNO:797); <h2 style=";text-align:left;direction:ltr"> 14) F1:TSGSLSR(SEQ ID NO:798) F2:RSDNLTT(SEQ ID NO:799) F3:QSGNLAR(SEQ ID NO:800) F4:DRTTLMR(SEQ ID NO:801) F5:QSGHLAR(SEQ ID NO:802) F6:QLTHLNS(SEQ IDNO:803); <h2 style=";text-align:left;direction:ltr"> 15) F1: IKHDLHR(SEQ ID NO: 804) F2: RSANLTR(SEQ ID NO: 805) F3: RSDNLAR(SEQ ID NO: 806) F4: QNVSRPR(SEQ ID NO: 807) F5: RSDDLSK(SEQ ID NO: 808) F6: DSSHRTR(SEQ ID NO: 809); <h2 style=";text-align:left;direction:ltr"> 16)F1:RSDNLAR(SEQ ID NO:810)F2:QNVSRPR(SEQ ID NO:811)F3:RSDDLSK(SEQ ID NO:812)F4:DSSHRTR(SEQ ID NO:813)F5:TSSNRKT(SEQ ID NO:814)F6:AQWTRAC(SEQ IDNO:815); <h2 style=";text-align:left;direction:ltr">17)F1:RSDDLSK(SEQ ID NO:816)F2:DSSHRTR(SEQ ID NO:817)F3:TSSNRKT(SEQ ID NO:818)F4:AQWTRAC(SEQ ID NO:819)F5:RKQTRTT(SEQ ID NO:820)F6:HRSSLRR(SEQ IDNO:821); <h2 style=";text-align:left;direction:ltr"> 18) F1: QSAHRKN(SEQ ID NO: 822) F2: TSNRKT(SEQ ID NO: 823) F3: RSDNLSA(SEQ ID NO: 824) F4: RNNDRKT(SEQ ID NO: 825) F5: TSGSLSR(SEQ ID NO: 826) F6: QAGHLAK(SEQ ID NO: 827); <h2 style=";text-align:left;direction:ltr"> 19)F1:RSDHLSQ(SEQ ID NO:828)F2:ASSTRTK(SEQ ID NO:829)F3:RSDDLTR(SEQ IDNO:830)F4:QKSNLSS(SEQ ID NO:831)F5:QSANRTT(SEQ ID NO:832)F6:QNATRTK(SEQ) IDNO:833); <h2 style=";text-align:left;direction:ltr"> 20)F1:RSDTLSE(SEQ ID NO:834)F2:RRWTLVG(SEQ ID NO:835)F3:DRSNLSR(SEQ ID NO:836)F4:QSGDLTR(SEQ ID NO:837)F5:QSSDLSR(SEQ ID NO:838)F6:YHWYLKK(SEQ IDNO:839); <h2 style=";text-align:left;direction:ltr"> 21)F1:RSANLAR(SEQ ID NO:840)F2:RSDNLRE(SEQ ID NO:841)F3:RPYTLRL(SEQ ID NO:842)F4:HRSNLNK(SEQ ID NO:843)F5:QSGSLTR(SEQ ID NO:844)F6:TSANLSR(SEQ IDNO:845); <h2 style=";text-align:left;direction:ltr"> 22) F1:RSDDLVR(SEQ ID NO:846) F2:TSGSLVR(SEQ ID NO:847) F3:RSDKLVR(SEQ ID NO:848) F4:RSDELVR(SEQ ID NO:849) F5:TSHSLTE(SEQ ID NO:850) F6:RADNLTE(SEQ IDNO:851); <h2 style=";text-align:left;direction:ltr">23) F1:ERSHLRE(SEQ ID NO:852) F2:TSHSLTE(SEQ ID NO:853) F3:QAGHLAS(SEQ ID NO:854) F4:TSHSLTE(SEQ ID NO:855) F5:DPGHLVR(SEQ ID NO:856) F6:TSGNLVR(SEQ IDNO:857); <h2 style=";text-align:left;direction:ltr"> 24) F1:RADNLTE(SEQ ID NO:858) F2:TSGSLVR(SEQ ID NO:859) F3:RKDNLKN(SEQ ID NO:860) F4:QSSSLVR(SEQ ID NO:861) F5:RSDKLVR(SEQ ID NO:862) F6:DSGNLRV(SEQ IDNO:863); <h2 style=";text-align:left;direction:ltr"> 25)F1:QSSSLVR(SEQ ID NO:864)F2:QSGDLRR(SEQ ID NO:865)F3:RSDERKR(SEQ IDNO:866)F4:HRTTLTN(SEQ ID NO:867)F5:RSDHLTN(SEQ ID NO:868)F6:TSGELVR(SEQ IDNO:869); <h2 style=";text-align:left;direction:ltr"> 26)F1:QSGDLRR(SEQ ID NO:870)F2:RSDERKR(SEQ ID NO:871)F3:HRTTLTN(SEQ ID NO:872)F4:RSDHLTN(SEQ ID NO:873)F5:TSGELVR(SEQ ID NO:874)F6:RSDDLVR(SEQ IDNO:875); <h2 style=";text-align:left;direction:ltr"> 27) F1: QRAHLER(SEQ ID NO: 876) F2: QLAHLRA(SEQ ID NO: 877) F3: DPGHLVR(SEQ ID NO: 878) F4: RRSACRR(SEQ ID NO: 879) F5: RSDHLTT(SEQ ID NO: 880) F6: QSSSLVR(SEQ IDNO: 881); <h2 style=";text-align:left;direction:ltr"> 28) F1: QSSNLVR (SEQ ID NO: 882) F2: RSDDLVR (SEQ ID NO: 883) F3: THLDLIR (SEQ ID NO: 884) F4: TSGNLTE (SEQ ID NO: 885) F5: RRSACRR (SEQ ID NO: 886) F6: RNDTLTE (SEQ ID NO: 887)。 334. The eZFP of any one of claims 313-333, wherein the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NOs: 692-719, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

335. The eZFP of any one of claims 313-334, wherein the engineered zinc finger protein is encoded by a sequence shown in any one of SEQ ID NOs: 888-915, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

336. An engineered zinc finger protein that binds to a target site in one or more HBV genes or regulatory elements thereof, wherein the zinc finger protein comprises six zinc fingers designated F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: QSAHRKN (SEQ ID NO:822) F2: TSSNRKT (SEQ ID NO:823) F3: RSDNLSA (SEQ ID NO:824) F4: RNNDRKT (SEQ ID NO:825) F5: TSGSLSR (SEQ ID NO:826) F6: QAGHLAK (SEQ ID NO:827).

337. The eZFP of any one of claims 313-336, wherein the engineered zinc finger protein comprises the sequence shown in SEQ ID NO: 709, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

338. The eZFP of any one of claims 313-337, wherein the engineered zinc finger protein comprises the sequence set forth in any one of SEQ ID NO:

709.

339. The eZFP of any one of claims 313-338, wherein the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 905, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

340. The eZFP of any one of claims 313-339, wherein the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO:

905.

341. An engineered zinc finger protein that binds to a target site in one or more HBV genes or regulatory elements thereof, wherein the zinc finger protein comprises six zinc fingers denoted F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: RSDHLSQ (SEQ ID NO:828) F2: ASSTRTK (SEQ ID NO:829) F3: RSDDLTR (SEQ ID NO:830) F4: QKSNLSS (SEQ ID NO:831) F5: QSANRTT (SEQ ID NO:832) F6: QNATRTK (SEQ ID NO:833).

342. The eZFP of any one of claims 313-335 and 341, wherein the engineered zinc finger protein comprises the sequence shown in SEQ ID NO: 710, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

343. The eZFP of any one of claims 313-335, 341 and 342, wherein the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO:

710.

344. The eZFP of any one of claims 313-335 and 341-343, wherein the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 906, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

345. The eZFP of any one of claims 313-335 and 341-344, wherein the engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO:

906.

346. An engineered zinc finger protein that binds to a target site in one or more HBV genes or regulatory elements thereof, wherein the zinc finger protein comprises six zinc fingers designated F1 to F6 in order from N-terminus to C-terminus, And the amino acid sequence of each zinc finger recognition region is as follows: F1: QSSSLVR (SEQ ID NO:864) F2: QSGDLRR (SEQ ID NO:865) F3: RSDERKR (SEQ ID NO:866) F4: HRTTLTN (SEQ ID NO:867) F5: RSDHLTN (SEQ ID NO:868) F6: TSGELVR (SEQ ID NO:869).

347. The eZFP of any one of claims 313-335 and 346, wherein the engineered zinc finger protein comprises the sequence shown in SEQ ID NO: 716, or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

348. The eZFP of any one of claims 313-335, 346, and 347, wherein the engineered zinc finger protein comprises the sequence shown in any one of SEQ ID NO:

716.

349. The eZFP of any one of claims 313-335 and 346-348, wherein the engineered zinc finger protein is encoded by the sequence shown in SEQ ID NO: 912, or a portion thereof, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

350. The eZFP of any one of claims 313-335 and 346-349, wherein The engineered zinc finger protein is encoded by the sequence shown in any one of SEQ ID NO: 912.

Images