Application of Lindenamarin in preparation of medicine for preventing, relieving or / and treating acetaminophen-induced liver injury or / and acute liver failure

Abstract

The invention belongs to the technical field of biological medicines, and relates to an application of Lindenamarin in medicines for preventing, relieving or / and treating acetaminophen-induced liver injury or / and acute hepatic failure. According to the application disclosed by the invention, it is found for the first time that Linocinnamarin can be used for preventing, relieving or / and treating APAP-induced liver injury or / and acute liver failure; in addition, the invention also finds that the Linocinnamarin can improve liver cell apoptosis, inflammatory response and oxidative stress reaction caused by APAP-induced liver injury or / and acute liver failure, and also finds that the Linocinnamarin can improve the liver cell apoptosis, inflammatory response and oxidative stress reaction caused by APAP-induced liver injury. Therefore, the invention provides a new treatment thought for clinically treating the APAP-induced liver injury or / and acute liver failure.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the use of linocinnamarin in preparing a medicament for preventing, alleviating or / and treating acetaminophen-induced liver damage or / and acute liver failure. Background Art

[0002] Acetaminophen (APAP) is a widely used over-the-counter antipyretic and analgesic, widely accepted for its excellent efficacy and relatively low incidence of adverse reactions. However, in overdose or under certain conditions, APAP can cause drug-induced liver injury, one of its most serious side effects. In recent years, excessive or inappropriate use of APAP has led to an increase in hepatotoxicity and damage, making it a major cause of drug-induced liver injury and acute liver failure. Therefore, exploring the mechanisms of acetaminophen-induced liver injury and identifying new treatments are crucial.

[0003] APAP is metabolized in the liver by cytochrome P450 enzymes (primarily CYP2E1), producing a highly reactive metabolite, N-acetyl-p-benzoquinoneimine (NAPQI). Normally, NAPQI is highly toxic, but it almost immediately binds to the antioxidant glutathione (GSH) in the body, forming a harmless compound that is then eliminated. When APAP intake exceeds the liver's processing capacity, excessive NAPQI production leads to rapid depletion of glutathione reserves. Following glutathione depletion, unbound NAPQI begins to covalently bind to cellular proteins and other molecules, causing direct cellular damage. This process is accompanied by the massive generation of reactive oxygen species (ROS), further exacerbating oxidative stress. ROS can attack cell membranes, DNA, and proteins, causing lipid peroxidation, protein structural changes, and genetic damage. Oxidative stress also affects mitochondria. Mitochondrial membrane damage and dysfunction reduce ATP production, impairing cellular energy supply, and ultimately triggering cell apoptosis or necrosis. Mitochondrial damage is a key driver of hepatocellular death in APAP hepatotoxicity. Oxidative stress and liver cell damage also activate inflammatory responses, attracting immune cells to the damaged area and releasing inflammatory mediators, further exacerbating liver tissue damage. Oxidative stress plays a central role in APAP-induced liver damage, not only directly contributing to liver cell damage but also promoting subsequent inflammatory responses and cell death. Therefore, strengthening cellular antioxidant capacity can effectively alleviate oxidative stress, thereby reducing or preventing the hepatotoxic effects of APAP.

[0004] Linocinnamarin (methyl p-hydroxycinnamate-4-O-β-glucopyranoside) is a Fragaria ananassa DuchIt is a natural product isolated from the wild-type linococcinnamarin, which has anti-inflammatory and antioxidant activities. 2+ Linocinnamarin can also reduce the concentration of linocinnamarin and increase reactive oxygen species (ROS). Furthermore, linocinnamarin inhibits inflammatory responses by acting on the MAPK signaling pathway. However, the role of linocinnamarin in APAP-induced liver injury has not been reported. Summary of the Invention

[0005] In view of the problems and deficiencies in the prior art, the present invention aims to provide the use of linocinnamarin in the preparation of a medicament for preventing, alleviating and / or treating acetaminophen-induced liver damage and / or acute liver failure.

[0006] To achieve the purpose of the invention, the technical solution adopted by the present invention is as follows: A first aspect of the present invention provides the use of linocinnamarin in preparing a product for preventing, alleviating or / and treating APAP-induced liver injury or / and acute liver failure.

[0007] The second aspect of the present invention provides the use of linocinnamarin in preparing a product for preventing, reducing or / and inhibiting APAP-induced liver damage or / and hepatocyte apoptosis caused by acute liver failure.

[0008] A third aspect of the present invention provides the use of linocinnamarin in preparing a product for alleviating and / or treating APAP-induced liver damage and / or inflammatory response caused by acute liver failure.

[0009] A fourth aspect of the present invention provides the use of linocinnamarin in the preparation of a product for reducing the expression level of inflammation-related proteins caused by APAP-induced liver injury or / and acute liver failure.

[0010] Preferably, the inflammation-related proteins include IL-1β, IL-6 and TNF-α.

[0011] A fifth aspect of the present invention provides the use of linocinnamarin in the preparation of a product for inhibiting or / and reducing APAP-induced liver damage or / and oxidative stress caused by acute liver failure.

[0012] A sixth aspect of the present invention provides a medicine comprising linocinnamarin and pharmaceutically acceptable excipients.

[0013] According to the above-mentioned medicine, preferably, the dosage form of the medicine is granules, capsules, tablets, powders, oral liquids or emulsions.

[0014] Compared with the prior art, the present invention has the following positive and beneficial effects: The present invention discovers for the first time that linocinnamarin can be used to prevent, alleviate, and / or treat APAP-induced liver injury and / or acute liver failure. Furthermore, the present invention also finds that linocinnamarin can ameliorate hepatocyte apoptosis, inflammation, and oxidative stress responses caused by APAP-induced liver injury and / or acute liver failure. Therefore, the present invention provides a new therapeutic approach for the clinical treatment of APAP-induced liver injury and / or acute liver failure. Furthermore, the present invention also finds that the protective effect of linocinnamarin is associated with the promotion of the Nrf2 / HO-1 signaling pathway, while inhibition of Nrf2 significantly attenuates the hepatoprotective effect of linocinnamarin. Therefore, our results suggest that linocinnamarin can modulate the Nrf2 / HO-1 signaling pathway, thereby alleviating APAP-induced liver injury by inhibiting oxidative stress, apoptosis, and inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The results of the detection of serum ALT and AST levels in mice treated with different concentrations of Linocinnamarin after APAP liver injury modeling; A is the detection result of ALT content, B is the detection result of AST content, control represents the control group, 20 represents the Linocinnamarin-20 group, * P<0.05, ** P < 0.01; Figure 2 The left image shows the H&E staining results of mouse liver tissue and the statistical analysis results of liver tissue necrosis area. The right image shows the statistical analysis results of H&E-stained liver tissue necrosis area. * P<0.05, ** P < 0.01; Figure 3 Figure 1 shows the detection results of linocinnamarin on APAP-induced cell apoptosis; A shows TUNEL staining of mouse liver tissue (red fluorescence indicates TUNEL-positive cells); B shows the statistical analysis results of TUNEL staining of mouse liver tissue; C shows a typical band diagram of western blot detection of apoptosis-related proteins Cleaved caspase3, BAX, and BCL-2; D, E, and F show the quantitative statistical analysis results of western blot detection of apoptosis-related proteins Cleaved caspase3, BAX, and BCL-2, respectively; * P<0.05, **P < 0.01; Figure 4 Figure 1 shows the test results of the effect of linocinnamarin on APAP-induced inflammatory response; A, B, and C are the results of ELISA detection of serum Il-1β, Il-6, and TNF-α levels; D is a graph of CD11b immunofluorescence staining of mouse liver tissue (red fluorescence indicates CD11b-positive cells); E is a statistical analysis of CD11b immunofluorescence staining of mouse liver tissue; F is a graph of Ly6g immunofluorescence staining of mouse liver tissue (red fluorescence indicates Ly6g-positive cells); G is a statistical analysis of Ly6g immunofluorescence staining of mouse liver tissue; * P<0.05, ** P < 0.01; Figure 5 Figure 1 shows the test results of the effect of linocinnamarin on APAP-induced oxidative stress; A shows the test results of MDA content in mouse liver tissue; B shows the test results of SOD activity in mouse liver tissue; C shows the test results of GSH activity in mouse liver tissue; D shows DHE staining of mouse liver tissue (red fluorescence indicates positive DHE staining); E shows the statistical analysis results of DHE staining intensity in mouse liver tissue; * P<0.05, ** P < 0.01; Figure 6 Figure 1 shows the effect of linocinnamarin on Nrf2 and HO-1 expression. Figure A shows the results of qPCR detection of NRF2 mRNA expression in mouse liver tissue. Figure B shows the results of qPCR detection of HO-1 mRNA expression in mouse liver tissue. Figure C shows the typical band results of western blot detection of NRF2 and HO-1 protein expression in mouse liver tissue. Figure D and E show the quantitative statistical analysis results of western blot detection of NRF2 and HO-1 proteins, respectively. * P<0.05, ** P < 0.01; Figure 7The experimental results show that inhibiting Nrf2 weakens the protective effect of linocinnamarin against APAP-induced liver injury; A is the detection result of ALT content in mouse serum; B is the detection result of AST content in mouse serum; C is the H&E staining of mouse liver tissue; D is the statistical analysis result of necrotic area in mouse liver tissue by H&E staining; E, F, and G are the detection results of Il-1β, Il-6, and TNF-α in mouse serum by ELISA, respectively; H is the TUNEL staining of mouse liver tissue (red fluorescence indicates TUNEL-positive cells); I is the statistical analysis result of TUNEL staining of mouse liver tissue; J is the DHE staining of mouse liver tissue (red fluorescence indicates DHE-positive staining); K is the fluorescence intensity analysis of DHE staining in mouse liver tissue; * P<0.05, ** P<0.01. DETAILED DESCRIPTION

[0016] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0017] The following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0018] It should be noted that the terms used herein are intended only to describe specific embodiments and are not intended to limit the exemplary embodiments of the present invention. Experimental methods in the following examples, where specific conditions are not specified, were performed using conventional techniques in the art or in accordance with the conditions recommended by the manufacturer. Reagents and instruments used, where the manufacturer is not specified, are commercially available conventional products.

[0019] The drugs and reagents used in the following examples are as follows: Linocinnamarin was purchased from Shanghai MCE Biotechnology Co., Ltd., mouse serum inflammatory factor ELISA kit was purchased from Wuhan Sanying Biotechnology Co., Ltd., alanine aminotransferase (ALT) and aspartate aminotransferase (AST) and oxidative stress detection kits were purchased from Nanjing Jiancheng Technology Co., Ltd., BAX, BCL2, Cleaved caspase3, HO -1, NRF2 primary antibodies and goat anti-mouse and goat anti-rabbit secondary antibodies were purchased from Wuhan Sanying Biotechnology Co., Ltd., immunohistochemistry kits, dihydroethidium (DHE) fluorescent probes, TUNEL staining kits and DAPI were purchased from Wuhan Sewell Biotechnology Co., Ltd., Trizol, RNA reverse transcription, and qPCR amplification reagents were purchased from Nanjing Novezan Biotechnology Co., Ltd., and qPCR amplification primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0020] The experimental animals and husbandry methods used in the following examples are as follows: Male C57BL / 6n mice, aged 6-8 weeks and weighing 18-22 g, were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. All experimental mice were housed at the SPF-grade Laboratory Animal Center of the First Affiliated Hospital of Zhengzhou University. Mice were housed in an environment with 12-hour alternating light-dark cycles, a humidity of 40%-70%, and a room temperature of 22-24°C. They had free access to water and food during their husbandry.

[0021] The experimental data in the following examples were statistically analyzed using SPSS 2.0 statistical software. Results are expressed as mean ± SD. Comparisons between two groups were performed using a two-tailed Student's t-test. Comparisons between multiple groups were performed using one-way analysis of variance. P < 0.05 was considered statistically significant.

[0022] Example 1: Linocinnamarin alleviates APAP-induced liver injury 1. Effect of Linocinnamarin on liver function in mice with APAP-induced liver injury (1) Experimental animals and group treatment: After male C57BL / 6n mice were acclimated for one week, they were divided into control group, Linocinnamarin-20 group, APAP+Linocinnamarin-0 group, APAP+Linocinnamarin-5 group, APAP+Linocinnamarin-10 group, APAP+Linocinnamarin-15 group, and APAP+Linocinnamarin-20 group, with 6 mice in each group.

[0023] Linocinnamarin was diluted with 0.9% NaCl to different concentrations, and the groups treated with different concentrations of linocinnamarin were gavaged once a day for 7 consecutive days.

[0024] The mice in the control group were kept without any treatment and raised normally.

[0025] The mice in the Linocinnamarin-20 group were treated by oral gavage with 20 mg of Linocinnamarin per kilogram of mouse body weight, once a day for 7 consecutive days.

[0026] Mice in the APAP+Linocinnamarin-0 group were treated by oral gavage with 0 mg of linocinnamarin per kilogram of mouse body weight (i.e., 0.9% NaCl solution) once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and received intraperitoneal injection of APAP (400 mg / kg body weight) to induce liver injury.

[0027] The mice in the APAP+Linocinnamarin-5 group were treated with 5 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and then intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0028] Mice in the APAP+Linocinnamarin-10 group were treated with 10 mg of linocinnamarin per kilogram of body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and received an intraperitoneal injection of APAP (400 mg / kg body weight) to induce liver injury.

[0029] Mice in the APAP+Linocinnamarin-15 group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and received intraperitoneal injection of APAP (400 mg / kg body weight) to induce liver injury.

[0030] Mice in the APAP+Linocinnamarin-20 group were treated with 20 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and received intraperitoneal injection of APAP (400 mg / kg body weight) to induce liver injury.

[0031] After 24 hours of APAP treatment, mice in each group were anesthetized and sacrificed, and liver tissue and serum samples were collected for analysis. This study protocol was approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University.

[0032] (2) Detection of serum ALT and AST levels in mice with APAP-induced liver injury: Twenty-four hours after APAP injection, blood was collected from the orbits of mice in the control group, Linocinnamarin-20 group, APAP+Linocinnamarin-0 group, APAP+Linocinnamarin-5 group, APAP+Linocinnamarin-10 group, APAP+Linocinnamarin-15 group, and APAP+Linocinnamarin-20 group. The blood was centrifuged at 3 000 r / min for 10 min, and the supernatant was collected. The ALT and AST kits (purchased from Nanjing Jiancheng Bioengineering Institute, catalog numbers C009-2-1 and C010-2-1, respectively) were used to detect the levels of AST and AST in serum according to the kit's instructions. The test results are shown in the figure. Figure 1 As shown in A and B.

[0033] Depend on Figure 1 As shown, serum ALT and AST levels in the linocinnamarin-20 group were not significantly different from those in the control group, indicating that linocinnamarin at doses of 20 mg / kg or less has no toxic effects on the mouse liver. Furthermore, compared with the APAP+linocinnamarin-0 group, serum ALT and AST levels were significantly reduced in the APAP+linocinnamarin-10, APAP+linocinnamarin-15, and APAP+linocinnamarin-20 groups, indicating that linocinnamarin at doses of 10 mg / kg, 15 mg / kg, and 20 mg / kg significantly reduces serum ALT and AST levels. Furthermore, linocinnamarin at doses of 15 mg / kg and 20 mg / kg was more effective than 10 mg / kg; however, there was no significant difference in efficacy between 15 and 20 mg / kg. Therefore, the 15 mg / kg dose of linocinnamarin was selected for subsequent animal experiments.

[0034] 2. Effects of Linocinnamarin on liver tissue in mice with APAP-induced liver injury (1) Experimental animals and group treatment: After male C57BL / 6n mice were acclimated for one week, they were divided into control group, linocinnamarin group, APAP group, and APAP+linocinnamarin group, with 6 mice in each group.

[0035] The mice in the control group were kept without any treatment and raised normally.

[0036] The mice in the linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days.

[0037] The treatment method for mice in the APAP group was as follows: after fasting overnight, the mice were intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0038] The mice in the APAP+Linocinnamarin group were treated as follows: 15 mg of linocinnamarin per kilogram of mouse body weight was given by gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0039] (2) H&E staining of mouse liver tissue samples After 24 hours of APAP treatment, mice in each group were anesthetized and sacrificed, and liver tissue samples were collected for H&E staining to observe liver tissue structure. This study protocol was approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University.

[0040] H&E staining procedures were as follows: liver tissue was fixed in 10% formalin for 48 hours, embedded in paraffin, and cut into 5-μm-thick paraffin sections. Sections were baked at 60°C for 2 hours, dewaxed in xylene, and dehydrated with graded ethanol. Staining was then performed according to the instructions for the hematoxylin-eosin staining reagent. Following staining, sections were dewaxed and soaked in graded ethanol and xylene, mounted with neutral resin, and air-dried in a well-ventilated area before being observed microscopically for pathological changes in liver tissue.

[0041] The results of H&E staining are as follows Figure 2 As shown. Figure 2 It can be seen that the liver cells of the mice in the APAP group had focal or large-area necrosis, and the structure of the liver lobule was also destroyed; compared with the APAP group, the area of necrotic cells in the liver of the mice in the APAP+Linocinnamarin group was significantly reduced.

[0042] These results indicate that Linocinnamarin can alleviate APAP-induced liver injury.

[0043] Example 2: Linocinnamarin alleviates APAP-induced hepatocyte apoptosis 1. Experimental animals and grouping: After male C57BL / 6n mice were acclimated for one week, they were divided into control group, linocinnamarin group, APAP group, and APAP+linocinnamarin group, with 6 mice in each group.

[0044] The mice in the control group were kept without any treatment and raised normally.

[0045] The mice in the linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days.

[0046] The treatment method for mice in the APAP group was as follows: after fasting overnight, the mice were intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0047] The mice in the APAP+Linocinnamarin group were treated as follows: 15 mg of linocinnamarin per kilogram of mouse body weight was given by gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0048] 2. TUNEL staining of mouse liver tissue samples After 24 hours of APAP treatment, the mice in each group were anesthetized and killed, and the liver tissue samples were collected for TUNEL staining.

[0049] TUNEL staining was performed as follows: paraffin sections of liver tissue were deparaffinized with xylene, dehydrated with graded ethanol, and incubated with proteinase K at 37°C for 20 minutes. Subsequently, sections were washed three times with PBS for 5 minutes each and incubated with TUNEL detection solution at 37°C for 10 minutes. Following incubation, sections were washed three times with PBS for 5 minutes each and stained with DAPI for 10 minutes at room temperature. Sections were washed three times with PBS for 5 minutes each, sealed with an anti-fluorescence quencher, and observed and photographed under a fluorescence microscope.

[0050] TUNEL staining results Figure 3 As shown in A and B. Figure 3As shown in Figures A and B, compared with those of the mice in the control group, the number of TUNEL-positive cells in the liver tissue of the mice in the APAP group was significantly increased after APAP injury; compared with those of the mice in the APAP group, the number of TUNEL-positive cells in the liver tissue of the mice in the APAP+Linocinnamarin group was significantly decreased, indicating that pretreatment with Linocinnamarin can significantly reduce the number of TUNEL-positive cells in the liver tissue after APAP injury.

[0051] (2) Western blot detection of apoptosis-related proteins Cleaved caspase3, BAX, and BCL-2 in mouse liver tissue samples After 24 hours of APAP treatment, the mice in each group were anesthetized and killed, and the liver tissue samples were collected for western blot analysis.

[0052] Western blot analysis was performed as follows: protein was extracted from liver tissue according to the RIPA lysis buffer instructions. Protein concentration was determined using a BCA kit and adjusted to 5 μg / μL. Proteins were separated using a 12% SDS-PAGE gel and transferred to a PVDF membrane. Following electrophoresis, the membrane was blocked with 5% skim milk for 1 hour at room temperature and incubated with the primary antibody overnight at 4°C. The PVDF membrane was then incubated with goat anti-rabbit or goat anti-mouse secondary antibodies for 1 hour at room temperature. After washing the membrane three times with TBST, ECL luminescent solution was evenly applied to the membrane and imaged using the ImageQuant™ system.

[0053] Western blot test results Figure 3 As shown in C to F. Figure 3 As shown in Figures C to F, in the liver tissue of mice injured by APAP, the levels of pro-apoptotic proteins BAX and cleaved caspase 3 were significantly increased, while the expression of anti-apoptotic protein BCL-2 was significantly decreased; however, linocinnamarin pretreatment reversed the changes in the expression of apoptosis-related proteins.

[0054] These results indicate that linocinnamarin pretreatment can reduce APAP-induced hepatocyte apoptosis. Example 3: Linocinnamarin reduces APAP-induced inflammatory response 1. Experimental animals and grouping: After male C57BL / 6n mice were acclimated for one week, they were divided into control group, linocinnamarin group, APAP group, and APAP+linocinnamarin group, with 6 mice in each group.

[0055] The mice in the control group were kept without any treatment and raised normally.

[0056] The mice in the linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days.

[0057] The treatment method for mice in the APAP group was as follows: the mice were fasted overnight and intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0058] Mice in the APAP+Linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and received intraperitoneal injection of APAP (400 mg / kg body weight) to induce liver injury.

[0059] 2. Detection of inflammatory factors IL-1β, IL-6, and TNF-α in mouse serum After 24 hours of APAP treatment, blood was collected from the orbits of mice in each group and centrifuged at 3,000 rpm for 10 min. The supernatant was collected and assayed using an ELISA kit (purchased from Wuhan Sanying Biotechnology Co., Ltd., with catalog numbers KE10003, KE10007, and KE10002, respectively) according to the kit's instructions. A standard curve was drawn based on the OD values of the standard wells, and the levels of the corresponding inflammatory factors in the serum were calculated.

[0060] The test results of inflammatory factors IL-1β, IL-6 and TNF-α are as follows Figure 4 As shown in A, B, and C. Figure 4 As shown in Figures A, B, and C, the levels of IL-1β, IL-6, and TNF-α in serum increased significantly after APAP injury of the liver, while linocinnamarin pretreatment significantly reduced the levels of IL-1β, IL-6, and TNF-α in serum of mice after APAP injury of the liver.

[0061] 3. Immunofluorescence staining of CD11b and Ly6g in mouse liver tissue After 24 hours of APAP treatment, the mice in each group were anesthetized and killed, and their liver tissues were collected for immunofluorescence detection.

[0062] Immunofluorescence staining was performed as follows: liver tissue was paraffin-embedded and cut into 5-μm-thick sections. The sections were then baked at 60°C for 2 h, deparaffinized with xylene, dehydrated with graded ethanol, and heat-antigen retrieval performed with 0.01 mol / L citrate buffer (pH 6.0). Sections were incubated with 10% goat serum at room temperature for 1 h, followed by the addition of primary antibody and incubation overnight at 4°C. The next day, sections were washed three times with PBS, and fluorescent secondary antibody was added. The sections were incubated in the dark at room temperature for 1 h. After washing three times with PBS, DAPI was added for nuclear staining at room temperature for 10 min. After staining, the sections were washed three times with PBS, mounted with an anti-fluorescence quencher, and photographed and analyzed under a fluorescence microscope.

[0063] Immunofluorescence staining results Figure 4 As shown in D, E, F, and G. Figure 4 As shown in Figures D, E, F, and G, the number of CD11b and Ly6g+ cells in the liver tissue increased significantly after APAP injury, while the number of CD11b+ and Ly6g+ cells in the APAP+ Linocinnamarin group decreased significantly, indicating that Linocinnamarin reduced the tissue inflammatory response after APAP injury in the liver.

[0064] These results indicate that Linocinnamarin can inhibit the inflammatory response induced by APAP.

[0065] Example 4: Linocinnamarin alleviates APAP-induced oxidative stress 1. Experimental animals and grouping: After male C57BL / 6n mice were acclimated for one week, they were divided into control group, linocinnamarin group, APAP group, and APAP+linocinnamarin group, with 6 mice in each group.

[0066] The mice in the control group were kept without any treatment and raised normally.

[0067] The mice in the linocinnamarin group were treated by oral gavage with 15 mg / kg of linocinnamarin per kilogram of mouse body weight, once a day for 7 consecutive days.

[0068] The treatment method for mice in the APAP group was as follows: after fasting overnight, the mice were intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0069] Mice in the APAP+Linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and then intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0070] 2. Detection of malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione (GSH) in mouse liver tissue After 24 hours of APAP treatment, mice in each group were anesthetized and sacrificed, and liver tissues were collected for analysis of malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione (GSH). The liver tissues were homogenized with the extraction solution at a weight (g): volume (mL) ratio of 1:9. The supernatant was collected by centrifugation at 8000 rpm at 4°C for 10 minutes, and the protein concentration was determined using a BCA assay kit. The levels of MDA, SOD, and GSH in liver tissues were then measured using kits (purchased from Nanjing Jiancheng Bioengineering Institute, catalog numbers A003-1-2, A001-3-2, and A005-1-2, respectively).

[0071] The detection results of MDA, SOD and GSH in mouse liver tissue are as follows Figure 5 As shown in A, B, and C. Figure 5 As shown in Figures A, B, and C, compared with the control group, the MDA content in liver tissue was significantly increased, and the SOD and GSH activities were significantly decreased after APAP liver injury. However, compared with the APAP group, the MDA content in the APAP+Linocinnamarin group was significantly decreased, and the SOD and GSH activities were significantly increased, indicating that Linocinnamarin pretreatment can inhibit the MDA content and significantly increase the SOD and GSH activities.

[0072] 3. DHE staining of mouse liver tissue After 24 hours of APAP treatment, mice in each group were anesthetized and sacrificed, and liver tissue was collected for DHE staining. The liver tissue was embedded in OTC, frozen, and cut into 10 μM thick sections. The sections were stained with 10 μM dihydroethidium (DHE) fluorescent probe, incubated in the dark at room temperature for 1 hour, and then stained with DAPI for 10 minutes. Finally, the sections were observed under a fluorescence microscope.

[0073] The results of DHE staining of liver tissue are as follows Figure 5 As shown in D and E. Figure 5As shown in Figures D and E, the level of reactive oxygen species (ROS) in normal liver tissue is relatively low, but after APAP treatment, the ROS level is significantly increased; moreover, linocinnamarin pretreatment can effectively inhibit the ROS generated after APAP injury in the liver.

[0074] These results indicate that Linocinnamarin can effectively alleviate APAP-induced oxidative stress.

[0075] Example 5: Linocinnamarin activates the Nrf2 / HO-1 signaling pathway 1. Experimental animals and grouping: After male C57BL / 6n mice were acclimated for one week, they were divided into control group, linocinnamarin group, APAP group, and APAP+linocinnamarin group, with 6 mice in each group.

[0076] The mice in the control group were kept without any treatment and raised normally.

[0077] The mice in the linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days.

[0078] The treatment method for mice in the APAP group was as follows: the mice were fasted overnight and intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0079] Mice in the APAP+Linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and received intraperitoneal injection of APAP (400 mg / kg body weight) to induce liver injury.

[0080] 2. Fluorescence quantitative PCR detection of Nrf2 and HO-1 expression in mouse liver tissue After 24 hours of APAP treatment, mice in each group were anesthetized and killed, and liver tissue samples were collected for fluorescence quantitative PCR detection of Nrf2 and HO-1 expression. The specific operation of fluorescence quantitative PCR detection was as follows: total RNA of mouse liver tissue was extracted using Trizol reagent, the total RNA concentration was determined by UV spectrophotometer, and total RNA (1 μg) was reverse transcribed into cDNA using a reverse transcription kit, and amplified using SYBR Green qPCR Mix reagent. The amplification primers were GAPDH puller: CTGCCCAGAACATCATCCCT, rear primer: TACTTGGCAGGTTTCTCCAGG; Nrf2 front primer: CAGCATAGAGCAGGACATGGAG, rear primer: GAACAGCGGTAGTATCAGCCAG; HO-1 front primer: CACTCTGGAGATGACACCTGAG, rear primer: GTGTTCCTCTGTCAGCATCACC. GAPDH was used as an internal control, and 2 -△△CT Method for computational analysis.

[0081] The results of quantitative fluorescence PCR detection of mouse liver tissue are as follows Figure 6 As shown in Figure 6A and B, the mRNA expressions of Nrf2 and HO-1 were significantly decreased in liver tissue after APAP injury; however, pretreatment with linocinnamarin could effectively reverse the decrease in Nrf2 and HO-1 mRNA expressions.

[0082] 3. Western blot detection of Nrf2 and HO-1 expression in mouse liver tissue After 24 hours of APAP treatment, the mice in each group were anesthetized and killed, and liver tissue samples were collected for western blot detection of Nrf2 and HO-1 expression.

[0083] Western blot test results Figure 6 As shown in C, D, and E. Figure 6 As shown in Figures C, D, and E, compared with those in the control group, the expression of NRF2 and HO-1 proteins in the liver tissue of the mice in the APAP group was significantly decreased, while the expression of NRF2 and HO-1 proteins in the liver tissue of the mice in the APAP+Linocinnamarin group was significantly higher than that in the APAP group.

[0084] These results indicate that linocinnamarin pretreatment can promote the expression of Nrf2 and HO-1 and reverse the downregulation of Nrf2 / HO-1 expression induced by APAP injury in the liver.

[0085] Example 6: Study on the mechanism of linocinnamarin protecting the liver from APAP injury To further investigate how linocinnamarin protects the liver from APAP injury, the Nrf2 inhibitor ML385 was used to inhibit Nrf2 expression in mice to investigate the mechanism by which linocinnamarin protects the liver from APAP injury.

[0086] 1. Experimental animals and grouping: After male C57BL / 6n mice were acclimated for one week, they were divided into control group, linocinnamarin group, APAP group, APAP+linocinnamarin group, APAP+ML385 group, and APAP+ML385+linocinnamarin group, with 6 mice in each group.

[0087] The mice in the control group were kept without any treatment and raised normally.

[0088] The mice in the linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days.

[0089] The treatment method for mice in the APAP group was as follows: after fasting overnight, the mice were intraperitoneally injected with APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0090] Mice in the APAP+Linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and received intraperitoneal injection of APAP (400 mg / kg body weight) to induce liver injury.

[0091] The treatment method for mice in the APAP+ML385 group was as follows: the mice were fasted overnight and intraperitoneally injected with ML385 (injection dose of 30 mg / kg), followed by intraperitoneal injection of APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0092] Mice in the APAP+ML385+Linocinnamarin group were treated with 15 mg of linocinnamarin per kilogram of mouse body weight by oral gavage once a day for 7 consecutive days. After the last dose, the mice were fasted overnight and then intraperitoneally injected with ML385 (30 mg / kg), followed by APAP (injection dose of 400 mg / kg body weight) to induce liver injury.

[0093] 2. Detection of ALT, AST, Il-1β, Il-6 and TNF-α in mouse serum and H&E staining, TUNEL staining and DHE staining in mouse liver tissue After 24 hours of APAP treatment, the mice in each group were anesthetized and killed, and blood was collected from the orbits. The supernatant was collected and the ALT and AST kits of Nanjing Jiancheng Bioengineering Institute (purchased from Nanjing Jiancheng Bioengineering Institute, with the catalog numbers C009-2-1 and C010-2-1, respectively) were used to detect the levels of AST and AST in serum according to the operating instructions of the kits. Elisa kits (purchased from Wuhan Sanying Biotechnology Co., Ltd., with the catalog numbers KE10003, KE10007, and KE10002, respectively) were used to add samples according to the instructions of the kits and then detected by microplate reader. A standard curve was drawn based on the OD values of the standard wells and the levels of inflammatory factors Il-1β, Il-6, and TNF-α in the serum were calculated. At the same time, liver tissue samples of the mice were collected for H&E staining, TUNEL staining, and DHE staining. The specific operation of H&E staining was the same as in Example 1, the specific operation of TUNEL staining was the same as in Example 2, and the specific operation of DHE staining was the same as in Example 4. The test results are shown in FIG. Figure 7 shown.

[0094] Depend on Figure 7 It can be seen that compared with the control group mice, the ALT and AST levels were significantly increased after APAP liver injury ( Figure 7 A~B), liver necrosis area ( Figure 7 C~D)、inflammatory factors( Figure 7 E, F, G), hepatocyte apoptosis ( Figure 7 H~I), DHE fluorescence intensity ( Figure 7 Compared with the APAP group, treatment with linocinnamarin significantly reduced liver damage, oxidative stress, apoptosis, and inflammatory responses after APAP injury ( Figure 7 A~K); however, the protective effect of Linocinnamarin on the liver was significantly weakened after the use of Nrf2 inhibitors ( Figure 7 These results indicate that inhibition of Nrf2 attenuates the protective effect of linocinnamarin and that the hepatoprotective effect of linocinnamarin is related to the promotion of the Nrf2 / HO-1 signaling pathway.

[0095] Finally, it should be noted that the above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any other manner. Any person skilled in the art may utilize the above technical content as a guide to make changes or modifications. These are equivalent embodiments of equivalent modifications. However, any simple modifications, equivalent changes, and modifications to the above embodiments that do not depart from the technical concept of the present invention and are based on the technical essence of the present invention remain within the scope of protection of the claims of the present invention.

Claims

1. Use of linocinnamarin in the preparation of a product for preventing, alleviating, and / or treating APAP-induced liver injury and / or acute liver failure.

2. Use of linocinnamarin in the preparation of a product for preventing, reducing, or / and inhibiting APAP-induced liver injury or / and hepatocyte apoptosis caused by acute liver failure.

3. Use of linocinnamarin in the preparation of a product for alleviating and / or treating APAP-induced liver injury and / or inflammatory response caused by acute liver failure.

4. Use of linocinnamarin in the preparation of a product for reducing the expression level of inflammation-related proteins caused by APAP-induced liver injury and / or acute liver failure.

5. The use according to claim 4, characterized in that The inflammation-related proteins include IL-1β, IL-6 and TNF-α.

6. Use of linocinnamarin in the preparation of a product for inhibiting and / or reducing APAP-induced liver injury and / or oxidative stress caused by acute liver failure.

7. A medicine comprising linocinnamarin and pharmaceutically acceptable excipients.

8. The drug according to claim 7, characterized in that The dosage form of the medicine is granules, capsules, tablets, powders, oral liquids or emulsions.

Images