Preparation method of a klebsiella quasimoniliformis aptamer and a fluorescence quenching type biosensor
The fluorescent quenching biosensor based on the Cronobacter sakazakii aptamer solves the problems of long detection time and low sensitivity of Cronobacter sakazakii, and realizes rapid and efficient food safety detection, which is suitable for real-time monitoring and emergency response in the food production process.
Patent Information
- Application Number
- CN202510648730.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2045-05-20
AI Technical Summary
Existing detection technologies for Cronobacter sakazakii are time-consuming and have low sensitivity, making it difficult to meet the needs for rapid and efficient food safety testing, especially in high-risk foods such as infant formula.
Using the Cronobacter sakazakii aptamer and its fluorescence quenching biosensor, rapid detection is achieved by the specific binding of the nucleic acid aptamer to the target bacteria, combined with fluorescent probes and quenching probes. The preparation method is simple and suitable for real-time online detection in food production and processing.
It achieves highly specific and sensitive detection of Cronobacter sakazakii, with a detection limit as low as 4.27 CFU/mL, and can complete the detection within 40 minutes. It is suitable for real-time monitoring in food production processes and emergency response to sudden contamination incidents.
Smart Images

Figure CN120442634B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biosensor technology, specifically relating to a method for preparing a Cronobacter sakazakii aptamer and its fluorescence-quenched biosensor. Background Technology
[0002] In the modern food industry, food safety is a growing concern, especially in the production and processing of prepared or cooked foods. *Cronobacter sakazakii*, an important foodborne pathogen, has attracted widespread attention due to its presence in infant formula. This bacterium can cause serious health problems, such as bacterial meningitis, sepsis, and necrotizing enterocolitis in infants, particularly in those whose immune systems are not yet fully developed. The primary route of infection is through the ingestion of contaminated food, especially infant formula; therefore, ensuring food safety is a crucial issue for the food industry. *Cronobacter sakazakii* possesses a strong ability to adapt to its environment, surviving for extended periods in dry and low-moisture conditions. This makes it a potential risk factor in prepared foods, particularly milk powder, cereals, spices, and other dried foods. Traditional food processing and sterilization methods, such as high-temperature sterilization and chemical disinfectants, while effective in killing most bacteria, are often ineffective against the biofilm and dryness resistance of *Cronobacter sakazakii*. In addition, this bacterium can form biofilms in production equipment and the environment, increasing the difficulty of removal.
[0003] Currently, the detection of Cronobacter sakazakii in food mainly relies on microbial culture methods and molecular biology techniques. Microbial culture methods require multiple steps, including pre-enrichment, selective culture, and biochemical identification, and typically take several days to produce results. While reliable, this method is time-consuming and labor-intensive, making it unsuitable for rapid detection. Molecular biology techniques, such as PCR and real-time PCR, can provide results within hours, but they require sophisticated equipment and skilled personnel and are costly, making them unsuitable for large-scale routine testing. Nucleic acid aptamers are single-stranded DNA or RNA molecules obtained through in vitro screening that can specifically bind to target molecules. Compared to traditional antibodies, nucleic acid aptamers have advantages such as simple synthesis, high stability, and ease of modification. In recent years, the application of nucleic acid aptamers in food safety testing has made significant progress. Nucleic acid aptamers can specifically bind to the surface of target bacteria, thereby achieving highly sensitive and specific detection.
[0004] Nucleic acid aptamers show great promise for application in food safety testing. Further optimization of aptamer screening and modification techniques can improve their stability and specificity in different food matrices. Furthermore, combined with fluorescence technology and portable detection devices, aptamer fluorescent probes hold promise for real-time online detection during food production and processing, ensuring food safety. Summary of the Invention
[0005] To address the problems of high detection difficulty, long detection time, and low sensitivity in existing detection technologies for Listeria monocytogenes in food, this invention provides an aptamer for Cronobacter sakazakii and a method for preparing a fluorescence-quenched biosensor based on the Cronobacter sakazakii aptamer.
[0006] The DNA sequence of a *Cronobacter sakazakii* aptamer is shown in SEQ ID No:1; the *Cronobacter sakazakii* aptamer specifically recognizes *Cronobacter sakazakii*.
[0007] The fabrication steps of the fluorescence-quenched biosensor based on the Cronobacter sakazakii aptamer are as follows:
[0008] (1) Preparation of activation mixture
[0009] 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed at a volume ratio of 2:1 to obtain an activated mixture.
[0010] (2) Preparation of the first aptamer solution
[0011] 10 μM of the aptamer with the DNA sequence SEQ ID No:1 was added to 180 μL of activation mixture to prepare a first aptamer solution with a molar concentration of 10 μM.
[0012] (3) Preparation of the second aptamer solution
[0013] 10 μM of the aptamer with the DNA sequence SEQ ID No:2 was added to 180 μL of activation mixture to prepare a second aptamer solution with a molar concentration of 10 μM.
[0014] The aptamer shown in the DNA sequence SEQ ID No:2 is gggtcggggg tggtgggtgg gggttctcgtctggcttcgg;
[0015] (4) Preparation of fluorescent probes
[0016] 2g of citric acid and 2g of L-cysteine were added to 30mL of ultrapure water, dissolved by sonication, heated to 180℃, and maintained at 180℃ for 1.5h. The mixture was then cooled to room temperature. After dialysis for 5 days, a brown reaction solution was obtained. 500uL of the brown reaction solution was vortexed with 200uL of the activation mixture and incubated on a shaker for 40min. Then, 100uL of the first aptamer solution was added and incubated on a shaker for 3h to obtain the fluorescent probe.
[0017] (5) Preparation of quenching probe
[0018] Add 1 mL of 1% tetrachloroauric acid solution to 120 mL of distilled water, boil, add 3 mL of 1% trisodium citrate solution, continue boiling for 18 min, and cool to room temperature to obtain gold nanoparticle solution.
[0019] 100 μL of the second aptamer solution was incubated in a 95°C water bath for 5 min and then cooled to room temperature. 10 μL of 3-(2-formylethyl)phosphohydrochloride solution with a final concentration of 2.867 g / L was added, and the mixture was allowed to stand for 40 min. Then, 1.2 mL of gold nanoparticle solution was added, and the mixture was incubated at 37°C for 16 h. The supernatant was removed by centrifugation. The precipitate was resuspended in 500 μL of phosphate buffer at pH 7.4 to obtain the quenching probe.
[0020] (6) Fabrication of biosensors
[0021] A fluorescent probe and a quenching probe were mixed at a volume ratio of 1:1.8 to prepare a fluorescent quenching biosensor.
[0022] Further preparation techniques are as follows:
[0023] In step (4), when the fluorescence emission wavelength of the fluorescent probe shifts from 424 nm to 420 nm, it indicates that the first aptamer has been successfully modified onto the fluorescent material.
[0024] In step (5), when the ultraviolet absorption wavelength of the gold nanoparticles shifts from 520 nm to 523 nm, it indicates that the second aptamer has been successfully modified onto the gold nanoparticles.
[0025] The beneficial technical effects of this invention are reflected in the following aspects:
[0026] 1. This invention provides an aptamer for *Cronobacter sakazakii*, which significantly improves the detection performance of *Cronobacter sakazakii* through efficient screening of nucleic acid aptamers and the application of a fluorescence-quenched biosensor. The *Cronobacter sakazakii* aptamer obtained through screening (DNA sequence shown in SEQ ID No:1) can specifically recognize target bacteria. Experimental verification shows that the flow cytometry binding rate of this *Cronobacter sakazakii* aptamer to *Cronobacter sakazakii* is as high as 80.7%, with an affinity constant of 18.59 nM, while exhibiting low cross-reactivity with other common foodborne pathogens (such as *Staphylococcus aureus*, *Salmonella*, *Escherichia coli*, *Listeria monocytogenes*, and *Pseudomonas aeruginosa*) (6.8%, 9.7%, 23.7%, 20.5%, and 17.4%, respectively). This high specificity ensures the accuracy of the detection results and avoids interference from non-target bacteria, making it particularly suitable for the accurate identification of *Cronobacter sakazakii* in food safety testing. The detection method based on a fluorescence-quenched biosensor achieves a detection limit as low as 4.27 CFU / mL, far exceeding the sensitivity of traditional detection methods. Experimental data show that the fluorescence intensity ratio (F / F0) has a linear relationship with the logarithm of Cronobacter sakazakii concentration (linear regression equation: y = -0.09515x + 1.03153, correlation coefficient r² = 0.993), enabling reliable detection at extremely low concentrations. This characteristic meets the stringent requirements of food safety testing for trace pathogen detection, and is particularly suitable for high-risk foods such as infant formula. Compared to traditional microbial culture methods (which take several days) and molecular biology techniques (such as PCR, which require several hours), the fluorescence-quenched biosensor for Cronobacter sakazakii of this invention can complete detection in a short time. From sample processing to fluorescence intensity measurement, the entire process can be completed within 40 minutes, significantly improving detection efficiency. This speed makes it suitable for real-time monitoring in food production processes, effectively reducing the risk of contamination.
[0027] Analysis of the design mechanism of this invention: When the sensor is not bound to the target bacteria, the fluorescent probe and the quenching probe maintain contact through the spatial proximity of the aptamers, and the gold nanoparticles efficiently quench the fluorescence (F0 close to 0). Once *Cronobacter sakazakii* is present, its surface proteins specifically bind to the aptamers on the fluorescent probe, causing the fluorescent probe to detach from the surface of the quenching probe, and the fluorescence signal is rapidly restored (F value increases). This process is essentially a change in steric hindrance driven by molecular recognition, requiring no enzymatic reactions or chemical modifications. The reaction kinetics depend only on the aptamer-target binding rate (on the order of minutes), rather than the amplification or culture time in traditional methods.
[0028] 2. The preparation method of the fluorescence quenching biosensor of the present invention is simple. It only requires the preparation of fluorescent materials by reacting citric acid and L-cysteine, and then binding them with nucleic acid aptamers. It does not rely on complex equipment or high technical thresholds.
[0029] This invention's fluorescence-quenched biosensor overcomes the time bottleneck of traditional detection technologies through a synergistic design of "rapid target recognition by high-affinity aptamers - instantaneous signal conversion by nanomaterials - simplified amplification-free process." The molecular recognition dynamics of the aptamers (binding equilibrium within minutes), the instantaneous quenching effect of gold nanoparticles, and the pretreatment-free detection process collectively ensure that the entire process from sample preparation to fluorescence measurement is completed within 40 minutes. This rapid detection characteristic is particularly suitable for real-time monitoring of food production and emergency response to sudden contamination events, providing an efficient solution for the rapid detection of trace pathogens.
[0030] 3. The fluorescence-quenched biosensor of this invention is used to detect *Cronobacter sakazakii*. The detection process only requires mixing the fluorescence-quenched biosensor with the sample to be tested, incubating it, and then measuring the fluorescence intensity. The operation steps are few, making it easy to promote and apply in laboratories and in the field. The simplified operation reduces detection costs and personnel training requirements, demonstrating good practicality. The nucleic acid aptamer has high chemical and thermal stability, maintaining its recognition function under different environmental conditions (such as temperature changes and pH fluctuations). The fluorescent probe can maintain its performance for a long time under light-protected storage conditions at 4°C, ensuring the reliability and repeatability of the detection method. This stability makes it suitable for various food sample detection scenarios, especially during transportation and storage. This method performs excellently in real food samples (such as pre-prepared prepared beef balls), accurately detecting *Cronobacter sakazakii* even in complex matrices with high protein, high salt, and high fat content, achieving a concentration of (0.99 × 10⁻⁶)... 6 CFU / mL) and actual concentration (1.00×10⁻⁶) 6 The CFU / mL concentration is highly consistent. No new standard curves need to be established for different samples; the linear regression equation based on the PBS buffer environment is universally applicable, demonstrating excellent adaptability. This versatility allows for wide application in various food testing scenarios, enhancing the technology's promotional value. Attached Figure Description
[0031] Figure 1 This is a secondary structure diagram of the Cronobacter sakazakii aptamer;
[0032] Figure 2 Three-dimensional structure diagram of membrane protein that is molecularly docked with the aptamer of Cronobacter sakazakii;
[0033] Figure 3 This is a schematic diagram illustrating the application principle of fluorescence detection.
[0034] Figure 4 TEM image of gold nanoparticles detected by fluorescence quenching;
[0035] Figure 5The FT-IR chromatogram of fluorescent carbon dots detected by fluorescence quenching;
[0036] Figure 6 The graph shows the relative fluorescence intensity before and after covalent coupling of the nucleic acid aptamer and gold nanoparticles, as detected by fluorescence quenching.
[0037] Figure 7 The UV absorption spectra of nucleic acid aptamers before and after covalent coupling with gold nanoparticles for fluorescence quenching detection are shown.
[0038] Figure 8 Standard curves for fluorescence quenching detection of different concentrations of Cronobacter sakazakii;
[0039] Figure 9 This is a specific detection diagram for various bacteria using fluorescence quenching detection. Detailed Implementation
[0040] The present invention will now be described in detail with reference to specific embodiments.
[0041] Unless otherwise defined, the technical and scientific terms used in the following embodiments have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0042] The present invention will now be described in detail with reference to specific embodiments.
[0043] Unless otherwise defined, the technical and scientific terms used in the following embodiments have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0044] Unless otherwise specified, the raw materials used in the following examples are all conventional biochemical reagents; unless otherwise specified, the experimental methods are all conventional methods; unless otherwise specified, the quantitative tests in the following examples are all repeated three times and the results are averaged; unless otherwise specified, the percentages in the following examples are all mass percentages.
[0045] In the following examples, the synthesized aptamers were purchased from Sangon Biotech (Shanghai) Co., Ltd.; unless otherwise specified, all other raw materials used were purchased from Sinopharm Chemical Reagent Co., Ltd.
[0046] It should be noted that the phosphate buffer used in this application is a 0.1M sterile PBS buffer with a pH of 7.4.
[0047] It should be noted that all bacterial strains used in this application were purchased from the American Type Culture Collection (ATCC).
[0048] The strains identified include *Cronobacter sakazakii* (ATCC 14028), *Staphylococcus aureus* (ATCC 29213), *Listeria monocytogenes* (ATCC 43251), *Escherichia coli* (ATCC 25922), *Cronobacter sakazakii* (ATCC 29544), and *Pseudomonas aeruginosa* (ATCC 15442). Furthermore, these strains were procured through an overseas agent, Hefei Xiyue Biotechnology Co., Ltd.
[0049] It should be noted that all instruments, equipment, raw materials, reagents, and methods used in this application are handled under aseptic conditions.
[0050] It should be noted that instruments, equipment, raw materials, reagents, or methods not mentioned in this application are conventional or well-known technical methods to those skilled in the art, and will not be described in detail in this application.
[0051] Example 1
[0052] Example 1 provides an *Cronobacter sakazakii* aptamer, the DNA sequence of which is shown in SEQ ID No:1. The *Cronobacter sakazakii* aptamer is a nucleic acid aptamer; see [link to documentation]. Figure 1 Secondary structure analysis of Cronobacter sakazakii aptamers, such as RNA structure analysis. Figure 1 As shown.
[0053] The binding assay was performed using the "aptamer binding assay" and "affinity constant determination" methods described in "Screening and Identification of Aptamers for Vibrio parahaemolyticus Based on Whole-Bacterial SELEX Technology_Lou Xiuqin". The assay was performed on the same bacteria instead of the native bacteria. The flow cytometry binding rate was 80.7%, and the affinity constant was 18.59 nM. The flow cytometry binding rates with Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella, and Pseudomonas aeruginosa were 6.8%, 9.7%, 23.7%, 20.5%, and 17.4%, respectively. The nucleic acid aptamers we screened are close to the highest level of known public information (e.g., the source article SEQ ID No:2 has a DOI of 10.3168 / jds.2021-20898, and the same tests showed that its flow cytometry binding rate was 81.6%, and the affinity constant was 34 nM). The nucleic acid aptamers we obtained are feasible and meet the requirements for use. In addition, the low affinity constant of Cronobacter sakazakii at low concentrations leads to a more stable binding state.
[0054] Furthermore, the screening method for the DNA sequences of Cronobacter sakazakii aptamers is as follows:
[0055] (1) Constructing the structure of membrane proteins of Cronobacter sakazakii
[0056] To obtain the amino acid sequence and structural information of the membrane protein OmpA from Cronobacter sakazakii. Figure 2 As shown;
[0057] Specifically, the crystal structure or homology modeling structure of the OmpA protein from Cronobacter sakazakii is searched in protein databases (such as PDB). If no experimentally resolved structure is available, a three-dimensional structural model can be constructed using homology modeling software (such as MODELLER, SWISS-MODEL, etc.). The obtained OmpA protein structure is then optimized, including hydrogenation and energy minimization, to obtain a reasonable and stable initial structure.
[0058] (2) Molecular docking tests were performed on the membrane proteins of Cronobacter sakazakii obtained in step (1).
[0059] The random design capacity is 10 14 A library of short oligoDNA fragments, wherein the length of the short oligoDNA fragments ranges from 40bp to 70bp; the structural information of the membrane protein OmpA of Cronobacter sakazakii in step (1) is imported into the AutoDock-Vina molecular simulation software, and then molecular docking is performed between the short oligoDNA fragment library and the surface domain of the membrane protein OmpA to obtain the free energy of binding between each short oligoDNA fragment and the membrane protein OmpA.
[0060] Nucleic acid aptamers are typically screened using the SELEX technique, which involves multiple rounds of enrichment and screening to select aptamers from a sample containing up to 10 aptamers. 14 In SELEX technology, aptamers with high affinity and specificity for target molecules are screened from single-stranded oligonucleotide libraries containing different nucleic acid sequences. However, a major drawback of SELEX technology is its long screening cycle, typically requiring weeks or even months to obtain specific candidate aptamers. Furthermore, the resulting aptamer sequences are usually long and contain redundant base sequences, leading to high synthesis costs and increasing the likelihood of side reactions during detection.
[0061] The DNA sequences can be randomly generated using programming languages (such as Python) or specialized DNA sequence generation tools (such as DNAWorks). The selected short oligoDNA fragments are then converted into three-dimensional structures. DNA 3D structure modeling tools (such as 3dna, NAB, etc.) can be used to convert the DNA sequences into PDB format 3D structural coordinate files for subsequent molecular docking. Simultaneously, the 3D structural coordinate files are also beneficial for the application of distance optimization models such as ant colony optimization. The conversion to 3D structures is a key aspect of this process.
[0062] In addition, the AutoDock-Vina molecular simulation software was used for molecular docking. The structural files of the OmpA protein and DNA fragment were imported into AutoDock Tools, and polar hydrogen atoms and charges were added to the receptor and ligand molecules. The procedure is as follows:
[0063] Loading receptor molecules in AutoDock Tools: Open AutoDock Tools software, select "File" -> "Read Molecule" in the menu bar, select the PDB file of the OmpA protein and open it. Under the "Edit" menu, select "Hydrogens" -> "Add" to add polar hydrogen atoms to the protein molecule. Under the "Edit" menu, select "Charges" -> "Add Kollman Charges" to add Kollman charges to the protein molecule. Under the "Edit" menu, select "Atoms" -> "Assign AD4 Type" to specify the AutoDock 4 atom type for the protein atoms. Under the "Grid" menu, select "Macromolecule" -> "Choose" to select the processed protein molecule. Under the "File" menu, select "Save" -> "Write PDBQT" to save the processed protein molecule as a PDBQT format file. Loading ligand molecules in AutoDock Tools: In the AutoDock Tools menu bar, select "File" -> "Read Molecule", select the PDB file of the DNA fragment and open it. Under the "Ligand" menu, select "Input" -> "Choose" to select the loaded DNA molecule. Under the "Ligand" menu, select "Torsion Tree" -> "Detect Root" to automatically detect the root atoms of the DNA molecule. Under the "Ligand" menu, select "Torsion Tree" -> "Choose Torsions" to define the rotatable bonds of the DNA molecule. Under the "Ligand" menu, select "Output" -> "Save as PDBQT" to save the processed DNA molecule as a PDBQT format file. Define the docking region: In AutoDock Tools, select "Grid" under the "Grid" menu to open the grid box settings window. Adjust the size and position of the grid box to cover the expected DNA binding sites on the receptor protein. You can refer to known nucleic acid binding sites or use blind docking to cover the entire protein surface. Under the "File" menu, select "Save" -> "SaveGPF" to save the grid parameters as a GPF file for subsequent docking calculations. The above steps complete the import of the OmpA protein and DNA fragment into AutoDock Tools, adding necessary information such as polar hydrogen atoms and charges. The docking calculation region is also defined.
[0064] In addition, a suitable docking region (usually a known or predicted nucleic acid binding site) is defined on the surface of the OmpA protein, and a raster parameter file for this region is generated. The Vina algorithm is used for molecular docking search. Using each DNA fragment as a ligand and the OmpA protein as the acceptor, a stable binding conformation is searched within the defined docking region. The docking process can be controlled by adjusting parameters such as search precision and exhaustiveness. After docking, Vina outputs a series of top-scoring docking conformations and their binding free energies. The conformation with the lowest binding free energy for each DNA fragment is selected as its representative conformation for binding with the OmpA protein.
[0065] (3) Optimize the molecular docking results obtained in step (2) using the ant colony algorithm model.
[0066] The free energy of the above combination is optimized by combining an improved ant colony algorithm model, and the algorithm formula of the model is as follows:
[0067] (I),
[0068] (II)
[0069] In the formula, Ants From node To the node The transition probability value, express Time Node To the node pheromone concentration, express Time Node To the node The constant heuristic function, where α represents the pheromone enhancement coefficient and β represents the heuristic information coefficient. The specified position indicating the binding free energy of a short-chain oligopeptide fragment. express Time Node To the node pheromone concentration, express Time Node To the node constant heuristic function, express The set of nodes that a node can choose next is... Ants via node To the node The sum of pheromones released, Indicates the pheromone volatility coefficient (0 < <1), Ants via node To the node Increase in the amount of pheromones released;
[0070] Based on the results of the optimization process, statistics The corresponding short oligoDNA fragments were used to obtain matching nucleic acid aptamers of Cronobacter sakazakii. Finally, nucleic acid secondary structure prediction software (such as mfold, RNAstructure, etc.) was used to predict the structure of the generated DNA sequences and screen out DNA sequences that could form suitable secondary structures (such as hairpins, stem loops, etc.).
[0071] Example 2
[0072] The steps for using the Cronobacter sakazakii aptamer from Example 1 to prepare a biosensor are as follows:
[0073] (1) Preparation of activation mixture
[0074] 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed at a volume ratio of 1:1 to obtain an activated mixture.
[0075] (2) Preparation of the first aptamer solution
[0076] A 10 μM solution of the first aptamer was prepared by adding 10 μM of the aptamer (DNA sequence SEQ ID No:1) to 180 μL of activation mixture. The 5' end of the first aptamer was modified with an amino group; see [link to relevant documentation]. Figure 6 When the fluorescence emission wavelength of the fluorescent material shifts from 424 nm to 420 nm, it indicates that the first aptamer in the fluorescence quenching biosensor has been successfully modified onto the fluorescent material.
[0077] (3) Preparation of the second aptamer solution
[0078] A 10 μM solution of the second aptamer with a molar concentration of 10 μM was prepared by adding 10 μM of the aptamer, as shown in SEQ ID No:2, to 180 μL of activation mixture. The aptamer shown in SEQ ID No:2 is gggtcgggggtggtgggtgg gggttctcgt ctggcttcgg. The 5' end of the second aptamer was modified with a thiol group. "1" represents the UV absorption spectrum before covalent coupling, and "2" represents the UV absorption spectrum after covalent coupling. See also... Figure 7 When the ultraviolet absorption wavelength of gold nanoparticles shifts from 520 nm to 523 nm, it indicates that the nucleic acid aptamer in the fluorescent probe has been successfully modified onto the gold nanoparticles.
[0079] (4) Preparation of fluorescent probes
[0080] Add 2g of citric acid and 2g of L-cysteine to 30mL of ultrapure water, sonicate to dissolve, heat to 180℃, maintain the reaction at 180℃ for 1.5h, and cool to room temperature. Dialyze for 5 days to obtain a brown reaction solution. Vortex mix 500µL of the brown reaction solution with 200µL of the activation mixture and incubate on a shaker for 40min; then add 100µL of the first aptamer solution and incubate on a shaker for 3h to obtain the fluorescent probe. See [link to relevant documentation]. Figure 4 and Figure 5 .
[0081] (5) Preparation of quenching probe
[0082] Add 1 mL of 1% tetrachloroauric acid solution to 120 mL of distilled water, boil, add 3 mL of 1% trisodium citrate solution, continue boiling for 18 min, and cool to room temperature to obtain a gold nanoparticle solution.
[0083] 100 μL of the second aptamer solution was incubated in a 95°C water bath for 5 min and then cooled to room temperature. 10 μL of 3-(2-formylethyl)phosphohydrochloride solution with a final concentration of 2.867 g / L was added, and the mixture was allowed to stand for 40 min. Then, 1.2 mL of gold nanoparticle solution was added, and the mixture was incubated at 37°C for 16 h. The supernatant was removed by centrifugation. The precipitate was resuspended in 500 μL of phosphate buffer with a pH of 7.4 to obtain the quenching probe.
[0084] (6) Fabrication of biosensors
[0085] A fluorescent probe and a quenching probe were mixed at a volume ratio of 1:1.8 to prepare a fluorescent quenching biosensor.
[0086] Example 3
[0087] The principle of detecting Cronobacter sakazakii using the fluorescence-quenched biosensor prepared in Example 2 is as follows: Figure 3 As shown, the operation steps are as follows:
[0088] (1) Establishment of linear regression equation: Prepare a test solution of the test sample without bacteria and set it as a blank control test solution. Artificially contaminate the blank control test solution with Cronobacter sakazakii and set up a test solution containing bacteria with linear gradient dilution.
[0089] The fluorescence-quenched biosensor was mixed with the blank control test solution and the bacterial test solution at a volume ratio of 1:1 and incubated for 40 min to obtain the incubation solution.
[0090] The fluorescence intensity of the incubation solution was measured at an excitation wavelength of 365 nm and an emission wavelength of 420 nm. The fluorescence intensity of the blank control solution was denoted as F0, and the fluorescence intensity of the bacterial test solution was denoted as F. A standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the bacterial concentration in the bacterial test solution as the abscissa. The linear regression equation was obtained, and the correlation coefficient and detection limit were obtained.
[0091] (2) Detection of Cronobacter sakazakii in the test sample: Prepare the test solution of the test sample, mix the fluorescence quenching biosensor with the test solution at a volume ratio of 1:1, incubate for 40 min to obtain the incubation solution; measure the fluorescence intensity of the incubation solution at an emission wavelength of 420 nm at an excitation wavelength of 365 nm.
[0092] Based on the obtained fluorescence intensity ratio F1 / F0, substitute it into the linear regression equation obtained in step (2) to obtain the concentration of Cronobacter sakazakii in the sample to be tested.
[0093] In the experiment, PBS buffer was selected as the blank control solution. Meanwhile, the *Cronobacter sakazakii* bacterial culture was centrifuged, washed three times with PBS buffer, resuspended in PBS buffer, and serially diluted to prepare concentrations of 10-1. 1 CFU / mL, 10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL, 10 7 CFU / mL of bacterial test solution. First, 100 μL of the prepared fluorescence-quenched biosensor was taken and incubated with 100 μL of blank control test solution and 100 μL of serially diluted bacterial test solution at 37 °C for 40 min to obtain the incubation solution. Then, the fluorescence intensity of the incubation solution at the emission wavelength of 420 nm was measured at an excitation wavelength of 365 nm. The fluorescence intensity of the blank control test solution was recorded as F0, and the fluorescence intensity of the bacterial test solution was recorded as F. A standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the bacterial concentration of the bacterial test solution as the abscissa to obtain the linear regression equation, correlation coefficient and detection limit.
[0094] The fluorescence quenching biosensor prepared by this invention has a fluorescent probe with a distinct fluorescence emission peak at 420 nm. At the same time, the ratio between the fluorescence intensity value F at 420 nm and the fluorescence intensity value F0 at 420 nm is linearly related to the logarithm of the bacterial concentration of Cronobacter sakazakii.
[0095] Also see, from top to bottom, the fluorescence spectrum curves are: curve 0 represents the fluorescence spectrum curve of a bacterial concentration of 0 CFU / mL (blank control test solution), curve 1 represents the fluorescence spectrum curve of a bacterial concentration of 10 CFU / mL. 1 The fluorescence spectrum curve for CFU / mL, curve 2 indicates a bacterial concentration of 10. 2 The fluorescence spectrum curve for CFU / mL, curve 3 indicates a bacterial concentration of 10. 3 The fluorescence spectrum curve for CFU / mL, curve number 4 indicates a bacterial concentration of 10. 4 The fluorescence spectrum curve for CFU / mL, curve number 5 indicates a bacterial concentration of 10. 5 The fluorescence spectrum curve for CFU / mL, curve number 6 indicates a bacterial concentration of 10. 6 The fluorescence spectrum curve for CFU / mL, curve number 7 indicates a bacterial concentration of 10. 7 Fluorescence spectrum of CFU / mL; see also Figure 8 The ratio of the fluorescence intensity value F at 420 nm to the fluorescence intensity value F0 at 420 nm on the fluorescence spectrum curves above is taken as the ordinate, and the logarithm of the bacterial concentration corresponding to each fluorescence spectrum curve is taken as the abscissa. The linear regression equation is y = -0.09515x + 1.03153, and the correlation coefficient (r) is... 2 The value was 0.993, and the limit of detection was 4.27 CFU / mL.
[0096] In addition, specific detection tests were conducted on the fluorescence quenching biosensor:
[0097] The *Cronobacter sakazakii* was replaced with *Staphylococcus aureus*, *Salmonella*, *Escherichia coli*, *Listeria monocytogenes*, and *Pseudomonas aeruginosa*, respectively; and concentrations of 1.0 x 10⁻⁶ were prepared for each. 6 CFU / mL of bacterial test solution.
[0098] See Figure 9 As can be seen, the fluorescence intensity ratios F / F0 of the test solutions containing Staphylococcus aureus, Salmonella, Escherichia coli, Listeria monocytogenes, and Pseudomonas aeruginosa were 0.99±0.02, 0.93±0.04, 0.91±0.03, 0.96±0.02, and 0.94±0.02, respectively. Meanwhile, under the same conditions, the fluorescence intensity ratio F / F0 of the test solutions containing Listeria monocytogenes was 0.41. Furthermore, under the same conditions, the fluorescence intensity ratio F0 / F0 of the blank control test solutions was 1. This demonstrates that the fluorescence quenching biosensor prepared in this invention has good specificity for Listeria monocytogenes.
[0099] Example 4
[0100] Based on Example 3, the testing of real food samples was added, selecting pre-prepared processed foods and the *Cronobacter sakazakii* nucleic acid aptamer designed in this invention for testing:
[0101] It should be noted that, in order to verify whether the above standard curve can be effectively applied to the determination under interference environment (pre-prepared food), this embodiment separately conducted the difference between the number of bacteria detected by the probe in artificial quantitative bacterial contamination and pre-prepared food, so as to know that even in real samples, the fluorescent probe established by this invention can be effectively detected under the influence of nutrients such as high protein, high salt, and high fat.
[0102] It should be noted that the pre-prepared beef balls involved in this embodiment are purchased from a certain food company. The product standard number is DB44 / 005-2016, and its composition (per 100g) is as follows: protein 26g, fat 9.8g, starch 2.4g, energy 428KJ.
[0103] In the experiment, *Cronobacter sakazakii* was artificially inoculated into 1 mL of pre-prepared seasoned beef meatballs. The final concentration of *Cronobacter sakazakii* after inoculation was 1.00 x 10⁻⁶. 6 The concentration of CFU / mL was centrifuged at 5000×g for 5 min, the supernatant was discarded, and the precipitate was resuspended in 1 mL of PBS buffer as the bacterial test solution. Then, 500 μL of the test solution was mixed with 500 μL of the prepared fluorescence quenching biosensor and incubated for 40 min to obtain the incubation solution. Next, the fluorescence intensity of the incubation solution at the emission wavelength of 420 nm was measured at an excitation wavelength of 365 nm. The fluorescence intensity of the blank control test solution was recorded as F0, and the fluorescence intensity of the bacterial test solution was recorded as F. Finally, the concentration of Cronobacter sakazakii in the test sample was obtained by substituting the obtained fluorescence intensity ratio F / F0 into the linear regression equation.
[0104] The experimental results showed that, based on calculations, the concentration of *Cronobacter sakazakii* detected by the fluorescent probe in pre-prepared processed foods under artificial inoculation conditions was 0.99 x 10⁻⁶. 6 CFU / mL, almost identical to its true concentration (1.00 x 10⁻⁶). 6 The CFU / mL ratio is close to the standard curve, indicating that even without establishing a corresponding standard curve and linear regression equation under the pre-prepared food environment, the standard curve and linear regression equation established under the pure PBS solution environment still have good versatility. Therefore, the fluorescent probe prepared by this invention has good versatility and can be quickly applied to the detection of different samples.
[0105] Those skilled in the art will readily understand that the above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A *Cronobacter sakazakii* aptamer, characterized in that: The DNA sequence of the *Cronobacter sakazakii* aptamer is shown in SEQ ID No:1; the *Cronobacter sakazakii* aptamer specifically recognizes *Cronobacter sakazakii*.
2. A method for preparing a fluorescence-quenched biosensor based on the *Cronobacter sakazakii* aptamer according to claim 1, characterized in that, The operation steps are as follows: (1) Preparation of activation mixture 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed at a volume ratio of 1:1 to obtain an activated mixture. (2) Preparation of the first aptamer solution 10 μM of the aptamer with the DNA sequence SEQ ID No:1 was added to 180 μL of activation mixture to prepare a first aptamer solution with a molar concentration of 10 μM. (3) Preparation of the second aptamer solution 10 μM of the aptamer with the DNA sequence SEQ ID No:2 was added to 180 μL of activation mixture to prepare a second aptamer solution with a molar concentration of 10 μM. The aptamer shown in the DNA sequence SEQ ID No:2 is gggtcggggg tggtgggtgg gggttctcgtctggcttcgg; (4) Preparation of fluorescent probes 2g of citric acid and 2g of L-cysteine were added to 30mL of ultrapure water, dissolved by sonication, heated to 180℃, and maintained at 180℃ for 1.5h. The mixture was then cooled to room temperature. After dialysis for 5 days, a brown reaction solution was obtained. 500uL of the brown reaction solution was vortexed with 200uL of the activation mixture and incubated on a shaker for 40min. Then, 100uL of the first aptamer solution was added and incubated on a shaker for 3h to obtain the fluorescent probe. (5) Preparation of quenching probe Add 1 mL of 1% tetrachloroauric acid solution to 120 mL of distilled water, boil, add 3 mL of 1% trisodium citrate solution, continue boiling for 18 min, and cool to room temperature to obtain gold nanoparticle solution. 100 μL of the second aptamer solution was incubated in a 95°C water bath for 5 min and then cooled to room temperature. 10 μL of 3-(2-formylethyl)phosphohydrochloride solution with a final concentration of 2.867 g / L was added, and the mixture was allowed to stand for 40 min. Then, 1.2 mL of gold nanoparticle solution was added, and the mixture was incubated at 37°C for 16 h. The supernatant was removed by centrifugation. The precipitate was resuspended in 500 μL of phosphate buffer at pH 7.4 to obtain the quenching probe. (6) Fabrication of biosensors A fluorescent probe and a quenching probe were mixed at a volume ratio of 1:1.8 to prepare a fluorescent quenching biosensor.
3. A method for preparing a fluorescent probe based on the *Cronobacter sakazakii* aptamer as described in claim 2, characterized in that: In step (4), when the fluorescence emission wavelength of the fluorescent probe shifts from 424 nm to 420 nm, it indicates that the first aptamer has been successfully modified onto the fluorescent material.
4. A method for preparing a fluorescent probe based on the *Cronobacter sakazakii* aptamer as described in claim 2, characterized in that: In step (5), when the ultraviolet absorption wavelength of the gold nanoparticles shifts from 520 nm to 523 nm, it indicates that the second aptamer has been successfully modified onto the gold nanoparticles.
Citation Information
Patent Citations
Specific new molecular targets for 4 species in Cronobacter, and rapid detection methods of 4 species in Cronobacter
CN110951898A
3D-DNA walker aptamer sensor based on magnetic separation and cronobacter detection method
CN117434263A