Compositions and methods for preparing capped mRNA

By connecting the nucleic acid promoter and cap analog on the DNA template and combining appropriate reaction conditions, the problem of low efficiency of synthesis of capped mRNA in vitro is solved, and high yield and high purity mRNA preparation is achieved, which is suitable for basic scientific research and therapeutic development.

CN120456815AActive Publication Date: 2025-08-08GENSCRIPT USA INC +1
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
CN202380071714.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-20
Filing Date
2023-08-09
Publication Date
2025-08-08
Estimated Expiration
2043-08-09

AI Technical Summary

Technical Problem

The prior art is inefficient and costly when synthesizing capped mRNAs in vitro, making it difficult to produce mRNAs with high expression levels and stability.

Method used

A method is provided to prepare capped mRNA by ligating the nucleic acid promoter, 5'UTR, ORF, 3'UTR and polyA regions on a DNA template and using a cap analog to bind the -1 and/or +1 nucleotides of the promoter, incubating with appropriate reaction mixtures and temperature.

Benefits of technology

It improves mRNA yield, purity and capping efficiency, achieves time and cost-effectiveness, and is suitable for mRNA synthesis of different sizes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005348691950000031
    Figure BDA0005348691950000031
  • Figure BDA0005348691950000241
    Figure BDA0005348691950000241
  • Figure BDA0005348691950000291
    Figure BDA0005348691950000291
Patent Text Reader

Abstract

A method for transcribing a DNA template into RNA in vitro includes providing a mixture comprising a buffer material, ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration of from about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at from about 25 DEG C to about 40 DEG C for from about 1 hour to about 12 hours, thereby producing the RNA. In one embodiment, a method for in vitro transcription includes providing a DNA template and a cap analog that binds-1 and / or + 1 nucleotides of a promoter for in vitro transcription, thereby producing mRNA of more complete length, allowing for more flexible selection of a first mRNA base, and providing a + 2 position open to a custom sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Related applications

[0001] This application claims priority to U.S. Application No. 18 / 069,123, filed December 20, 2022, U.S. Provisional Application No. 63 / 371,132, filed August 11, 2022, and U.S. Provisional Application No. 63 / 396,904, filed August 10, 2022. Each of these applications is incorporated by reference in its entirety for all purposes. References to sequence listings submitted as compliant XML files (.xml)

[0002] In accordance with the EFS-Web legal framework and 37 C.FR §1.821-825 (see MPEP §2442.03(a)), a sequence listing in the form of a compliant XML file (titled "3000076-005977_Supp-SL_ST26.xml", created on September 29, 2023, and 73,234 bytes in size) is submitted concurrently with this application, and the entire contents of the sequence listing are incorporated herein by reference. Background Art

[0003] The present disclosure generally relates to methods and compositions for in vitro transcription.

[0004] mRNA is a well-defined molecule with a structure consisting of a 5' cap, a 5' untranslated region (UTR), an open reading frame sequence encoding one or more genes of interest, and a 3' UTR, along with a poly(A) tail. The production of capped mRNA by in vitro synthesis has the potential to be of great significance for both basic scientific research and the development of new therapeutics. Several factors contribute to the production of mRNA with high expression levels, stability, and functionality.

[0005] The flanks of an mRNA molecule may be flanked by 5' and 3' untranslated regions (UTRs). The 5'-UTR serves as an entry site for ribosomes to initiate translation, and the 3'UTR plays an important role in translation termination and post-translational modifications (which may affect the expression and half-life of mRNA). The poly A tail of mRNA can make RNA molecules more stable and prevent mRNA degradation. In addition, the poly A tail can allow mature messenger RNA to be exported from the nucleus and translated into protein by ribosomes in the cytoplasm. See, for example, Sachs A and Wahle E, "Poly (A) tail metabolism and function in eucaryotes", J Biol Chem, (November 5, 1993); 268 (31): 22955-8, incorporated herein by reference in its entirety.

[0006] The mRNA cap is a highly methylated modification at the 5' end of the mRNA that protects the mRNA from degradation, recruits complexes involved in mRNA processing, and marks the cellular mRNA to avoid recognition by the immune system. In mammals, the predominant 5' cap structure is an inverted 7-methylguanosine nucleotide attached to the first transcribed nucleotide via a 5'-5' triphosphate bond. 7-methylguanosine is methylated at its 7th carbon position and can be referred to as m7 G or 7m G. The cap structure can be represented as 5' m7 GpppN1(pN) x , wherein N is any nucleotide and x is 0 or any number. In the cap 0 structure, the first nucleotide has a 2' hydroxyl group in its ribose, while in the cap 1 structure, the first nucleotide has a 2'-o-methyl modification in its ribose, and the structure may contain from the 5' end to the 3' end m7 G 5' pppN1 2'-OMe (pN) x , where N is any nucleotide and x can be any integer. In addition, in the cap 2 structure, m7 The 2' hydroxyl groups of the first ribose and the second ribose connected by G are methylated. The structure can contain m7 G 5' pppN1 2'-OMe pN2 2'-OMe (pN) x , where N is any nucleotide and x can be any integer. See, e.g., Perry RP, "RNA processing comes of age", J Cell Biol. (December 1981); 91(3Pt2): 28s-38s, incorporated herein by reference in its entirety.

[0007] Capping can improve the properties of mRNA, such as, but not limited to, its stability and its translation efficiency. See, for example, Banerjee AK, "5'-terminal cap structure in eucaryotic messenger ribonucleic acid", Microbiol Rev. (June 1980); 44(2): 175-205, incorporated herein by reference in its entirety. In vivo, each capping process can be performed enzymatically. See, for example, Perry. These processes can be time-consuming, inefficient, and expensive to perform in vitro.

[0008] The production of capped mRNA by in vitro synthesis may be of great significance for basic science research, pharmacological development, and therapeutic development. Several factors may contribute to the production of mRNA that can have high expression levels, stability, and functionality. There is a need for an efficient in vitro transcription method that will allow for more efficient production of capped mRNA that can have high expression levels, stability, functionality, or a combination thereof. Summary of the Invention

[0009] In one aspect, the present disclosure relates to a method for in vitro transcribing a DNA template into RNA, the method comprising providing (1) a DNA template comprising a promoter operably linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding an RNA of interest, a 3'UTR, and a poly A region, and (2) a cap analog comprising the following structure: wherein R1 and R2 may each be CH3 or H; and B1 and B2 may each be A, U, G or C, The promoter may contain the sequence of TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), wherein A at position 17 is -1 nucleotide and X1 at position 18 is +1 nucleotide, When X1 is G, X2 and X3 are each A, T, G or C, then B1 is A and B2 is G, when X1 is A, X2 and X3 are each A, T, G or C, then B1 is A and B2 is A, When X1 is C, X2 and X3 are each A, T, G or C, then B1 is A and B2 is C, and When X1 is T, X2 and X3 are each A, T, G or C, then B1 is A and B2 is U, wherein the cap analog binds to -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analog in a reaction mixture, wherein the incubating can comprise incubating the reaction mixture at from about 15°C to about 35°C for about 1 hour to about 12 hours, thereby producing RNA.

[0010] In another aspect, the promoter may contain a sequence selected from the group consisting of SEQ ID NOs: 10, 11, 13, and 14.

[0011] In another aspect, the 5'UTR and the 3'UTR can be SEQ ID NO: 1 and 2, 1 and 4, 1 and 6, 3 and 2, 3 and 4, 3 and 6, 3 and 8, 5 and 2, 5 and 4, 5 and 6, 7 and 2, 7 and 4, 7 and 6, 7 and 8, 9 and 2, 9 and 4, 9 and 6, or 9 and 8, respectively.

[0012] In another aspect, the 5'UTR and the 3'UTR can be SEQ ID NOs: 1 and 2, 1 and 4, 3 and 2, 1 and 6, 7 and 4, 9 and 2, or 3 and 6, respectively.

[0013] In another aspect, the poly A block can contain from about 60 to about 200 A's, from about 60 to about 190 A's, from about 60 to about 180 A's, from about 60 to about 170 A's, from about 60 to about 160 A's, from about 60 to about 150 A's, from about 60 to about 140 A's, from about 60 to about 130 A's, from about 60 to about 120 A's, from about 60 to about 110 A's, from about 60 to about 100 A's , from about 70 to about 190 A, from about 80 to about 180 A, from about 90 to about 170 A, from about 100 to about 160 A, from about 100 to about 150 A, from about 100 to about 140 A, from about 100 to about 130 A, from about 100 to about 120 A, about 100 A, about 110 A, about 120 A, about 130 A, about 140 A, or about 150 A.

[0014] In another aspect, the cap analog can be selected from the group consisting of: 7 GpppApA、m 7 GpppApC、m 7 GpppApG、m 7 GpppApU、m 7 G 3'Ome pppApA、m 7 G 3'Ome pppApC、m 7 G 3'Ome pppApG、m 7 G 3'Ome pppApU、m 7 G 3' Ome pppA 2'Ome pA, m 7 G 3'Ome pppA 2'Ome pC、m 7 G 3'Ome pppA 2'Ome pG、m 7 G 3'Ome pppA 2'Ome pU、m 7 GpppA 2'Ome pA, m 7 GpppA 2'Ome pC、m 7 GpppA 2'Ome pG and m 7 GpppA2'Ome pU.

[0015] In another aspect, the reaction mixture can contain a buffer substance at a concentration of from about 45 mM to about 55 mM, an RNase inhibitor at a concentration of from about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of from about 3 mM to about 5 mM, a cap analog at a concentration of from about 6 mM to about 8 mM, one or more magnesium salts at a concentration of from about 20 mM to about 30 mM, a polyamine at a concentration of from about 1.5 mM to about 2.5 mM, a DNA template at a concentration of from about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of from about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of from about 0.01 μg / μl to about 0.05 μg / μl.

[0016] In another aspect, the RNA polymerase can be selected from wild-type T7 RNA polymerase or a variant thereof.

[0017] In another aspect, the incubating can comprise incubating the reaction mixture at from about 18°C to about 31°C.

[0018] In another aspect, the incubating can comprise incubating the reaction mixture at about 30°C for about 4 hours.

[0019] In another aspect, the DNA template may further contain at least one transcription terminator located upstream and / or downstream of the open reading frame (ORF).

[0020] In one aspect, the present disclosure relates to a method for in vitro transcription of a DNA template into RNA, the method comprising providing a mixture comprising ribonucleoside triphosphates (NTPs), a DNA template, and an RNA polymerase (e.g., a recombinant RNA polymerase), and incubating the reaction mixture at from about 15° C. to about 35° C., optionally from about 18° C. to about 31° C., for a suitable time, preferably from about 1 hour to about 12 hours, thereby producing RNA. Preferably, the mixture further comprises a buffer substance and one or more magnesium salts. The mixture may optionally further comprise a cap analog.

[0021] In one aspect, the disclosure relates to a method for in vitro transcribing a DNA template into RNA, the method comprising providing a mixture comprising a buffer substance, ribonucleoside triphosphates (NTPs), one or more magnesium salts at a concentration from about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at from about 15° C. to about 35° C., optionally from about 18° C. to about 31° C., for from about 1 hour to about 12 hours, thereby producing RNA.

[0022] In another aspect, the buffer substance can be Tris base, HEPES or Tris-HCl.

[0023] In another aspect, the concentration of the buffer substance can be from about 1 mM to about 100 mM, from about 1 mM to about 90 mM, from about 1 mM to about 80 mM, from about 1 mM to about 70 mM, from about 1 mM to about 60 mM, from about 1 mM to about 50 mM, from about 1 mM to about 40 mM, from about 1 mM to about 30 mM, from about 1 mM to about 20 mM, from about 1 mM to about 10 mM, from about 1 mM to about 5 mM, from about 10 mM to about 20 mM, mM, from about 10 mM to about 30 mM, from about 10 mM to about 40 mM, from about 10 mM to about 50 mM, from about 20 mM to about 50 mM, from about 30 mM to about 50 mM, from about 40 mM to about 50 mM, from about 45 mM to about 50 mM, from about 45 mM to about 55 mM, from about 15 mM to about 45 mM, from about 15 mM to about 35 mM, from about 15 mM to about 30 mM, or from about 15 mM to about 25 mM.

[0024] In another aspect, the concentration of the NTPs can be from about 1 mM to about 50 mM, from about 1 mM to about 40 mM, from about 1 mM to about 30 mM, from about 1 mM to about 20 mM, from about 1 mM to about 10 mM, from about 1 mM to about 5 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 9 mM, from about 3 mM to about 8 mM, from about 3 mM to about 7 mM, from about 3 mM to about 6 mM, from about 3 mM to about 5 mM, from about 3 mM to about 4 mM, from about 4 mM to about 10 mM, from about 5 mM to about 10 mM, from about 6 mM to about 10 mM, from about 7 mM to about 10 mM, from about 8 mM to about 10 mM, or from about 9 mM to about 10 mM.

[0025] In another aspect, the concentration of the one or more magnesium salts can be from about 2 mM to about 50 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 20 mM, from about 2 mM to about 10 mM, from about 2 mM to about 5 mM, from about 5 mM to about 50 mM, from about 10 mM to about 45 mM, from about 15 mM to about 40 mM, from about 20 mM to about 35 mM, from about 20 mM to about 30 mM, from about 20 mM to about 25 mM, from about 22 mM to about 28 mM, or from about 25 mM to about 30 mM.

[0026] In another aspect, the concentration of the DNA template can be from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 2 μg / μl, from about 0.01 μg / μl to about 1.5 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, from about 0.01 μg / μl to about 0.05 μg / μl, from about 0.02 μg / μl to about 0.04 μg / μl, from about 0.02 μg / μl to about 0.1 μg / μl, from about 0.03 μg / μl to about 0.1 μg / μl, from about 0.04 μg / μl to about 0.1 μg / μl, from about 0.05 μg / μl to about 0.1 μg / μl, from about 0.06 μg / μl to about 0.1 μg / μl, from about 0.07 μg / μl to about 0.1 μg / μl, from about 0.08 μg / μl to about 0.1 μg / μl, or from about 0.09 μg / μl to about 0.1 μg / μl.

[0027] In another aspect, the concentration of the recombinant RNA polymerase can be from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.3 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, from about 0.01 μg / μl to about 0.05 μg / μl. / μl, from about 0.1 μg / μl to about 1 μg / μl, from about 0.1 μg / μl to about 0.9 μg / μl, from about 0.1 μg / μl to about 0.8 μg / μl, from about 0.1 μg / μl to about 0.7 μg / μl, from about 0.1 μg / μl to about 0.6 μg / μl, from about 0.1 μg / μl to about 0.5 μg / μl, from about 0.1 μg / μl to about 0.4 μg / μl, from about 0.1 μg / μl to about 0.3 μg / μl, or from about 0.1 μg / μl to about 0.2 μg / μl.

[0028] In another aspect, the mixture may further contain an antioxidant.

[0029] In another aspect, the antioxidant can be dithiothreitol (DTT) at a concentration of from about 1 mM to about 50 mM, from about 2 mM to about 50 mM, from about 3 mM to about 50 mM, from about 4 mM to about 50 mM, from about 5 mM to about 50 mM, from about 6 mM to about 50 mM, from about 7 mM to about 50 mM, from about 8 mM to about 50 mM, from about 9 mM to about 50 mM, from about 10 mM to about 50 mM, from about 10 mM to about 40 mM, from about 15 mM to about 30 mM, from about 15 mM to about 25 mM, from about 15 mM to about 20 mM, from about 20 mM to about 50 mM, from about 30 mM to about 50 mM, or from about 40 mM to about 50 mM.

[0030] In another aspect, the mixture can further contain an RNase inhibitor at a concentration of from about 0.001 U / μl to about 5 U / μl, from about 0.001 U / μl to about 4 U / μl, from about 0.001 U / μl to about 3 U / μl, from about 0.001 U / μl to about 2 U / μl, from about 0.001 U / μl to about 1 U / μl, from about 0.01 U / μl to about 5 U / μl, from about 0.01 U / μl to about 4 U / μl, from about 0.01 U / μl to about 3 U / μl, from about 0.01 U / μl to about 2 U / μl, from about 0.01 U / μl to about 1 U / μl, from about 0.01 U / μl to about 0.5 U / μl, from about 0.01 U / μl to about 0.1 U / μl, from about 0.01 U / μl to about 0.05 U / μl, from about 0.0 1 U / μl to about 0.04 U / μl, from about 0.01 U / μl to about 0.03 U / μl, from about 0.01 U / μl to about 0.02 U / μl, from about 0.1 U / μl to about 5 U / μl, from about 0.1 U / μl to about 4 U / μl, from about 0.1 U / μl to about 3 U / μl, from about 0.1 U / μl to about 2 U / μl, from about 0.1 U / μl to about 1 U / μl, from about 0.1 U / μl to about 1 U / μl, from about 0.1 U / μl to about 2 U / μl From about 0.5 U / μl to about 5 U / μl, from about 0.5 U / μl to about 4 U / μl, from about 0.5 U / μl to about 3 U / μl, from about 0.5 U / μl to about 2 U / μl, from about 0.5 U / μl to about 1 U / μl, from about 1 U / μl to about 5 U / μl, from about 2 U / μl to about 5 U / μl, from about 3 U / μl to about 5 U / μl, or from about 4 U / μl to about 5 U / μl.

[0031] In another aspect, the mixture can further contain a cap analog at a concentration of from about 0.5 mM to about 50 mM, from about 0.5 mM to about 40 mM, from about 0.5 mM to about 30 mM, from about 0.5 mM to about 20 mM, from about 0.5 mM to about 10 mM, from about 0.5 mM to about 5 mM, from about 1 mM to about 10 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 9 mM, From about 3mM to about 8mM, from about 3mM to about 7mM, from about 3mM to about 6mM, from about 3mM to about 5mM, from about 3mM to about 4mM, from about 4mM to about 10mM, from about 5mM to about 10mM, from about 6mM to about 10mM, from about 6mM to about 10mM, from about 6mM to about 9mM, from about 6mM to about 8mM, from about 6mM to about 7mM, from about 7mM to about 10mM, from about 8mM to about 10mM, or from about 9mM to about 10mM.

[0032] In another aspect, the mixture may further contain a polyamine.

[0033] In another aspect, the polyamine can be spermine, spermidine, or a combination thereof.

[0034] In another aspect, the concentration of the polyamine can be from about 0.1 mM to about 5 mM, from about 0.2 mM to about 4.9 mM, from about 0.2 mM to about 4.8 mM, from about 0.2 mM to about 4.7 mM, from about 0.2 mM to about 4.6 mM, from about 0.2 mM to about 4.5 mM, from about 0.2 mM to about 4.4 mM, from about 0.2 mM to about 4.3 mM, from about 0.2 mM to about 4.2 mM, from about 0.2 mM to about 4.1 mM, from about 0.2 mM to about 4 mM, from about 0.2 mM to about 3.5 mM, from about 0.2 mM to about 3 mM, from about 0.2 mM to about 4.6 mM, From about 0.2mM to about 2.5mM, from about 0.5mM to about 2.5mM, from about 1.0mM to about 2.5mM, from about 1.5mM to about 2.5mM, from about 0.2mM to about 2mM, from about 0.2mM to about 1.5mM, from about 0.2mM to about 1mM, from about 0.2mM to about 0.9mM, from about 0.2mM to about 0.8mM, from about 0.2mM to about 0.7mM, from about 0.2mM to about 0.6mM, from about 0.2mM to about 0.5mM, from about 0.2mM to about 0.4mM, or from about 0.2mM to about 0.3mM.

[0035] In another aspect, the mixture can further contain pyrophosphatase at a concentration of from about 0.01 mU / μl to about 2 mU / μl, from about 0.01 mU / μl to about 1.5 mU / μl, from about 0.01 mU / μl to about 1 mU / μl, from about 0.1 mU / μl to about 2 mU / μl, from about 0.1 mU / μl to about 1.5 mU / μl, from about 0.1 mU / μl to about 1 mU / μl, from about 0.1 mU / μl to about 1 mU / μl, from about 0.1 mU / μl to about 2 mU / μl, from about 0.1 mU / μl to about 1.5 mU / μl, from about 0.1 mU / μl to about 1 mU / μl, from about 0.1 mU / μl to about μl to about 0.9 mU / μl, from about 0.1 mU / μl to about 0.8 mU / μl, from about 0.1 mU / μl to about 0.7 mU / μl, from about 0.1 mU / μl to about 0.6 mU / μl, from about 0.1 mU / μl to about 0.5 mU / μl, from about 0.1 mU / μl to about 0.4 mU / μl, from about 0.1 mU / μl to about 0.3 mU / μl, or from about 0.1 mU / μl to about 0.2 mU / μl.

[0036] In another aspect, incubating the reaction mixture is performed at a temperature of from about 15°C to about 35°C, from about 16°C to about 35°C, from about 17°C to about 35°C, from about 18°C to about 35°C, from about 18°C to about 34°C, from about 18°C to about 33°C, from about 18°C to about 32°C, from about 18°C to about 31°C, from about 18°C to about 30°C, from about 18°C to about 29°C, from about 18°C to about 28°C, from about 18°C to about 27°C, from about 18°C to about 26°C, from about 18°C to about 25°C, From about 18°C to about 24°C, from about 18°C to about 23°C, from about 18°C to about 22°C, from about 18°C to about 21°C, from about 18°C to about 20°C, from about 18°C to about 19°C, from about 25°C to about 26°C, from about 25°C to about 27°C, from about 25°C to about 28°C, from about 25°C to about 29°C, from about 25°C to about 30°C, from about 25°C to about 31°C, from about 21°C to about 22°C, from about 21°C to about 23°C, from about 21°C to about 24°C, or from about 21°C to about 25°C.

[0037] In another aspect, the reaction mixture is incubated for a period of time from about 1 hour to about 12 hours, from about 1 hour to about 11 hours, from about 1 hour to about 10 hours, from about 1 hour to about 9 hours, from about 1 hour to about 8 hours, from about 1 hour to about 7 hours, from about 1 hour to about 6 hours, from about 1 hour to about 5 hours, from about 1 hour to about 4 hours, from about 1 hour to about 3 hours, from about 1 hour to about 2 hours, from about 2 hours to about 12 hours, from about 3 hours to about 12 hours, from about 4 hours to about 12 hours, from about 5 hours to about 12 hours, from about 6 hours to about 12 hours, from about 7 hours to about 12 hours, from about 8 hours to about 12 hours, from about 9 hours to about 12 hours, from about 10 hours to about 12 hours, or from about 11 hours to about 12 hours.

[0038] In another aspect, incubating the reaction mixture can be at about 25°C for from about 1 hour to about 5 hours, from about 1.5 hours to about 4.5 hours, from about 2 hours to about 4 hours, from about 2.5 hours to about 3.5 hours, or from about 2.5 hours to about 3 hours.

[0039] In another aspect, incubating the reaction mixture can be at about 31° C. for from about 1 hour to about 5 hours, from about 1 hour to about 4.5 hours, from about 1 hour to about 4 hours, from about 1 hour to about 3.5 hours, from about 1 hour to about 3 hours, from about 1 hour to about 2.5 hours, from about 1 hour to about 2 hours, from about 1 hour to about 1.5 hours, from about 0.5 hour to about 1 hour, or from about 0.5 hour to about 1.5 hours.

[0040] In another aspect, the DNA template can include a promoter operably linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a poly A tract, wherein the promoter can contain a sequence of TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), wherein X1 is A or G, X2 is A or G, and X3 is A, T, G, or C, wherein the 5'UTR can be selected from SEQ ID NO: 1, 3, 5, or 9, and the 3'UTR can be selected from SEQ ID NO: 2, 4, 6, or 8, wherein the poly A tract comprises at least 60 adenine bases (A).

[0041] In another aspect, the promoter can contain a sequence selected from the group consisting of SEQ ID NOs: 10-15.

[0042] In another aspect, the cap analog can bind to the -1 and / or +1 nucleotide of the promoter.

[0043] In one aspect, the disclosure relates to a reaction mixture for in vitro transcription of a DNA template into RNA, the reaction mixture containing a buffer substance at a concentration of from about 45 mM to about 55 mM, an RNase inhibitor at a concentration of from about 0.01 U / μl to about 0.03 U / μl, NTPs at a concentration of from about 3 mM to about 5 mM, a cap analog at a concentration of from about 6 mM to about 8 mM, one or more magnesium salts at a concentration of from about 20 mM to about 30 mM, a polyamine at a concentration of from about 1.5 mM to about 2.5 mM, a DNA template at a concentration of from about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of from about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of from about 0.01 μg / μl to about 0.05 μg / μl.

[0044] In another aspect, the one or more magnesium salts can be MgCl2 and / or magnesium acetate (Mg(C2H3O2)2) (MgOAc).

[0045] In one aspect, the disclosure relates to a method for in vitro transcribing a DNA template into RNA, the method comprising providing a reaction mixture of the disclosure, and incubating the reaction mixture at from about 15°C to about 35°C for from about 1 hour to about 12 hours, thereby producing RNA.

[0046] In one aspect, the 5'UTR can be selected from SEQ ID NOs: 23-69.

[0047] In another aspect, the 5'UTR may be selected from SEQ ID NOs: 23-52.

[0048] In one aspect, the disclosure relates to a nucleic acid comprising, in the 5' to 3' direction, a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding RNA, and a 3'UTR, wherein the 5'UTR is selected from SEQ ID NOs: 23-69.

[0049] In one aspect, the disclosure relates to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23-52.

[0050] In another aspect, any one of SEQ ID NOs: 23-52 may be a 5'UTR or a 3'UTR. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1A Shown is the addition of poly A tails of varying lengths to a DNA template according to one embodiment of the present disclosure.

[0052] Figure 1B It was shown that more than 90% of the PCR products of the eGFP template had a 100A tail added by the PCR method disclosed in Example 1, with an average length of 1086 bp.

[0053] Figure 2A The quality of mRNA prepared by the method according to one embodiment of the present disclosure is shown.

[0054] Figure 2B The expression of mRNA prepared by the method according to one embodiment of the present disclosure is shown.

[0055] Figure 3 Shown is a poly A fragment length analysis according to one embodiment of the present disclosure.

[0056] Figure 4 Shown is the effect of poly A tail length on mRNA expression according to one embodiment of the present disclosure.

[0057] Figure 5A Comparison of the expression levels of eGFP mRNA prepared by various methods according to one embodiment of the present disclosure is shown, and the relative intensity of eGFP expression was measured by a fluorescence plate reader.

[0058] Figure 5B Shown are the relative eGFP expression intensities in cells, as measured by confocal microscopy.

[0059] Figure 6 Shown is the expression level of luciferase mRNA prepared by the method according to one embodiment of the present disclosure.

[0060] Figure 7 Shown is a comparison of the expression levels of espCas9 mRNA prepared by various methods according to one embodiment of the present disclosure.

[0061] Figures 8A-8C The purity of mRNA prepared by various methods according to one embodiment of the present disclosure is shown.

[0062] Figure 9A Shown are the eGFP mRNA expression efficiencies measured by a fluorescence plate reader. mRNA was prepared by in vitro transcription at different reaction temperatures of 31°C or 37°C.

[0063] Figure 9B The purity of eGFP mRNA obtained from the 31°C IVT reaction is shown, as measured by a bioanalyzer.

[0064] Figure 9C The purity of eGFP mRNA obtained by 37°C IVT reaction is shown, as measured by bioanalyzer.

[0065] Figure 10A In accordance with one embodiment of the present disclosure, the use of a cap analog to initiate in vitro transcription at the -1 position is shown.

[0066] Figure 10B In accordance with one embodiment of the present disclosure, the use of a cap analog to initiate in vitro transcription at the +1 position is shown.

[0067] Figure 10C The capping efficiency of mRNA prepared by the method according to one embodiment of the present disclosure is shown.

[0068] Figure 10DThe expression level of eGFP mRNA prepared by the method according to one embodiment of the present disclosure is shown. Compared with the mRNA IVT initiated by T7AGG with a cap 1 analog that initiates transcription at the +1 position, the IVT reaction performed by co-transcription initiated at the -1 position with the T7GGG promoter had similar mRNA expression intensity.

[0069] Figure 11A The purity of 10 kb mRNA prepared by the method according to one embodiment of the present disclosure is shown.

[0070] Figure 11B The purity of 10 kb mRNA prepared by the method according to another embodiment of the present disclosure is shown.

[0071] Figure 11C The integrity of 10 kb mRNA prepared by the method according to one embodiment of the present disclosure is shown.

[0072] Figure 11D The yield of 10 kb mRNA prepared by the method according to one embodiment of the present disclosure is shown.

[0073] Figure 12A Shown is the effect of magnesium on 1 kb mRNA production according to one embodiment of the present disclosure.

[0074] Figure 12B The effect of magnesium on the integrity of 1 kb mRNA is shown according to one embodiment of the present disclosure.

[0075] Figure 13 Shown are changes in the length of the poly A tail produced by in vitro transcription according to one embodiment of the present disclosure.

[0076] Figure 14 The 5' end sequence of an RNA product prepared by IVT starting from the -1 position of a DNA template according to one embodiment of the present disclosure is shown.

[0077] Figure 15 The 5' end sequence of an RNA product prepared by IVT starting from the +1 position of a DNA template according to one embodiment of the present disclosure is shown.

[0078] Figure 16A The effect of 5'UTR sequence on gene expression is shown according to one embodiment of the present disclosure.

[0079] Figure 16B

[0066] According to another embodiment of the present disclosure, the effect of 5'UTR sequence on gene expression is shown.

[0080] Figure 16C

[0066] According to another embodiment of the present disclosure, the effect of 5'UTR sequence on gene expression is shown.

[0081] Figure 17A

[0066] According to another embodiment of the present disclosure, the effect of 5'UTR sequence on gene expression is shown.

[0082] Figure 17B

[0066] According to another embodiment of the present disclosure, the effect of 5'UTR sequence on gene expression is shown. DETAILED DESCRIPTION

[0083] Provided herein are methods and compositions for in vitro synthesis of mRNA. mRNA may also include one or more caps, and methods and compositions for in vitro synthesis of capped mRNA are provided. mRNA may also include a poly A tail, and methods and compositions for in vitro synthesis of mRNA with a poly A tail are provided. Aspects of the disclosed methods and compositions can be used alone or in any combination. The disclosed methods and compositions can improve the efficiency of mRNA synthesis and can provide mRNA with improved properties.

[0084] Advantages of the present disclosure may include, for example, improved yield of mRNA, improved purity of mRNA, improved capping efficiency, and improved uniformity of length and / or distribution of poly A tails. Improvements in time efficiency and / or cost efficiency may also be achieved.

[0085] The disclosed methods and compositions can be used alone or in any combination to perform in vitro synthesis of mRNAs of various sizes, such as, but not limited to, mRNAs ranging from about 100b to about 20Kb, from about 200b to about 19Kb, from about 300b to about 18Kb, from about 400b to about 17Kb, from about 500b to about 16Kb, from about 600b to about 15Kb, from about 700b to about 14Kb, from about 800b to about 13Kb, from about 900b to about 12Kb, from about 1Kb to about 11Kb, from about 1Kb to about 10Kb, from about 1Kb to about 9Kb, from about 1Kb to about 8Kb, from about 1Kb to about 16Kb, from about 1Kb to about 18Kb, from about 1Kb to about 19Kb, from about 1Kb to about 20Kb, from about 1Kb to about 21Kb, from about 1Kb to about 22Kb, from about 1Kb to about 24Kb, from about 1Kb to about 26Kb, from about 1Kb to about 28Kb, from about 1Kb to about 29Kb, from about 2Kb to about 30Kb, from about 2Kb to about 31Kb, from about 2Kb to about 32Kb, from about 2Kb to about 33Kb, from about 2Kb to about 36Kb, from about 2Kb to about 37Kb, from about 2Kb to about 38Kb, from about 2Kb to about 39Kb, from about 3Kb to about 40Kb, from about 3Kb to about 41Kb, from about 3 From about 1 Kb to about 7 Kb, from about 1 Kb to about 6 Kb, from about 1 Kb to about 5 Kb, from about 1 Kb to about 4 Kb, from about 1 Kb to about 3 Kb, from about 1 Kb to about 2 Kb, from about 50 b to about 200 b, from about 60 b to about 190 b, from about 70 b to about 180 b, from about 80 b to about 160 b, from about 90 b to about 100 b, from about 90 b to about 110 b, from about 90 b to about 120 b, from about 90 b to about 130 b, from about 90 b to about 140 b, from about 90 b to about 150 b, from about 100 b to about 140 b, from about 110 b to about 130 b, or from about 110 b to about 120 b.

[0086] The mRNA synthesized using the disclosed compositions and / or methods can have applications including, but not limited to, use in basic science research, use in pharmacology development, use in diagnostics development, use in therapeutics development, use as pharmacology, use as a diagnostic, use as a therapeutic, or any combination thereof.

[0087] Methods for in vitro transcription of RNA are known in the art (see, e.g., Geall et al. (2013) Semin. Immunol. 25(2):152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14). Reagents used in the methods may include: a linear DNA template having a promoter sequence that has a high binding affinity for its corresponding RNA polymerase; ribonucleoside triphosphates (NTPs) of the four bases (adenine, cytosine, guanine, and uracil); a cap analog (e.g., m7G(5')ppp(5')G(m7G)); other modified nucleotides; a DNA-dependent RNA polymerase (e.g., T7, T3, or SP6 RNA polymerase); a ribonuclease (RNase) inhibitor to inactivate any contaminating RNase; a pyrophosphatase to degrade pyrophosphate that inhibits transcription; MgCl2 and / or MgOAc, which provide Mg 2+ As a cofactor for RNA polymerase; antioxidants (such as DTT); polyamines such as spermidine; and buffers to maintain the appropriate pH.

[0088] Common buffer systems for RNA in vitro transcription can include 4-(2-hydroxy-ethyl)-1-piperazineethanesulfonic acid (HEPES) and tris(hydroxymethyl)aminomethane (Tris). The pH of the buffer can generally be adjusted to a pH between 6 and 8.5. Some commonly used transcription buffers can contain 80 mM HEPES / KOH (pH 7.5) and 40 mM Tris / HCl (pH 7.5).

[0089] The transcription buffer may also contain magnesium salts, such as MgCl2 and / or MgOAc, typically in the range of 5-50 mM. 2+ ) can be an essential component of RNA in vitro transcription buffer systems because free Mg 2+ It can act as a cofactor in the catalytic center of RNA polymerase and may be critical for RNA polymerization. In diffusion binding, fully hydrated Mg ions can also interact with RNA products via nonspecific long-range electrostatic interactions.

[0090] The RNA in vitro transcription reaction can be carried out in a batch reaction, wherein all components are combined and then incubated to allow the synthesis of the RNA molecule until the reaction terminates. Additionally, a fed-batch reaction was developed to increase the efficiency of the RNA in vitro transcription reaction (Kern et al. (1997) Biotechnol. Prog. 13: 747-756; Kern et al. (1999) Biotechnol. Prog. 15: 174-184). In a fed-batch system, all components are combined, but then some reagents (e.g., NTPs, MgCl and / or MgOAc) are added over time to maintain constant reaction conditions.

[0091] For clarity and readability, the following definitions are provided. Any technical features mentioned in these definitions can be read in each embodiment of the present invention. In the context of these embodiments, additional definitions and explanations can be provided in particular.

[0092] In vitro transcription: The term "in vitro transcription" or "RNA in vitro transcription" may relate to a process in which RNA is synthesized in a cell-free system (in vitro). DNA, in particular plasmid DNA, is used as a template for producing RNA transcripts. RNA can be obtained by DNA-dependent in vitro transcription of an appropriate DNA template, which, according to the present disclosure, may preferably be a linearized plasmid DNA template. The promoter used to control in vitro transcription may be any promoter for any DNA-dependent RNA polymerase. Specific non-limiting examples of DNA-dependent RNA polymerases are T7, T3, and SP6 RNA polymerases. DNA templates for in vitro RNA transcription can be obtained, for example, by cloning a nucleic acid (in particular a cDNA corresponding to the corresponding RNA to be transcribed in vitro) and introducing it into an appropriate vector for in vitro transcription, such as plasmid DNA. In a preferred embodiment of the present disclosure, the DNA template can be linearized with a suitable restriction enzyme prior to its in vitro transcription. cDNA can be obtained by reverse transcription or chemical synthesis of mRNA. In addition, DNA templates for in vitro RNA synthesis can also be obtained by gene synthesis.

[0093] For example, reagents used in in vitro transcription may include: 1) A linearized DNA template having a promoter sequence that has a high binding affinity for its corresponding RNA polymerase (e.g., a bacteriophage-encoded RNA polymerase); 2) ribonucleoside triphosphates (NTPs) of the four bases (adenine, cytosine, guanine, and uracil); 3) optionally a cap analogue as defined below (eg, m7G(5')ppp(5')A(m7G)); 4) a DNA-dependent RNA polymerase capable of binding to the promoter sequence within the linearized DNA template (e.g., T7, T3, or SP6 RNA polymerase); 5) optionally a ribonuclease (RNase) inhibitor to inactivate any contaminating RNases; 6) optionally a pyrophosphatase to degrade pyrophosphate that can inhibit transcription; 7) MgCl2 and / or magnesium acetate (Mg(C2H3O2)2) (MgOAc), which provides Mg 2+ ions serve as cofactors for polymerases; 8) Buffer to maintain a suitable pH value. The buffer may also contain an optimal concentration of an antioxidant (eg, DTT), an amine (eg, betaine), and / or a polyamine (eg, spermidine).

[0094] In embodiments, in the method for in vitro transcription of RNA according to the present disclosure, the following reagents are not used, which are only required for the in vitro translation of the transcribed RNA into protein, but not for the in vitro transcription of the RNA. In particular, the mixture used for in vitro transcription of RNA may not contain any proteinogenic amino acids or tRNA. In addition, the mixture may not contain any proteinogenic amino acids, tRNA, or ribosome-containing cell extracts.

[0095] As used herein, the term "co-transcription" refers to the preparation of mRNA together with a cap structure by a one-step in vitro transcription reaction using an RNA polymerase (e.g., T7 RNA polymerase). In contrast, one or more traditional post-transcriptional capping methods may require the preparation of uncapped RNA by in vitro transcription (IVT) in the presence of an RNA polymerase, followed by the addition of a cap using a capping enzyme (e.g., vaccinia capping enzyme) with the aid of a 2'-O-methyltransferase for adding a methyl group at the +1 base of the mRNA.

[0096] Nucleic acid: The term "nucleic acid" means any DNA or RNA molecule and is used synonymously with polynucleotide. In addition, modifications or derivatives of nucleic acids as defined herein are explicitly included in the general term "nucleic acid." For example, peptide nucleic acids (PNA) are also included in the term "nucleic acid."

[0097] Nucleic acid template: The nucleic acid template provides a nucleic acid sequence that is transcribed into RNA by an in vitro transcription process and thus contains a nucleic acid sequence that is complementary to the RNA sequence transcribed therefrom. In addition to the nucleic acid sequence that is transcribed into RNA, the nucleic acid template also contains a promoter to which the RNA polymerase used in the in vitro transcription process binds with high affinity.

[0098] Preferably, the nucleic acid template can be a linearized plasmid DNA template. Linear template DNA can be obtained in the following manner: under suitable conditions, the plasmid DNA is contacted with a restriction enzyme so that the restriction enzyme cuts the plasmid DNA at one or more of its recognition sites and destroys the circular plasmid structure. Preferably, the plasmid DNA is cut immediately after the end of the sequence to be transcribed into RNA. Therefore, the linear template DNA comprises a free 5' end and a free 3' end that are not connected to each other. If the plasmid DNA contains only one recognition site for a restriction enzyme, the linear template DNA has the same number of nucleotides as the plasmid DNA. If the plasmid DNA contains more than one recognition site for a restriction enzyme, the linear template DNA has fewer nucleotides than the plasmid DNA. The linear template DNA is then a fragment of plasmid DNA that contains the elements required for in vitro transcription, which are promoter elements and template DNA elements for RNA transcription. By base pairing rules, the open reading frame (ORF) of the linear template DNA can determine the sequence of the transcribed RNA.

[0099] In other embodiments, the nucleic acid template can be selected from a synthetic double-stranded DNA construct, a single-stranded DNA template having a double-stranded DNA region comprising a promoter to which RNA polymerase binds, a circular double-stranded DNA template having promoter and terminator sequences, or a linear DNA template amplified by PCR or isothermal amplification.

[0100] According to preferred embodiments of the present disclosure, the concentration of the nucleic acid template contained in the in vitro transcription mixture described herein can be in the range of from about 1 to about 200 nM, from about 10 nM to about 150 nM, from about 20 nM to about 140 nM, from about 30 nM to about 130 nM, from about 40 nM to about 120 nM, from about 50 nM to about 110 nM, from about 60 nM to about 100 nM, from about 65 nM to about 90 nM, from about 65 nM to about 80 nM, from about 65 nM to about 75 nM, from about 65 nM to about 70 nM, from about 70 nM to about 75 nM, about 1 to about 40 nM, about 1 to about 30 nM, about 1 to about 20 nM, or about 1 to about 10 nM. Even more preferably, the concentration of the nucleic acid template can be from about 10 to about 30 nM. Most preferably, the concentration of the nucleic acid template can be about 40, 50, 60, 70, 80, 90 or 100 nM.

[0101] RNA, mRNA: RNA is a commonly used abbreviation for ribonucleic acid. It is a nucleic acid molecule, a polymer composed of nucleotide monomers. These nucleotides are typically adenosine monophosphate (AMP), uridine monophosphate (UMP), guanosine monophosphate (GMP), and cytidine monophosphate (CMP) monomers or their analogs, linked together along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar (i.e., ribose) of the first monomer and the phosphate moiety of the second adjacent monomer. The specific order of monomers (i.e., the order of bases attached to the sugar / phosphate backbone) is called the RNA sequence. RNA can generally be obtained by transcription from a DNA sequence (for example, within a cell). In eukaryotic cells, transcription typically occurs within the nucleus or mitochondria. In vivo, transcription of DNA typically produces so-called premature RNA, which must be processed into so-called messenger RNA (commonly abbreviated as mRNA). Processing of premature RNA in eukaryotic organisms, for example, includes a variety of post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. The sum of these processes is also referred to as RNA maturation. The mature messenger RNA generally provides a nucleotide sequence that can be translated into an amino acid sequence of a specific peptide or protein. Typically, the mature mRNA comprises a 5'-cap, optionally a 5'UTR, an open reading frame, optionally a 3'UTR and a poly(A) sequence.

[0102] In addition to messenger RNA, there are several non-coding types of RNA that may be involved in the regulation of transcription and / or translation and immune stimulation. The term "RNA" further encompasses RNA molecules such as viral RNA, retroviral RNA and replicon RNA, small interfering RNA (siRNA), antisense RNA, CRISPR / Cas9 guide RNA, ribozymes, aptamers, riboswitches, immunostimulatory RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA) and Piwi-interacting RNA (piRNA).

[0103] Dicarboxylic acid or its salt: A dicarboxylic acid is an organic acid having two carboxyl groups (-COOH). The term includes organic acids having the general formula HO2C—(CH2) n -CO2H linear saturated dicarboxylic acids such as oxalic acid, malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid and sebacic acid. It also includes unsaturated dicarboxylic acids with at least one double bond (such as maleic acid and fumaric acid), and substituted dicarboxylic acids with at least one additional functional group (such as malic acid, tartaric acid, chicoric acid and dimercaptosuccinic acid). Salts of dicarboxylic acids contain a dicarboxylic acid anion and a suitable cation, such as Na + , K + , Ca 2+or Mg 2+ .

[0104] Tricarboxylic acids or their salts: Tricarboxylic acids are organic acids with three carboxyl groups (-COOH). Examples of tricarboxylic acids include citric acid, isocitric acid, aconitic acid, trimesic acid, nitrilotriacetic acid, and propane-1,2,3-tricarboxylic acid. In the buffer systems and methods of the present invention, citric acid (3-carboxy-3-hydroxypentane-1,5-dioic acid) is preferably used. Salts of tricarboxylic acids comprise a tricarboxylic acid anion and a suitable cation, such as Na + , K + , Ca 2+ or Mg 2+ Preferably, sodium citrate or magnesium citrate is used. If magnesium citrate is added to the RNA in vitro transcription reaction, it may not be necessary to add a magnesium salt to the reaction because the magnesium ions in magnesium citrate can act as a cofactor for RNA polymerase. Therefore, in this case, the reaction mixture for RNA in vitro transcription comprises magnesium citrate, a buffer substance, ribonucleoside triphosphates, a nucleic acid template, and RNA polymerase.

[0105] Buffer: A buffer is a weak acid or base that is used to maintain the acidity (pH) of a solution around a selected value after the addition of another acid or base. Thus, the function of a buffer is to prevent rapid changes in pH when an acid or base is added to a solution. Suitable buffers for use in the present invention include tris(2-amino-2-hydroxymethyl-propane-1,3-diol) and HEPES (2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid). The buffer may further include an acid or base for adjusting the pH, such as HCl (Tris-HCl) in the case of Tris and KOH (HEPES-KOH) in the case of HEPES. In a preferred embodiment of the present invention, citric acid is used to adjust the pH of the buffer (preferably Tris base), eliminating the need to add another acid. In an alternative embodiment, the pH of the buffer is adjusted with an acid or base (such as HCl and KOH), and a salt of a dicarboxylic acid or tricarboxylic acid (preferably citrate) is present in the reaction mixture in addition to the pH-adjusted buffer.

[0106] The concentration of the buffer substance in the mixture for in vitro transcription described herein can be about 10 to about 100 mM, about 10 to about 80 mM, about 10 to about 50 mM, about 10 to about 40 mM, about 10 to about 30 mM, or about 10 to about 20 mM. Preferably, the concentration of the buffer substance is 80 mM.

[0107] Preferably, the buffer has a pH of from about 6 to about 8.5, from about 6.5 to about 8.0, from about 7.0 to about 7.5, even more preferably about 7.5 or about 8.0.

[0108] Ribonucleotide triphosphates: Ribonucleotide triphosphates (NTPs) (i.e., GTP, ATP, CTP, and UTP) are monomers that are polymerized during in vitro transcription. They can provide monovalent or divalent cations as counterions. Preferably, the monovalent cation is selected from the group consisting of: Li + 、Na + , K + NH4 + Or tris (hydroxymethyl) - aminomethane (Tris). Preferably, the divalent cation is selected from the group consisting of: Mg 2+ 、Ba 2+ and Mn 2+ More preferably, the monovalent cation is Na + or tris(hydroxymethyl)-aminomethane (Tris).

[0109] According to a preferred embodiment of the present invention, part or all of at least one ribonucleoside triphosphate in the in vitro transcription reaction mixture is replaced by a modified nucleoside triphosphate as defined below.

[0110] Modified nucleoside triphosphates: As used herein, the term "modified nucleoside triphosphates" refers to chemical modifications comprising backbone modifications and sugar modifications or base modifications. These modified nucleoside triphosphates are also referred to herein as (nucleotide) analogs.

[0111] In this context, modified nucleoside triphosphates as defined herein are nucleotide analogs / modifications, such as backbone modifications, sugar modifications or base modifications. The backbone modification relevant to the present invention is a modification in which the phosphoric acid in the backbone of the nucleotide is chemically modified. The sugar modification relevant to the present invention is a chemical modification to the sugar in the nucleotide. In addition, the base modification relevant to the present invention is a chemical modification to the base portion of the nucleotide. In this context, nucleotide analogs or modifications are preferably selected from nucleotide analogs that are applicable to transcription and / or translation. Sugar modification

[0112] Modified nucleosides and nucleotides that can be used in the context of the present invention can be modified in the sugar moiety. For example, the 2' hydroxyl group (OH) can be modified or replaced by a number of different "oxy" or "deoxy" substituents. Examples of "oxy"-2' hydroxyl group modifications include, but are not limited to, alkoxy or aryloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), -O(CH2CH2O); nCH2CH2OR; a "locked" nucleic acid (LNA) in which the 2' hydroxyl group is linked to the 4' carbon of the same ribose, for example, via a methylene bridge; and an amino group (-O-amino, where the amino group (e.g., NRR) can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy.

[0113] "Deoxy" modifications include hydrogen, amino (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or an amino group can be attached to the sugar via a linker, wherein the linker comprises one or more of C, N, and O atoms.

[0114] The sugar group may also contain one or more carbons that have the opposite stereochemical configuration to the corresponding carbon in ribose. Thus, modified nucleotides may include nucleotides containing, for example, arabinose as the sugar. Skeleton modification

[0115] The phosphate backbone can be further modified in modified nucleosides and nucleotides. The phosphate group of the backbone can be modified by replacing one or more oxygen atoms with different substituents. In addition, modified nucleosides and nucleotides can include fully replacing the unmodified phosphate moiety with modified phosphoric acid as described herein. The example of modified phosphate group includes but is not limited to thiophosphate, selenophosphate, borane phosphate, borane phosphate ester, hydrogen phosphonate, phosphoramide, alkyl phosphonic acid or aryl phosphonic acid and phosphotriester. Dithiophosphoric acid has two non-connected oxygens replaced by sulfur. The phosphate joint can also be modified by replacing the oxygen connected with nitrogen (phosphoramide of bridged connection), sulfur (thiophosphate of bridged connection) and carbon (methylene-phosphonic acid of bridged connection). base modification

[0116] The modified nucleosides and nucleotides that can be used in the present disclosure can be further modified in the core base portion. Examples of core bases found in RNA include but are not limited to adenine, guanine, cytosine and uracil. For example, the nucleosides and nucleotides described herein can be chemically modified on the major groove surface. In certain embodiments, the major groove chemical modification can include an amino group, a thiol group, an alkyl group or a halide group.

[0117] In a particularly preferred embodiment of the present invention, the nucleotide analogs / modifications can be selected from base modifications, which are preferably selected from 2-amino-6-chloropurine nucleoside-5'-triphosphate, 2-aminopurine-nucleoside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2' -O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate Acid, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine nucleoside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate '-triphosphate, 7-deazaguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate or puromycin-5'-triphosphate, xanthosine-5'-triphosphate. Particular preference is given to nucleotides for base modification, which are selected from the group of base-modified nucleotides consisting of 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate and pseudouridine-5'-triphosphate.

[0118] In some embodiments, the modified nucleosides may include pyridin-4-one ribonucleosides, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinemethyluridine, 1-taurinemethyl-pseudouridine, 5-taurinemethyl-2-thio-uridine, 1-taurine uridine, 2-thio-1-methyl-pseudouridine, 1-methyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine and 4-methoxy-2-thio-pseudouridine.

[0119] In some embodiments, the modified nucleosides may include 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4 -thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine and 4-methoxy-1-methyl-pseudoisocytidine.

[0120] In other embodiments, the modified nucleosides may include 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6 -isopentenyl adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine and 2-methoxy-adenine.

[0121] In other embodiments, the modified nucleosides may include inosine, 1-methyl-inosine, wyosine, wyobutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and N2,N2-dimethyl-6-thio-guanosine.

[0122] In some embodiments, the nucleotides may be modified on the major groove surface and may include replacing the hydrogen at C-5 of uracil with a methyl group or a halide group.

[0123] In specific embodiments, the modified nucleoside is 5'-O-(1-phosphothioate)-adenosine, 5'-O-(1-phosphothioate)-cytidine, 5'-O-(1-phosphothioate)-guanosine, 5'-O-(1-phosphothioate)-uridine, or 5'-O-(1-phosphothioate)-pseudouridine.

[0124] In another specific embodiment, the modified nucleotides may include nucleoside modifications selected from the group consisting of 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudoisocytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-Methyl-uridine, pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudoisocytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azidoadenosine, 7-deaza-adenosine.

[0125] Magnesium salt: A magnesium salt comprises a magnesium cation and a suitable anion (such as a chloride anion or an acetate anion). Preferably, the magnesium salt is magnesium chloride. In one or more in vitro transcription mixtures described herein, preferably, the initial free Mg 2+ The concentration may be from about 1 to about 100 mM, about 1 to about 75 mM, about 1 to about 50 mM, about 1 to about 25 mM, or about 1 to about 10 mM. Even more preferably, the initial free Mg 2+The concentration is from about 5 to about 50 mM, about 10 to about 45 mM, about 15 to about 40 mM, or about 16 to about 37 mM, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 mM. It will be appreciated by those skilled in the art that Mg 2+ The choice of concentration may be influenced by the initial total NTP concentration, meaning that if a higher total NTP concentration is used in the in vitro transcription mix, a higher Mg may need to be used. 2+ In some embodiments, the concentration of the magnesium salt can be from about 2 mM to about 50 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 20 mM, from about 2 mM to about 10 mM, from about 2 mM to about 5 mM, from about 5 mM to about 50 mM, from about 10 mM to about 45 mM, from about 15 mM to about 40 mM, from about 20 mM to about 35 mM, from about 20 mM to about 30 mM, from about 20 mM to about 25 mM, from about 22 mM to about 28 mM, or from about 25 mM to about 30 mM.

[0126] RNA polymerase: RNA polymerase is an enzyme that catalyzes the transcription of a DNA template into RNA. Suitable RNA polymerases for use in the present disclosure may include T7, T3, SP6, and E. coli RNA polymerase. Preferably, T7 RNA polymerase may be used. Also preferably, the RNA polymerase for use in the present disclosure may be a recombinant RNA polymerase, meaning that it is added as a single component to an RNA in vitro transcription reaction, rather than as part of a cell extract containing other components in addition to the RNA polymerase. The skilled artisan will appreciate that the choice of RNA polymerase depends on the promoter present in the DNA template, which must be bound by the appropriate RNA polymerase. Preferably, the concentration of RNA polymerase in one or more in vitro transcription mixtures described herein can be from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.1 ... The concentration of the RNA polymerase may be about 0.05 μg / μl, about 0.1 μg / μl to about 1 μg / μl, about 0.1 μg / μl to about 0.9 μg / μl, about 0.1 μg / μl to about 0.8 μg / μl, about 0.1 μg / μl to about 0.7 μg / μl, about 0.1 μg / μl to about 0.6 μg / μl, about 0.1 μg / μl to about 0.5 μg / μl, about 0.1 μg / μl to about 0.4 μg / μl, about 0.1 μg / μl to about 0.3 μg / μl, or about 0.1 μg / μl to about 0.2 μg / μl. It will be appreciated by those skilled in the art that the selection of RNA polymerase concentration may be affected by the concentration of the DNA template.

[0127] Pyrophosphatase: Pyrophosphatase is an anhydrase that hydrolyzes diphosphate bonds. In in vitro transcription reactions, it can be used to hydrolyze the diphosphate bond released after the incorporation of ribonucleoside triphosphates into the nascent RNA chain. Preferably, the concentration of pyrophosphatase in one or more in vitro transcription mixtures described herein can be from about 1 to about 100 units / ml, from about 10 units / ml to about 90 units / ml, from about 20 units / ml to about 80 units / ml, from about 30 units / ml to about 70 units / ml, from about 40 units / ml to about 60 units / ml, from about 45 units / ml to about 55 units / ml, from about 45 units / ml to about 50 units / ml, from about 50 units / ml to about 55 units / ml, from about 10 units / ml to about 50 units / ml, from about 15 units / ml to about 40 units / ml, from about 20 units / ml to about 30 units / ml, from about 20 units / ml to about 25 units / ml, from about 25 units / ml to about 30 units / ml, about 1 to about 15 units / ml, about 1 to about 10 units / ml, about 1 to about 5 units / ml, or about 1 to about 2.5 units / ml. Even more preferably, the concentration of pyrophosphatase may be about 50 units / ml or may be about 25 units / ml.

[0128] 5'-cap structure: A 5'-cap is typically a modified nucleotide, particularly a guanine nucleotide, added to the 5' end of an RNA molecule. Preferably, a 5'-5'-triphosphate linkage can be used to add the 5'-cap. The 5'-cap can be methylated, for example, m7GpppN, where N is the terminal 5' nucleotide of the nucleic acid carrying the 5'-cap, typically at the 5' end of the RNA. Naturally occurring 5'-caps can include m7GpppN.

[0129] Additional examples of 5' cap structures can include a glyceryl group, an inverted deoxy abasic residue (moiety), a 4',5' methylene nucleotide, a 1-(β-D-erythrofuranosyl) nucleotide, a 4'-thionucleotide, a carbocyclic nucleotide, a 1,5-anhydrohexitol nucleotide, an L-nucleotide, an α-nucleotide, a modified base nucleotide, a threo-pentofuranosyl nucleotide, an acyclic 3',4'-seconucleotide, an acyclic 3,4-dihydroxybutyl nucleotide, an acyclic 3,5 dihydroxypentyl nucleotide, a 3'-3'-inverted nucleotide moiety', a 3'-3'-inverted abasic moiety', a 3'-2'-inverted nucleotide moiety, a 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, a 3'-phosphoamidite, hexyl phosphate, an aminohexyl phosphate, a 3'-phosphate, a 3'-phosphorothioate, a dithiophosphate, or a bridging or non-bridging methylphosphonic acid moiety.

[0130] Particularly preferably, the 5' cap structure may be cap 1 (methylation of the ribose of the adjacent nucleotide of m7G).

[0131] The 5' cap structure may be formed by a cap analog.

[0132] Cap analogs: Cap analogs are non-extendable dinucleotides or trinucleotides that function as a cap, meaning that when incorporated into the 5' end of an RNA molecule, they promote translation or localization and / or protect the RNA from degradation. The absence of a 5' triphosphate structure in capped mRNA reduces its immunogenic side effects. Non-extendable means that the cap analog will only be incorporated into the 5' end, as it lacks a 5' triphosphate and is therefore not extendable in the 3' direction by template-dependent RNA polymerases.

[0133] Cap analogs include, but are not limited to, chemical structures selected from the group consisting of: m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analogs (e.g., m2,7GpppG), trimethylated cap analogs (e.g., m2,2,7GpppG), dimethylated symmetric cap analogs (e.g., m7Gpppm7G), or anti-reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (Stepinski et al., 2001. RNA 7(10): 1486-95, the contents of which are hereby incorporated by reference in their entirety).

[0134] Additional cap analogs have been previously described (U.S. Patent No. 7,074,596, U.S. Patent No. 8,304,529, U.S. Patent No. 8,153,773, U.S. Patent No. 8,519,110, U.S. Patent No. 9,295,717, and U.S. Patent No. 9388420, the contents of which are hereby incorporated by reference in their entirety). The synthesis of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs has recently been described (Kore et al., 2013. Bioorg. Med. Chem. 21(15):4570-4).

[0135] Particularly preferably, the cap analogue may be G[5']ppp[5']G, m 7 G[5']ppp[5']G、m3 2,2,7 G[5']ppp[5']G、m2 7,3'-O G[5']ppp[5']G(3'-ARCA), m2 7,2'-O GpppG(2'-ARCA), m2 7,2'-O GppspG D1(β-S-ARCAD1), m2 7,2'-O GppspG D2(β-S-ARCAD2), m 7GpppmAG、m 7 GpppmAmG、m 7 GpppmAmGG、m 7 GpppmA、m 7 mGpppmA、m 7 Gpppm 7 mAG and m 7 mGpppm 7 mAG.

[0136] In some embodiments, the cap analog can be a cap 0, cap 1, or cap 2 analog.

[0137] In some embodiments, a cap analog may include a cap [I] having the following structure:

[0138] Preferably, the cap analog can be added at an initial concentration ranging from about 1 to about 20 mM, about 1 to about 17.5 mM, about 1 to about 15 mM, about 1 to about 12.5 mM, about 1 to about 10 mM, about 1 to about 7.5 mM, about 1 to about 5 mM, or about 1 to about 2.5 mM. Even more preferably, the cap analog can be added at an initial concentration of about 5 to about 20 mM, about 7.5 to about 20 mM, about 10 to about 20 mM, or about 12.5 to about 20 mM. In some embodiments, the concentration of the cap analog can be from about 0.5 mM to about 50 mM, from about 0.5 mM to about 40 mM, from about 0.5 mM to about 30 mM, from about 0.5 mM to about 20 mM, from about 0.5 mM to about 10 mM, from about 0.5 mM to about 5 mM, from about 1 mM to about 10 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 9 mM, from about 3 mM to about 10 ... From about 8mM, from about 3mM to about 7mM, from about 3mM to about 6mM, from about 3mM to about 5mM, from about 3mM to about 4mM, from about 4mM to about 10mM, from about 5mM to about 10mM, from about 6mM to about 10mM, from about 6mM to about 9mM, from about 6mM to about 8mM, from about 6mM to about 7mM, from about 7mM to about 10mM, from about 8mM to about 10mM, or from about 9mM to about 10mM.

[0139] In some embodiments, the cap analogs can be chemically synthesized using known methods such as, but not limited to, phosphorylation, oxidation with amidites and nucleosides as starting materials to form dimer fragments, followed by chemical synthesis to prepare the GDP imidazolide fragment, and then the final coupling reaction.

[0140] Ribonuclease inhibitors: Ribonuclease inhibitors inhibit the action of ribonucleases that degrade RNA. Preferably, the concentration of the ribonuclease inhibitor in one or more in vitro transcription mixtures described herein can be from about 1 to about 500 units / ml, about 1 to about 400 units / ml, about 1 to about 300 units / ml, about 1 to about 200 units / ml, or about 1 to about 100 units / ml. Even more preferably, the concentration of the ribonuclease inhibitor can be about 100 to about 300 units / ml, for example, 100 units / ml, 150 units / ml, 200 units / ml, 250 units / ml, or 300 units / ml.

[0141] Antioxidants: Antioxidants inhibit the oxidation of other molecules. Suitable antioxidants for use in the present disclosure may include, but are not limited to, DTT (dithiothreitol), TCEP (tris(2-carboxyethyl)phosphine), NAC (N-acetylcysteine), β-mercaptoethanol, glutathione, cysteine, and cystine. Preferably, DTT may be used in the in vitro transcription reaction.

[0142] The concentration of the antioxidant (preferably DTT) in one or more in vitro transcription mixtures described herein can be about 1 to about 50 mM, about 5 to about 48 mM, about 8 to about 47 mM, about 10 to about 46 mM, about 15 to about 45 mM, about 18 to about 44 mM, about 20 to about 43 mM, about 23 to about 42 mM, about 25 to about 41 mM, or about 28 to about 40 mM. Preferably, the concentration can be about 40 mM.

[0143] Amine: Preferably, the amine to be used in the present invention may be betaine (trimethylglycine). The concentration of the amine (preferably betaine) may be about 10 mM to about 2 M, preferably about 0.7 M to about 1.3 M.

[0144] Polyamine: Preferably, the polyamine can be selected from the group consisting of spermine and spermidine. Preferably, the concentration of the polyamine can be from about 1 to about 25 mM, about 1 to about 20 mM, about 1 to about 15 mM, about 1 to about 10 mM, about 1 to about 5 mM, or about 1 to about 2.5 mM. Even more preferably, the concentration of the polyamine can be about 2 mM. Most preferably, the concentration of spermidine can be about 2 mM.

[0145] DNA enzyme: DNA enzyme is an enzyme that hydrolyzes DNA by catalyzing the hydrolytic cleavage of phosphodiester linkages in the DNA backbone. Suitable DNA enzymes can be isolated from bovine pancreas and can be obtained from different suppliers (such as Sigma-Aldrich, New England Biolabs, Qiagen and ThermoFisher). Preferably, the DNA enzyme does not have any RNA enzyme activity. In the method of the present disclosure, DNA enzyme treatment can be performed after the RNA in vitro transcription reaction by adding DNA enzyme to the reaction mixture for RNA in vitro transcription. Preferably, an appropriate amount of calcium chloride can be added to the RNA in vitro transcription mixture together with the DNA enzyme. The appropriate amount of CaCl2 can be from about 1 to about 5mM, preferably from about 2 to about 4mM, and more preferably it can be about 3mM. DNA can be treated with DNA enzyme for about 1 to about 5 hours, preferably about 1.5 to about 3 hours, and more preferably about 2 hours. The DNA enzyme treatment can preferably be performed at a temperature of about 37°C. In one embodiment, about 3mM CaCl2 and about 200U / ml DNA enzyme I can be added to the RNA in vitro transcription mixture, and the resulting mixture can be incubated at about 37°C for about two hours. In another embodiment, about 3 mM CaCl and about 400 U / ml DNase I can be added to the RNA in vitro transcription mixture, and the resulting mixture can be incubated at about 37° C. for about two hours. The DNase treatment can be stopped by adding EDTA or another chelating agent. Preferably, the DNase treatment can be stopped by adding EDTA to a final concentration of about 25 mM.

[0146] The embodiments of the present disclosure can provide a combined solution for in vitro synthesis of mRNAs of different sizes in a time-efficient manner with high capping efficiency, uniform poly A tails, high yield and integrity. The mRNA sizes range from, for example, but not limited to, about 1 Kb to 20 Kb, such as 1 Kb to 15 Kb or 1 Kb to 10 Kb. The embodiments of the present disclosure can include designing a T7 promoter sequence in a DNA template to provide high affinity for a cap analog, thereby transcribing the capped mRNA in vitro using a T7 RNA polymerase. Such a DNA template promoter design can include a T7 φ6.5 promoter followed by the sequence GG. This design can ensure efficient initiation of transcription to prepare capped mRNAs with high fidelity at the 5' end by a one-step process. 5' end capping of mRNA

[0147] One of the key factors that determine the efficiency of mRNA translation can be its 5' end capping. Typically, capping is performed using a capping enzyme, and although the efficiency of capping may be high, the process is time-consuming and expensive. Therefore, there is a need for an efficient co-transcription method that allows for faster production of more efficient capped mRNA. Ishikawa M., Ishikawa et al., "Preparation of eukaryotic mRNAhaving differently methylated adenosine at the 5'-terminus and the effect of the methyl group in translation", Nucleic Acids Symposium Series, Vol. 53, No. 1, September-October 2009, pp. 129-130 partially addressed this need. Ishikawa demonstrated the use of trinucleotide cap analogs of the structure m7GpppA*pG (wherein A* is adenosine or a methylated adenosine derivative) for preparing capped mRNA by one-step in vitro transcription. By using these molecules, Ishikawa obtained mRNAs with A, A m 、 m6 A or m6 A m (as the first transcribed nucleotide) and studied their translation properties in a rabbit reticulocyte system. Another study also confirmed the co-transcriptional capping of mRNA using cap analogs. Sikorski, PJ et al., 2020, "The identity and methylation status of the firsttranscribed nucleotide in eukaryotic mRNA 5'cap modulates protein expressionin living cells", Nucleic acids research, 48(4), pp. 1607-1626. Although these methods show higher transcription capping efficiency, the capping efficiency is still about 95%-96% efficiency or less (depending on the cap molecule). Therefore, there is still a need for an efficient co-transcription method that will allow for more time- and / or cost-effective production of higher quality capped mRNA.

[0148] In embodiments, methods and / or compositions for increasing capping efficiency can be provided. In embodiments, methods and / or compositions for increasing capping efficiency to greater than about 96% efficiency, greater than about 96.5% efficiency, greater than about 97% efficiency, greater than about 97.5% efficiency, greater than about 98% efficiency, greater than about 98.5% efficiency, greater than about 99% efficiency, greater than about 99.5% efficiency as measured by cleavage of mRNA with RNase H followed by measurement of capping efficiency by LC-MS can be provided.

[0149] In an embodiment, the cap analog can initiate in vitro transcription to synthesize capped mRNA in a one-pot reaction. In an embodiment, the first base methyl-A after the inverted G cap can bind to the -1 position of the DNA template, and the second base G can bind to the +1 position of the DNA template, forming a complex with RNA polymerase to recruit the next ribonucleoside triphosphate (NTP), thereby extending the RNA during the transcription process. For example, Figure 10A As shown, when using cap [I]( m7 G 5 pppA 2'-Ome G), the first base methyl-A after the inverted G cap binds to the -1 position of the DNA template, and the second base G binds to the +1 position of the DNA template, forming a complex with T7 RNA polymerase to recruit the next NTP, thereby extending the RNA during the transcription process.

[0150] In embodiments, compositions comprising one or more cap analogs as described herein are provided. In embodiments, methods of using one or more cap analogs as described herein are provided. In embodiments, the cap analogs as described herein can be used in combination with the compositions and / or methods described herein and / or in combination with conventional compositions and / or methods. In embodiments, the methods and / or compositions described herein can increase mRNA capping efficiency to greater than about 96% efficiency, greater than about 96.5% efficiency, greater than about 97% efficiency, greater than about 97.5% efficiency, greater than about 98% efficiency, greater than about 98.5% efficiency, greater than about 99% efficiency, greater than about 99.5% efficiency, or up to about 100% efficiency. promoter

[0151] The promoter design in the DNA template can be important for initiating in vitro transcription with a DNA-dependent RNA polymerase. In embodiments where T7 RNA polymerase (a single-subunit polymerase derived from T7 bacteriophage) can be used, the DNA template promoter design can include the T7φ6.5 promoter followed by the sequence GG, GA, or AGG. In embodiments, this design can enable efficient initiation of transcription to produce mRNA with high fidelity at the 5' end via a one-step process.

[0152] In an embodiment, the promoter can have a sequence of TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), wherein X1 is A or G, X2 is A or G, and X3 is A, T, G, or C.

[0153] In embodiments where T7 RNA polymerase can be used, in vitro transcription can be initiated using at least one promoter sequence from Table 1. The promoter can be added to a plasmid vector by gene synthesis or subcloning. Table 1 <![CDATA[ SEQ ID NO ]]> <![CDATA[ sequence ]]> 10 TAATACGACTCACTATAGGG 11 TAATACGACTCACTATAGG 12 TAATACGACTCACTATAAGG 13 TAATACGACTCACTATAGAT 14 TAATACGACTCACTATAGA 15 TAATACGACTCACTATTAGG

[0154] In an embodiment, at least one of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15 can be used to initiate in vitro transcription.

[0155] In embodiments, compositions comprising one or more promoters as described herein are provided. In embodiments, vectors comprising one or more promoters as described herein are provided. In embodiments, methods of using one or more promoters as described herein are provided. In embodiments, compositions comprising mRNA comprising one or more promoters as described herein are provided. In embodiments, vectors comprising mRNA comprising one or more promoters as described herein are provided. In embodiments, methods of using mRNA comprising one or more promoters as described herein are provided.

[0156] In some embodiments, in vitro transcription can start at the -1 position, which can contribute to the formation of a more favorable complex with the T7 RNA polymerase, thereby producing a more complete RNA length. The application of the -1 and +1 positions of the start site for in vitro transcription allows for more flexible selection of the first mRNA base (excluding the cap base), and keeps the +2 position open to the custom sequence as described in Table 1 for mRNA production. The general practice currently used for incorporating cap molecules during in vitro transcription uses the +1 position for initiating mRNA synthesis, which requires the template to have an accurate sequence of AG or AT after the T7 promoter TATA box sequence. The embodiments of the present disclosure can include a method using a DNA template with a conventional T7 promoter sequence (which has GG after the TATA box of the T7 promoter), which co-transcribes the preparation of cap 1 mRNA without the need for specific mutagenesis of the DNA template.

[0157] In some embodiments, a method for in vitro transcribing a DNA template into RNA can include providing (1) a DNA template comprising a promoter operably linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a poly A region, and (2) a cap analog comprising the following structure: wherein R1 and R2 may each be CH3 or H; and B1 and B2 may each be A, U, G or C, The promoter may contain the sequence of TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), wherein A at position 17 is -1 nucleotide and X1 at position 18 is +1 nucleotide, When X1 is G, X2 and X3 are each A, T, G or C, then B1 is A and B2 is G, when X1 is A, X2 and X3 are each A, T, G or C, then B1 is A and B2 is A, When X1 is C, X2 and X3 are each A, T, G or C, then B1 is A and B2 is C, and When X1 is T, X2 and X3 are each A, T, G or C, then B1 is A and B2 is U, wherein the cap analog binds to -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analog in a reaction mixture, wherein the incubating can comprise incubating the reaction mixture at from about 15°C to about 35°C for about 1 hour to about 12 hours, thereby producing RNA.

[0158] The promoter may contain a sequence selected from the group consisting of SEQ ID NOs: 10, 11, 13 and 14.

[0159] In some embodiments, a method for in vitro transcribing a DNA template into RNA can include providing (1) a DNA template comprising a promoter operably linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a poly A region, and (2) a cap analog, wherein the cap analog binds to the -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analog in a reaction mixture, wherein the incubation can include incubating the reaction mixture at from about 15°C to about 35°C, preferably from about 18°C to about 31°C, for a suitable time, preferably from about 1 hour to about 12 hours, thereby producing RNA.

[0160] In some embodiments, a method for in vitro transcribing a DNA template into RNA can include providing (1) a DNA template comprising a promoter operably linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding a target RNA, a 3'UTR, and a poly A region, and (2) a cap analog, wherein the cap analog binds to -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analog in a reaction mixture, thereby producing RNA.

[0161] In some embodiments, the reaction mixture comprises NTPs and RNA polymerase. In some embodiments, the reaction mixture may further comprise one or more of the following: a buffer substance, an RNase inhibitor, a magnesium salt, a polyamine, and a pyrophosphatase.

[0162] In some embodiments, the reaction mixture comprises: a buffer substance at a concentration of from about 45 mM to about 55 mM, an RNase inhibitor at a concentration of from about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of from about 3 mM to about 5 mM, a cap analog at a concentration of from about 6 mM to about 8 mM, one or more magnesium salts at a concentration of from about 20 mM to about 30 mM, a polyamine at a concentration of from about 1.5 mM to about 2.5 mM, a DNA template at a concentration of from about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of from about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of from about 0.01 μg / μl to about 0.05 μg / μl. 5'UTR and 3'UTR

[0163] An mRNA molecule can be flanked by 5' and 3' untranslated regions (UTRs). The 5'-UTR is recognized by the ribosome to allow translation to begin, and the 3'UTR can contain regulatory sequences that can affect the expression and half-life of the mRNA. When the mRNA is expressed in mammalian cells, several different combinations of the 5' and 3' UTRs can achieve high mRNA expression efficiency.

[0164] Cao et al. (Cao et al., “High-throughput 5'UTR engineering for enhanced protein production in non-viral gene therapies”, Nature Communications, (2021) 12:4138, pp. 1-10, incorporated herein by reference in its entirety) reported a method for generating artificial 5'UTRs through a high-throughput screening process.

[0165] In an embodiment, a combination of an artificially selected 5'UTR and a human hemoglobin or mouse hemoglobin 3'UTR can be used to generate a construct for efficiently expressing an mRNA sequence. Its combination can be selected and used to construct a vector for in vitro transcription (IVT). This combination can be used to generate mRNA with efficient protein expression capabilities. In an embodiment, one or more UTRs listed in Table 5 are used (see Example 1 below). In an embodiment, one or more UTRs listed in Table 5 can be used in any combination. In an embodiment, UTRs can be used in pairs, as shown in Table 5, wherein the paired members are in the same row. In an embodiment, SEQ ID NO: 1 is paired with SEQ ID NO: 2, SEQ ID NO: 3 is paired with SEQ ID NO: 2, SEQ ID NO: 1 is paired with SEQ ID NO: 4, SEQ ID NO: 1 is paired with SEQ ID NO: 6, SEQ ID NO: 3 is paired with SEQ ID NO: 6, and / or SEQ ID NO: 9 is paired with SEQ ID NO: 2. In an embodiment, high expression efficiency of mRNA when expressed in mammalian cells can be achieved using one or more UTRs listed in Table 5. In an embodiment, one or more pairs of UTRs listed in Table 5 can be used to achieve high expression efficiency when mRNA is expressed in mammalian cells.

[0166] In an embodiment, a native 5'UTR (e.g., SEQ ID NOs: 53-69 (Table 13)) can be modified to generate a mutant 5'UTR (e.g., SEQ ID NOs: 23-52 (Table 14)). Combinations of mutant 5'UTRs and 3'UTRs (e.g., SEQ ID NOs: 2, 4, 6, 8, and 71) can be used to generate constructs for efficient expression of mRNA sequences. Combinations thereof can be selected and used to construct vectors for in vitro transcription (IVT). Such combinations can be used to generate mRNAs with efficient protein expression capabilities.

[0167] In embodiments, the nucleic acids disclosed herein can include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NOs: 1-71.

[0168] In embodiments, the nucleic acids of the present disclosure can include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequences of SEQ ID NOs: 1-9.

[0169] In embodiments, the nucleic acids disclosed herein can include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NOs: 23-52.

[0170] In embodiments, the nucleic acids disclosed herein can include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequences of SEQ ID NOs:53-69.

[0171] In an embodiment, a T7 promoter sequence, UTR can be added to an open reading frame coding sequence by gene synthesis, which can then be subcloned into a plasmid vector to produce large-scale plasmid DNA for in vitro transcription applications. Compositions comprising one or more UTRs as described herein are provided. In an embodiment, vectors comprising one or more UTRs as described herein are provided. In an embodiment, methods of using one or more UTRs as described herein are provided. In an embodiment, compositions comprising mRNA are provided, the mRNA comprising one or more UTRs as described herein. In an embodiment, vectors comprising mRNA are provided, the mRNA comprising one or more UTRs as described herein. In an embodiment, methods of using mRNA are provided, the mRNA comprising one or more UTRs as described herein. Poly A tail

[0172] The quality of the poly (A) tail (e.g., length and uniformity of length and distribution) can directly affect the efficiency of mRNA expression. Traditional methods for adding poly (A) tails to mRNA products in vitro use poly (A) polymerase. See, for example, Cao, GJ and Sarkar, N., "Identification of the gene for an Escherichia coli poly (A) polymerase", Proc. Natl. Acad. Sci. USA, (1992) 89 (21), 10380-10384, incorporated herein by reference in its entirety. However, such methods typically produce products with a wide distribution of poly (A) tail lengths, with only about 70% of the mRNA being tailed.

[0173] In addition to capping and poly A tail length and distribution, mRNA purity and integrity may be important factors affecting mRNA properties (such as, but not limited to, its stability and / or expression efficiency). Purification, promoter sequence, one or more 5' and / or 3' UTR sequences, and / or transcription conditions can contribute to the production of high-quality mRNA.

[0174] The traditional method for adding poly A tail to mRNA product in vitro uses poly A polymerase, as described in, for example, Cao et al. (Proc. Natl. Acad. Sci. USA. 89, 10380-10384). However, this method may produce poly A products with a wide distribution of poly A tail lengths, for example, wherein only about 70% of the mRNA is polyadenylated. The embodiments of the present disclosure include methods for effectively adding poly A tails to DNA templates via polymerase chain reaction (PCR). Therefore, in order to produce more uniform poly A tail products for efficient mRNA expression, these methods will provide the benefits of engineering the template tail design by a single-step PCR reaction, rather than undergoing traditional lengthy cloning and plasmid purification steps. The embodiments of the present disclosure can also provide poly A tails that are longer than the poly A tails provided by some traditional methods.

[0175] In embodiments, the methods and / or compositions may include providing capping analogs, providing and / or improving the length and / or distribution of poly A tails, providing an efficient promoter, providing an efficient UTR (such as a UTR pair), providing efficient transcription conditions, providing an efficient transcription system, providing efficient purification, or any combination thereof.

[0176] In embodiments, methods and / or compositions can be provided for increasing the uniformity of the length and / or distribution of poly A tails in transcribed mRNA molecules. In embodiments, methods and / or compositions can produce a population of mRNAs wherein greater than about 70% are tailed, wherein at least about 71% are tailed, wherein at least about 72% are tailed, wherein at least about 73% are tailed, wherein at least about 74% are tailed, wherein at least about 75% are tailed, wherein at least about 76% are tailed, wherein at least about 77% are tailed, wherein at least about 78% are tailed, wherein at least about 79% are tailed, wherein at least about 80% are tailed, wherein at least about 85% are tailed, wherein at least about 90% are tailed, wherein at least about 95% are tailed, wherein at least about 99% are tailed.

[0177] In embodiments, the methods and / or compositions can produce mRNA populations in which the length of the poly A tail (number of adenines) varies from mRNA molecules to about 70 to about 130 adenines, from mRNA molecules to about 60 to about 120 adenines, from mRNA molecules to about 50 to about 100 adenines, from mRNA molecules to about 40 to about 90 adenines, from mRNA molecules to about 50 to about 80 adenines, from mRNA molecules to about 40 to about 70 adenines, from mRNA molecules to about 30 to about 50 adenines, or from mRNA molecules to about 20 to about 40 adenines. The length of the poly A tail of an mRNA can be measured by digesting the mRNA with RNase T1, followed by purification and recovery of the poly A fragments with oligo dT magnetic beads, and then detecting the length of the poly A fragments by capillary gel electrophoresis on a bioanalyzer.

[0178] In an embodiment, the poly A tail is added to the DNA template before transcription. In an embodiment, a method for adding the poly A tail to the DNA template before transcription can be provided. In an embodiment, the poly A tail is added to the DNA template via polymerase chain reaction (PCR), which is a new method for adding the poly A tail compared to the traditional method of inserting into a plasmid vector by gene synthesis. In an embodiment, the poly A tail is added to the DNA template and can result in the production of a more uniform poly A tail mRNA product, a product with a longer poly A tail, or both, each of which or both can result in more effective mRNA expression.

[0179] In an embodiment, a composition comprising an mRNA is provided, the mRNA comprising a poly A tail as described herein added by PCR. In an embodiment, a vector comprising a poly A tail as described herein is provided, the poly A tail being added to the vector by PCR. In an embodiment, a pVAX1 or pUC57 vector is provided, the vector comprising an ampicillin resistance gene, a T7 promoter sequence, a 5'UTR and a 3'UTR sequence, an mRNA containing a poly A tail as described herein (e.g., 100A) added by PCR. In an embodiment, a method of using an mRNA is provided, the mRNA comprising a poly A tail as described herein added by PCR.

[0180] In embodiments, the disclosed methods and / or compositions can produce a population of mRNA wherein greater than about 70% are tailed, wherein at least about 71% are tailed, wherein at least about 72% are tailed, wherein at least about 73% are tailed, wherein at least about 74% are tailed, wherein at least about 75% are tailed, wherein at least about 76% are tailed, wherein at least about 77% are tailed, wherein at least about 78% are tailed, wherein at least about 79% are tailed, wherein at least about 80% are tailed, wherein at least about 85% are tailed, wherein at least about 90% are tailed, wherein at least about 95% are tailed, wherein at least about 99% are tailed, wherein about 100% are tailed.

[0181] In embodiments, the disclosed methods and / or compositions can produce a population of mRNAs in which the length of the poly A tail (number of adenines) varies from mRNA molecules by up to about 70 to about 130 adenines, from mRNA molecules by up to about 60 to about 120 adenines, from mRNA molecules by up to about 50 to about 100 adenines, from mRNA molecules by up to about 40 to about 90 adenines, from mRNA molecules by up to about 50 to about 80 adenines, from mRNA molecules by up to about 40 to about 70 adenines, from mRNA molecules by up to about 30 to about 50 adenines, or from mRNA molecules by up to about 20 to about 40 adenines.

[0182] Bacterial research has proved that repetitive sequence (for example, CTG, CAG) and plasmid replication and transcription pattern and level can work in the amplification and disappearance of repetitive sequence.After inducing lacZ promotor, the deletion frequency of cloned repetitive sequence can increase up to 20 times, and the lacZ promotor drives the transcription (Bowater et al., 1997.Transcription increases the deletion frequency of long CTG·CAG tripletrepeats from plasmids in Escherichia coli.Nucleic Acids Res 25:2861-2868 of insertion sequence in pUC19; Its content is hereby incorporated by reference in its entirety). Common vectors can typically maintain high copy number, and can induce the transcription and translation of antibiotic resistance gene, indicator gene (such as blue / white screening gene) and insert fragment, so as to cause the instability of the dna sequence dna of some categories. As extreme repetitive sequence and very low GC ratio sequence, poly A sequence may easily be lost in plasmid cloning and replication process. If such a sequence exists, accidental transcription and translation affected by the inducible activity of upstream and downstream promoters may further increase the instability of the poly A sequence. In order to avoid promoter-like initiation activity in the vector for the inserted sequence, common strategies may include segmenting the inserted gene (if the inserted gene has significant cytotoxicity) or directional cloning of the ORF in the "reverse" direction relative to transcription from the promoter of the vector. However, these two strategies may not be suitable for gene cloning containing poly A sequences. Segmentation can eliminate the genotoxicity of the cloned gene after expression, but this strategy may not be able to solve the instability problem of the poly A sequence because the transcription process has not been eliminated, and reverse insertion can only eliminate the influence of the promoter in a certain direction. Therefore, the embodiments of the present disclosure may include modifying the vector by inserting transcription terminators upstream and downstream of the multiple cloning site, which can effectively interrupt the influence of the upstream and downstream promoters of the multiple cloning site on the inserted gene. This strategy effectively improves the stability of the poly A sequence during plasmid cloning and replication, especially some extremely unstable poly A-containing boxes. The results showed that after adding transcription terminators upstream and downstream of the multiple cloning site, the positive rate of cloning reached 25%-50% (almost 0 before adding terminators), and the number of A bases in the poly A tail increased from 70-110 to approximately 120. In addition, after adding terminators upstream and downstream of the inserted cassette, the plasmid yield also increased by 32.5%.Without being limited to a particular theory, this increase may be due to the insertion of a transcription terminator that restores the activity of the replication origin (Stueber et al., 1982. Transcription from efficient promoters can interfere with plasmid replication and diminish expression of plasmid specified genes. EMBO J 1: 1399-1404; the contents of which are hereby incorporated by reference in their entirety). The use of transcription terminators upstream and downstream of the multiple cloning site to facilitate the cloning of cytotoxic sequences or repetitive sequences (such as poly A tails) has not been reported in the art.

[0183] The transcription termination sequence may be any nucleotide sequence that, when transcriptionally placed downstream of the nucleotide sequence encoding the open reading frame, causes the transcription of the open reading frame to terminate. Such sequences are known in the art and may be of prokaryotic, eukaryotic, or phage origin. Examples of terminator sequences include, but are not limited to, the PTH terminator, the pET-T7 terminator, terminator, pBR322-P4 terminator, vesicular stomatitis virus terminator, rrnB-T1 terminator, rrnB-T2 terminator, λt0 terminator, rrnC terminator, Ttadc transcriptional terminator, and yeast-recognized termination sequences (e.g., Matα (α factor) transcriptional terminator, native α factor transcriptional termination sequence, ADR1 transcriptional termination sequence, ADH2 transcriptional termination sequence, and GAPD transcriptional termination sequence). A non-exhaustive list of transcriptional terminator sequences can be found in the iGEM registry available at partsregistry.org / Terminators / Catalog. A series of 2, 3, 4, 5, 6, 7 or more first transcription terminator sequences can be placed directly 3' to the last nucleotide of the gene of interest (or open reading frame), or at a distance of at least 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-100, 100-150, 150-200, 200-300, 300-400, 400-500, 500-1,000 or more nucleotides 3' to the last nucleotide of the gene of interest (or open reading frame). The number of nucleotides between tandem transcription terminator sequences can vary, for example, the transcription terminator sequences can be separated by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or more nucleotides. carrier

[0184] In an embodiment, a vector is provided, which includes one or more of the following: (i) a poly A tail as described herein, (ii) one or more UTRs as described herein, (iii) one or more promoters as described herein, or (iv) a combination thereof. In an embodiment, the vector can have various uses, including but not limited to being used to insert a target template nucleotide sequence. In an embodiment, such a vector with a target template nucleotide sequence can be used (as a non-limiting example) to clone or transcribe the target template nucleotide sequence. In an embodiment, transcription can include in vitro transcription. In an embodiment, T7 RNA polymerase can be used for transcription. In an embodiment, the vector can be a plasmid or viral vector, such as, but not limited to, pVAX1 and / or pUC57. mRNA purity

[0185] The integrity of mRNA may affect cellular expression; therefore, it may be important to start translation with high-integrity mRNA. The conditions used for transcription may affect the quality of the mRNA produced. Some transcription conditions can result in more truncated products.

[0186] mRNA integrity can be a key factor influencing cellular expression, so starting with high-integrity mRNA can be crucial. mRNA integrity has two aspects. Typically, RNA tends to degrade faster than DNA due to its chemical instability, so storage conditions affect RNA quality. Additionally, transcription conditions can also lead to more truncated products, so optimal buffer conditions can be empirically determined to achieve higher integrity and higher yields across a wide range of mRNA sizes.

[0187] The conditions used for purification may affect the quality of the mRNA produced. For example, the presence of trinucleotide cap analogs in the final mRNA product m7 GpppA * The pG residues can compete with capped mRNA for ribosome recruitment, thereby inhibiting mRNA translation efficiency in cells. Purification after in vitro transcription may be an important step in obtaining the final purified mRNA product.

[0188] The present disclosure further provides solutions for obtaining pure mRNA products with minimal contaminant cap analogs, free NTPs, and other proteins that may interfere with and impair the performance of the mRNA products. mRNA purity refers to the ratio of full-length mRNA species in the crude transcribed mRNA product, which can be quantified by the ratio of full-length peaks in capillary gel electrophoresis.

[0189] In embodiments, purification as described herein can produce a highly pure mRNA product with minimal contaminant analogs, free NTPs, and / or other proteins that may interfere with and / or impair the stability and / or translation efficiency of the mRNA product. In embodiments, the purification method comprises binding the nucleic acid using a silica membrane column, followed by washing with about 60% to about 80% ethanol in water, preferably about 70% to about 80% ethanol in water, and subsequently eluting in water.

[0190] Other conventional purification methods using LiCl precipitation or affinity-based magnetic bead purification can be applied for the same purpose. In an embodiment, the purification methods as described herein can be used in conjunction with the compositions and / or methods described herein and / or used in conjunction with conventional compositions and / or methods.

[0191] In embodiments, methods and / or compositions for increasing the purity of transcribed mRNA can be provided. In embodiments, methods and / or compositions for producing the following mRNA can be provided: mRNA obtained at about 79% or greater purity; mRNA at about 79.5% or greater purity; mRNA at about 80% or greater purity; mRNA at about 80.5% or greater purity; mRNA at about 81% or greater purity; mRNA at about 81.5% or greater purity; mRNA at about 82% or greater purity; mRNA at about 82.5% or greater purity; mRNA at about 83% or greater purity; mRNA at about 83.5% or greater purity; mRNA at about 84% or greater purity; mRNA at about 84.5% or greater purity; mRNA at about 85% or greater purity; mRNA at about 85.5% or greater purity; mRNA at about 86% or greater purity; mRNA at about 86 .5% or greater purity; mRNA of about 87% or greater purity; mRNA of about 87.5% or greater purity; mRNA of about 88% or greater purity; mRNA of about 88.5% or greater purity; mRNA of about 89% or greater purity; mRNA of about 89.5% or greater purity; mRNA of about 90% or greater purity; mRNA of about 91% or greater purity; mRNA of about 92% or greater purity; mRNA of about 93% or greater purity; mRNA of about 94% or greater purity; mRNA of about 95% or greater purity; mRNA of about 96% or greater purity; mRNA of about 97% or greater purity; mRNA of about 98% or greater purity; mRNA of about 99% or greater purity; or mRNA of about 100% purity. The purity of mRNA can be measured by capillary gel electrophoresis using a bioanalyzer instrument, and the target peak area ratio (target length ± 15%) can be calculated for its purity measurement.

[0192] In an embodiment, methods and / or compositions for increasing the purity or integrity of transcribed mRNA can be provided. Obtaining high-quality long mRNA from in vitro transcription is a significant challenge because long mRNA tends to degrade more easily. The present invention has found that temperature and duration of in vitro transcription reactions are key factors affecting the quality of the long mRNA produced. Figure 11A As shown, in vitro transcription at 25°C for 2.5 hours produced a 10 kb mRNA product with a purity of approximately 57% as determined by a bioanalyzer, whereas the same IVT reaction at 31°C for 2.5 hours produced a 10 kb mRNA with a purity of approximately 2% because most of the mRNA product was truncated ( Figure 11B The yield and purity of mRNA produced by IVT reactions performed at temperatures of 18°C, 21°C, 25°C, and 31°C were investigated, and the results of mRNA purity and yield are shown in Figure 11C and Figure 11D As low as 18°C, long mRNAs can be transcribed using the disclosed methods with T7 polymerase. T7 RNA polymerase-mediated transcription

[0193] In eukaryotes, transcription of messenger RNA (mRNA) is accomplished by RNA polymerase II. This is a complex multi-subunit enzyme under complex regulation. In order to perform large-scale in vitro transcription, researchers typically use single-subunit phage polymerases derived from T7, T3, SP6, K1-5, K1E, K1F or K11 phages. This polymerase family uses a simple minimal promoter sequence of approximately 17 nucleotides, which may not require auxiliary proteins and may have minimal restrictions on the starting nucleotide sequence. Although the present application focuses on T7 RNA polymerase (T7 RNAP), it will be appreciated by those skilled in the art that this disclosure can be practiced with other RNA polymerases.

[0194] T7 RNA polymerase (RNAP) exists in at least two protein states. The first is called the "abortive complex" and is likely associated with transcription initiation. The second is a very persistent conformation called the "elongation complex." In vitro transcription can be divided into six steps: 1) binding of RNA polymerase to the promoter sequence, 2) initiation of transcription, 3) non-progressive elongation called abortive transcription, during which the polymerase frequently releases the DNA template and produces short, abortive transcripts, 4) conversion of the open complex to a closed complex, 5) processive elongation, and 6) termination of transcription. A large amount of RNA produced during transcription may contain short abortive fragments of about 2-8 nucleotides in length (Biochemistry 19:3245-3253 (1980); Nucleic Acids Res. 9:31-45 (1981); Nucleic Acids Res. 15:8783-8798 (1987); Biochemistry 27:3966-3974 (1988), each of which is herein incorporated by reference in its entirety). After synthesizing approximately 10-14 bases, RNA polymerase may escape from the abortive cycle, concomitantly losing sequence-specific contacts with the promoter DNA, and form a processive elongation complex in which the RNA chain can extend in a sequence-independent manner (J. Mol. Biol. 183: 165-177 (1985); Proc. Natl. Acad. Sci. USA 83: 3614-3618 (1986); Mol. Cell Biol. 7: 3371-3379 (1987), each of which is incorporated herein by reference in its entirety). Table 2

[0195] The consensus sequence of the most active class III T7 promoter can encompass a 17 bp sequence upstream of the transcription start site and a 6 bp sequence downstream (Cell 16:815-25. (1979), incorporated herein by reference in its entirety). The position of the first transcribed nucleotide is generally referred to as the +1 transcript nucleotide of the RNA, the second transcribed nucleotide is referred to as the +2 transcript nucleotide, and so on (Table 2). During transcription, the two chains can be melted to form a transcription bubble, and the bottom strand of the duplex (shown as 3' to 5' in Table 2) is the template for transcription. For transcript nucleotides +3 and above, the template strand can define the identity of the transcribed nucleotides primarily through Watson-Crick base pairing interactions. Here, the nucleotide encoding the first RNA transcript nucleotide is defined as the +1 nucleotide of the template. In the example shown in Table 2, the +1 transcript nucleotide is G, and the +1 template nucleotide is C. Similarly, the +4 transcript nucleotide is A, and the +4 template nucleotide is T.

[0196] It is known that T7 RNAP can also be initiated with short oligonucleotide primers. For example, it is known that 13 promoters in the T7 genome can be initiated with pppGpG (J.Mol.Biol.370:256-268 (2007), which is incorporated herein by reference in its entirety). It has been shown that T7 RNAP can be initiated from dinucleotide primers (Biochemistry24:5716-5723 (1985), which is incorporated herein by reference in its entirety). Axelrod et al. showed that uncapped GpA dinucleotides can be initiated from +1 and +2 template nucleotides of 2'-deoxycytidine and 2'-deoxythymidine, respectively ("CT" template). The reaction conditions are 200 micromolar (μM) dimers and 100 μM ATP, CTP, GTP, and UTP. The reaction conditions also contain 100 μM 3'dATP, 3'dCTP, 3'dUTP, or 50 μM 3'dGTP. Only RNA initiated by GpA was observed, while a mixture of RNA initiated by GpA and 5' triphosphate RNA initiated by GTP was not observed. This may be due to the reaction conditions used. 100 μM GTP is far below the 2 mM Kd of T7 polymerase for the first initiating guanosine (J. Mol. Biol. (2007) 370, 256-268, incorporated herein by reference in its entirety). Since GTP competes with the initiating oligonucleotide for initiation, using low GTP concentrations favors GpA initiation, but may result in low transcription yields (estimated maximum calculated yield <150 ug / mL reaction). When transcription is initiated on a "CT" template with ApG, CpG, UpG or GpG, the formation of RNA transcripts with additional non-templated 5' nucleotides (A, C, U or G, respectively) is observed.

[0197] Ishikawa et al. showed that the structure m7 GpppApG, m7 Gppp m6 ApG, m7 GpppA 2'Ome pG or m7 Gppp m6 A 2'Ome The pG capped initiator oligonucleotide trimer can initiate transcription on a template with 2'-deoxycytidine residues at template positions +1 and +2 ("CC" template; Nucleic Acids Symposium Series No. 53:129 (2009), incorporated herein by reference in its entirety). The authors note that "compared to using m7 The different results in the case of G5'pppG may be due to m7This method is significantly different from the method described in the present disclosure, in which the +1 and +2 nucleotides of the starting capping oligonucleotide trimer pair with the +1 and +2 nucleotides of the template nucleotides. Ishikawa et al. used 6 mM starting oligonucleotide trimer, 0.9 mM GTP, and 7.5 mM each of ATP, CTP, and UTP. The authors used a 6-fold excess of the capping starting oligonucleotide primer (the most expensive nucleotide component in the transcription reaction) over competing GTP to drive the transcription reaction towards capped RNA rather than pppRNA, which increases the overall cost of synthesizing RNA. On the other hand, the low concentration of GTP (0.9 mM) limits the total yield of RNA in the transcription reaction (theoretically less than 1.4 mg / mL). In contrast, the method described herein may not require limiting the concentration of any NTP to achieve efficient RNA capping and higher RNA yields (about 2 to 10 mg / mL), thereby allowing the production of high-quality mRNA at a commercially beneficial cost. T7 RNA polymerase

[0198] In some embodiments, at least one modification of the T7 RNA polymerase can be selected from the group consisting of P266L, P270L, P270S, P270A, P270Y, Q744L, Q744P, Q744R, Y639F, H784A, E593G, Y639V, V685A, H784G, S430P, N433T, S633P, F849I, and F880Y. In some embodiments, at least one modification includes Y639F and H784A. In some embodiments, at least one modification includes E593G, Y639V, V685A, and H784G. In some embodiments, at least one modification includes S430P, N433T, S633P, F849I, and F880Y. In some embodiments, at least one modification comprises S430P, N433T, S633P, F849I, F880Y, and P266L. In some embodiments, at least one modification comprises S430P, N433T, S633P, F849I, F880Y, Y639F, and H784A. In some embodiments, at least one modification comprises S430P, N433T, S633P, F849I, F880Y, P266L, Y639F, and H784A. In some embodiments, at least one modification comprises S430P, N433T, S633P, F849I, F880Y, E593G, Y639V, V685A, and H784G. In some embodiments, the at least one modification includes S430P, N433T, S633P, F849I, F880Y, P266L, E593G, Y639V, V685A, and H784G.

[0199] In some embodiments, at least one modification of the T7 RNA polymerase promotes the initiation-extension transition. In some embodiments, at least one modification increases promoter clearance. In some embodiments, at least one modification increases the stability and / or activity of the polymerase. In some embodiments, at least one modification increases the thermostability of the polymerase. In some embodiments, at least one modification produces 2'-Ome incorporation. Magnesium ions in in vitro transcription

[0200] Magnesium ion (Mg 2+ ) is an essential component of RNA in vitro transcription buffer systems for initiating transcription using cap analogs instead of GTP. Conventional buffer systems for RNA in vitro transcription (e.g., HEPES buffer, Tris-HCl buffer) may contain high concentrations of free magnesium ions, as free Mg may be required. 2+ ions to ensure high activity of RNA polymerase. During the in vitro transcription process, Mg 2+ Complexes with NTP during the reaction, keeping free of additional free Mg2+ The presence of Mg ions in the buffer system is important to ensure high capping efficiency and high integrity of the transcribed mRNA. Therefore, higher concentrations of Mg 2+ May cause problems, especially in the case of high yield / industrial scale RNA production. 2 + Ion-related problems may include magnesium-driven precipitation, which may lead to free Mg 2+ A decrease in Mg concentration results in a depletion of magnesium ions from the RNA polymerase reaction center. The result will be a lower efficiency of RNA in vitro transcription. To evaluate the effect of Mg concentration on mRNA IVT yield and integrity, IVT was performed in the presence of increasing Mg concentrations. By maintaining the final Mg concentration in the IVT reaction at 16.5 mM, 21 mM, 29 mM, and 37 mM, the free Mg in the IVT reaction system after complexing with NTPs and cap analogs was reduced. 2+ The concentrations of Mg are -12mM, -8mM, 0mM and +8mM respectively. 2+ As the concentration increases, the mRNA production decreases ( Figure 12A ), and when Mg 2+ As concentrations increase, mRNA integrity decreases ( Figure 12B ). Examples Example 1 Construction of DNA template Encoding a poly A tail in the DNA template

[0201] The poly A tail can be encoded in the DNA template by using appropriately tailed PCR primers. A forward primer and a reverse primer comprising a poly T sequence oligonucleotide are synthesized by methods known in the art. The primers used herein are synthesized by solid phase oligonucleotide synthesis (such as, but not limited to, solid phase chemistry) and then assembled in a PCR reaction using a reverse primer comprising a poly T sequence.

[0202] Forward primer: GCTTAGGAAATTAATACGACTCACTATAAGG (SEQ ID NO: 17)

[0203] Reverse primer: ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt ttttttgccgcccactcagactttattc(SEQ ID NO:18)

[0204] The reaction mixtures are described in Table 3 below. Table 3

[0205] A DNA template containing a T7 promoter (SEQ ID NO: 10), a 5'UTR (SEQ ID NO: 9), a Kozak sequence (GCCACC), an eGFP coding sequence, and a 5'UTR (SEQ ID NO: 2) was subcloned into a pVAX vector. A poly A tail was added to the DNA of the DNA template encoding enhanced green fluorescent protein (eGFP) using (i) a reverse primer (SEQ ID NO: 18) having different lengths of T. The lengths of the resulting DNA templates, which had 100 A, 80 A, 60 A, and 40 A, were confirmed by testing with a DNA bioanalyzer (Agilent DNA7500 kit) ( FIG1 ). Table 4 KAPA = KAPA HiFi HotStart DNA Polymerase Super Fi2 = Invitrogen Platinum SuperFi II DNA Polymerase NA = Not Available

[0206] Reactions #1-#3 (Table 4) performed using conventional PCR methods failed to add the poly A tail and produced DNA products with a length of 969 bp. Figure 1A It was shown that using the method of the present disclosure, DNA with a 100A tail having an average length of 1086 bp and a purity of about 90% was produced. Figure 1B It showed that more than 90% of the PCR products of the eGFP template had a 100A tail, with an average length of 1086 bp. Cloning of 5'UTR and 3'UTR into DNA template

[0207] During gene synthesis, the different UTRs were cloned into a vector containing the eGFP target DNA template. A gene fragment containing a T7 promoter (SEQ ID NO: 10), a 5' UTR (SEQ ID NO: 9), a Kozak sequence (GCCACC), the eGFP coding sequence, and a 3' UTR (SEQ ID NO: 2) was prepared by gene synthesis and then subcloned into the pVAX vector to generate a plasmid for mRNA production. The 5' UTR and 3' UTR pairs are shown in Table 5. Table 5

[0208] The plasmid was linearized by restriction enzymes and then purified to prepare a linear plasmid for in vitro transcription to prepare mRNA. mRNA was prepared by the aforementioned co-transcription method using cap [I] and then purified by silica membrane column. mRNA quality was tested by bioanalyzer using Agilent RNA Nano6000 kit ( Figure 2A ).

[0209] The expression efficiency of eGFP mRNA with different UTRs on A549 cells was tested. 1 μg of mRNA was transfected into each well of A549 cells in a 96-well plate using lipofectamine 2000, tested in triplicate, and the eGFP expression level was measured by plate reader based on its fluorescence intensity, according to the CyQUANT TM Cell viability was normalized to the cell number measured by XTT cell viability assay. Figure 2B The expression levels of mRNAs with different UTR combinations are shown. The UTR combinations in mRNAs #4 (SEQ ID NOs: 3 and 2), #5 (SEQ ID NOs: 5 and 8), #6 (SEQ ID NOs: 1 and 6), and #8 (SEQ ID NOs: 9 and 2) produce higher EGFP expression levels than others (e.g., #1 (SEQ ID NOs: 1 and 2), #2 (SEQ ID NOs: 1 and 4), #3 (SEQ ID NOs: 1 and 8), and #7 (SEQ ID NOs: 7 and 4)). Example 2 Construction of DNA template Encoding a poly A tail in the DNA template

[0210] By using the tailing PCR primers of appropriate chemical modification coupled with T7 exonuclease digestion, high-purity poly A tail can be encoded in the DNA template. By solid phase chemistry, a forward primer modified by phosphorothioate synthesis and a reverse primer comprising a poly-T sequence oligonucleotide are used. Modified primers are assembled to assemble the PCR reaction to produce a DNA template for in vitro transcription. The PCR product is further digested with T7 exonuclease (NEB) to remove any brachymembrane DNA product, thereby producing a high-purity template for downstream mRNA preparation.

[0211] Forward primer: C*A*C*TGCTTACTGGCTTATCGAAATTAATACGACT CACTATA*G*G*A(SEQ IDNO:19)

[0212] Reverse primer: T*mU*T*[T] 96TGCCGCCCACTCAGACTTTATTCAAAGA*C*C*A(SEQ ID NO:20) Note: * indicates phosphorothioate backbone modification, and mU indicates 2'-O-methyl-uridine.

[0213] The reaction mixtures are described in Table 6 below. Table 6 (Reaction #4)

[0214] Reaction #4 (Table 6) using the touch-up PCR method generated DNA templates with uniform poly A tails for downstream applications. Using KAPA HiFi DNA polymerase (Roche), touch-up PCR was performed for 5 cycles with an annealing temperature of 62°C, followed by 20 cycles with an annealing temperature of 68°C. Following standard protocols, the resulting PCR products were purified using DNA selection magnetic beads (Yeasen) and further digested with T7 exonuclease in NEB buffer 4 at 25°C for 30 minutes to remove all impurities. Example 3 Effect of promoter on capping efficiency

[0215] To test the effect of promoters on capping efficiency, plasmids containing the different promoters listed in Table 1, 5'UTR (SEQ ID NO: 9), eGFP ORF, 3'UTR (SEQ ID NO: 2) and 100 A were prepared by mutagenesis using pVAX vector, purified by maxi-prep, and then linearized by restriction enzymes after the poly A sequence to generate templates for mRNA preparation.

[0216] Using a linearized plasmid as a template, T7 polymerase and cap [I] AG, N1-methyl-pseudo UTP, mRNA was prepared by the in vitro transcription method disclosed herein. The prepared mRNA was purified by a silica membrane column. Then, the capping efficiency of each mRNA was tested. In order to test its capping efficiency, a 24-mer probe was synthesized from Integrate DNA Technologies (IDT). The 24-mer probe had 4 DNA nucleotides at the 5' end, a 20nt RNA that was reversely complementary to the 5' end sequence of the mRNA, and a 3' end biotin modification. The probe was hybridized with the prepared mRNA and further digested with RNase H to cut at the DNA / RNA hybridization position, thereby releasing the 24-mer of the 5' end mRNA. The probe was further purified with streptavidin magnetic beads and analyzed by LC-MS. UPLC conditions were 5% B hold 0-0.5 min, 6%-20% B over 5 min, Clarity Oligo-xt 2.1 x 50 mm, 2.6 μm column, 60C, B=65 / 35 ACN / water, A=1% HFIP buffer, 0.4 mL / min. Mass analysis was performed using an Orbitrap Velos Pro mass spectrometer.

[0217] Figure 10A An exemplary schematic diagram showing the use of a cap [I] 3-mer nucleotide (e.g., 7mGpppmAG) at the -1 position of a promoter to initiate in vitro transcription to produce capped mRNA (e.g., G at the +1 position of the promoter). For clarity, the TATA sequence upstream of the +1 position is boxed. Thus, 7mGpppmAG binds to the -1 and +1 positions to initiate in vitro transcription. Figure 10B An exemplary schematic diagram showing the use of a cap [I] 3-mer nucleotide (e.g., 7mGpppmAG) to initiate in vitro transcription at the +1 position to prepare capped mRNA (e.g., A at the +1 position and G at the +2 position). Thus, 7mGpppmAG binds to the +1 and +2 positions to initiate in vitro transcription. Figure 10C Shown are LC-MS data used to test the capping efficiency of exemplary mRNAs prepared using cap analogs and the disclosed in vitro transcription method. Figure 10D It was shown that using the disclosed in vitro transcription method, mRNA prepared using the template 6.5GGG (SEQ ID NO: 10) with IVT starting from the -1 position, or using the template 6.5AGG (SEQ ID NO: 12) with IVT starting from the +1 position, or using the template 2.5AGG (SEQ ID NO: 15) with IVT starting from the +1 position, produced capped eGFP mRNA with similar expression efficiency in A549 cells.

[0218] The capping efficiency was calculated by the ratio of the fragments with the target capped molecular weight to the total fragments in the LC-MS analysis. The capping efficiency test results of the promoter with cap [I]-AG are listed in Table 7 below: Table 7 SEQ ID NO: promoter Cap analogs Capping efficiency 10 TAATACGACTCACTATAGGG hat[I] 98.80% 11 TAATACGACTCACTATAGG hat[I] 93.47% 12 TAATACGACTCACTATAAGG hat[I] 92.18% 13 TAATACGACTCACTATAGAT hat[I] 97.73% 14 TAATACGACTCACTATAGA hat[I] 93.61% 15 TAATACGACTCACTATTAGG hat[I] 93.17%

[0219] Table 7 shows that the ORF driven by the promoter (SEQ ID NO: 10) produces eGFP mRNA with higher capping efficiency than ORFs driven by other promoters with cap [I].

[0220] Higher organisms typically have more extensively methylated cap structures, while yeast mRNA primarily contains Cap 0 structures. 2'-O-methylation at the second base after the triphosphate bond is called Cap 2. Approximately half of human poly(A)-tailed mRNA molecules have Cap 2 structures. Methylation of Cap 1 and Cap 2 in U2 snRNA is essential for its spliceosome formation and associated splicing activity (WernerMaria, Purta Elzbieta et al., Nucleic Acid Research, 2011, Vol. 30, No. 11, pp. 4756-4768; the contents of which are hereby incorporated by reference in their entirety). The new cap analogs were evaluated for use in preparing capped mRNA via a one-step in vitro transcription reaction. Following the methods described herein, Cap [II] was added to the IVT reaction system using the modified T7 polymerase P266L described above. The resulting mRNA was purified using a silica membrane column, and capping efficiency was tested using RNase H digestion coupled to LC-MS. Example 4 Determination of poly A tail length

[0221] The poly A tail length can be determined by using the following method: digesting the mRNA sample with RNase T1 (which can cut RNA after the G base), then purifying the digested fragments and recovering the poly A tail fragments using oligo dT magnetic beads, eluting the purified poly A tail fragments after denaturation with high-temperature water or a denaturing reagent, and then analyzing the poly A tail length by bioanalyzer or other capillary electrophoresis or LC-MS.

[0222] Poly A fragment length analysis was performed using RNase T1 digestion coupled to a bioanalyzer to detect mRNA tail length. Briefly, mRNA was digested with RNase T1 (which cleaves mRNA after each rG base), and then poly A fragments were purified using oligo dT magnetic beads. The purified poly A fragments were analyzed using a small RNA kit with a bioanalyzer.

[0223] The length of the poly A tail is a key quality attribute of mRNA. Figure 4The results indicate that mRNAs with longer poly A tails have better mRNA translation / expression efficiency in cells. Generally, mRNAs longer than 80A can be expected to have good protein translation. Figure 3 The results of the poly A tail length analysis of mRNA samples performed by a bioanalyzer are shown. Peak 3: the poly A tail of the mRNA obtained from Company A, which is a typical distribution of poly A tails produced by poly A polymerase, resulting in a wide range of length distribution from 20 to 100nt, with an average poly A tail length of 63nt; Peak 4: the poly A tail of the mRNA produced using the PCR-based method disclosed herein, resulting in a characteristic and sharp distribution uniformly distributed around a size of 120±20nt; and Peak 5: the poly A tail of the mRNA produced using the method of Company T, resulting in an average tail length of 140nt but a wider distribution. The results indicate that the use of the poly A tail produced by the PCR-based method described in Example 1 results in the production of high-quality DNA templates with a uniform poly A length distribution, which further contributes to high-quality mRNA with a uniformly distributed poly A tail. As Figure 5A and Figure 5B The mRNA translation or expression efficiency shown indicates that the internal (IH) eGFP mRNA has stronger expression than the eGFP mRNA from company T (T), while the eGFP from company A (A) has the lowest expression. Peak 1 is a noise peak. Peak 2 ( Figure 3 ) shows the lower marker in the Small RNA Bioanalyzer Kit, which is a 4nt long internal size control added to each sample run for analytical alignment. Effect of poly A tail length on gene expression

[0224] eGFP mRNA with different lengths of poly A tail was prepared by the aforementioned co-transcriptional capping method using cap [I], 100% UTP was replaced with N1-methyl-pseudo UTP, and the resulting mRNA was purified by silica membrane purification method for cell expression assay. One day before the experiment, A549 cells were plated on 96-well plates and 0.5 μg of mRNA was transfected into each well using lipofectamine 2000. Only cells were used as untreated background controls, and groups of EGFP-mRNA-100A, EGFP-mRNA-80A, EGFP-mRNA-60A, EGFP-mRNA-40A, or eGFP mRNA prepared in-house using the method disclosed herein were tested in triplicate. The expression level of eGFP protein was measured the next day by plate reader using CyQUANT TM Normalization of viable cell numbers for XTT cell viability assay.

[0225] Figure 4The results showed that the expression level of eGFP in A549 cells increased with the length of the poly A tail of mRNA. mRNA with a minimum of 60 A tails is easily expressed and translated. Example 5 In vitro transcription

[0226] Both the linearized DNA plasmid and the PCR product can be used as DNA templates for preparing mRNA by in vitro transcription. To test in vitro transcription conditions, a plasmid vector containing a T7 promoter (SEQ ID NO: 11), 5'-UTR (SEQ ID NO: 9), eGFP coding sequence, 3'-UTR (SEQ ID NO: 2), and poly A tail (100A) was linearized by BspQ1 or Bbs1 restriction enzymes and purified by ethanol precipitation. The linearized plasmid was transcribed using T7 RNA polymerase (M3Q), a cap analog (cap [I]), 10x transcription buffer, NTPs, and an RNase inhibitor to prepare capped mRNA. Table 8 *: eGFP DNA template, luciferase DNA template, or espCas9 DNA template.

[0227] The cap analog can be any cap analog described herein. HEPES buffer is 400 mM HEPES in water, pH 7.5; Tris buffer is 400 mM Tris-HCl buffer, pH 7.5. The RNA polymerase can be wild-type T7 RNA polymerase or a mutant T7 RNA polymerase with enhanced stability and / or the ability to incorporate a cap [II] analog. In vitro transcription can be performed in DNase-free, RNase-free plastic tubes ranging from 0.2 mL to 15 mL at a defined temperature with or without shaking.

[0228] In vitro transcription mixture and conditions are described in Table 8. More specifically, 10x buffer containing HEPES or Tris buffer was prepared by adding magnesium acetate, spermidine and DTT and stored at -20 ° C for future use. In the in vitro transcription reaction, buffer, water containing no DNase and no RNase, NTP and cap analogs were added to the reaction tube, followed by the addition of DNA template, T7 polymerase, RNase inhibitor and inorganic pyrophosphatase. The reaction was maintained at a specified temperature ranging from 20 ° C to 40 ° C for 1 to 6 hours to transcribe. The DNA template was then removed by digestion with enzymes containing no DNase 1 and RNase.

[0229] The eGFP mRNA prepared in this way using the promoter (SEQ ID NO: 15) was used for expression efficiency determination in A549 cells. Two batches of cap [I], modified 100% N1-methyl-pseudo UTP, 100A-tailed eGFP mRNA were prepared and named internal (IH) 1 and IH2. Cells only (indicating cells were not treated with mRNA) were used as background controls. For comparison, eGFP mRNA was also obtained from Company T (T) and Company A (A), where Company T used co-transcriptional capping with the promoter of SEQ ID NO: 12, and Company A used traditional enzymatic in vitro transcription to prepare uncapped mRNA, and then added cap analogs with vaccinia virus capping enzyme and 2'-O-methyltransferase, and added poly A tails using poly A polymerase. The eGFP mRNA samples were transfected into A549 cells in 96-well black well transparent bottom plates in triplicate, and each 1ug of mRNA was transfected into the cells with 0.5uL of lipofectamine 2000 and OptiMEM. Cells were incubated with mRNA overnight, and expression efficiency was measured by relative fluorescence intensity of eGFP mRNA-treated cells using a plate reader and normalized to relative cell number as tested by Cyquant XTT cell viability assay. Figure 5 shows that expression of eGFP mRNA prepared by the method of the present disclosure, i.e., IH1 and IH2, was higher than expression of eGFP mRNA prepared by the method of Company T (T) and Company A (A), wherein Company T used co-transcriptional capping with the promoter of SEQ ID NO: 12, and Company A used traditional enzymatic in vitro transcription to prepare uncapped mRNA, followed by addition of cap analogs using vaccinia virus capping enzyme and 2′-O-methyltransferase, and addition of a poly A tail using poly A polymerase. eGFP mRNA samples were transfected in triplicate into A549 cells in 96-well black well clear bottom plates, and each 1 ug of mRNA was transfected into the cells using 0.5 uL of lipofectamine 2000 and OptiMEM. Cells were incubated with mRNA overnight, and expression efficiency was measured by relative fluorescence intensity of eGFP mRNA-treated cells using a plate reader and normalized to relative cell number as tested by the Cyquant XTT cell viability assay. Figure 5 shows that expression of eGFP mRNA produced by the methods of the present disclosure, namely IH1 and IH2, was higher than that of eGFP mRNA produced by the methods of Company T (T) and Company A (A). Figure 9 shows that eGFP mRNA produced by an in vitro transcription reaction at 31°C had higher expression efficiency than eGFP mRNA produced by a reaction at 37°C.

[0230] To determine luciferase mRNA expression using the methods of the present disclosure, a plasmid vector (F-Luc) containing a T7 promoter (SEQ ID NO: 15), 5'-UTR (SEQ ID NO: 10), luciferase coding sequence, 3'-UTR (SEQ ID NO: 2), and a poly A tail (100A) was used for in vitro transcription, followed by lipofectamine (Lipo)-mediated transfection into A549 cells. Figure 6 It was shown that luciferase mRNA was readily expressed and translated compared to controls (eg, cells alone, Lipo alone, and eGFP-transfected cells as a negative control).

[0231] To determine espCas9 mRNA expression using the methods of the present disclosure, plasmid vectors containing the T7 promoter (SEQ ID NO: 12), 5'-UTR (SEQ ID NO: 9), espCas9 (espCas9-1) and espcas9-EGFP (espCas9-2) coding sequences, 3'-UTR (SEQ ID NO: 2) and a poly A tail (100A) were used for in vitro transcription and subsequently transfected into A549 cells. Figure 7 The expression levels of espCas9-1 and espCas9-2 mRNAs were shown to be higher than those of mRNAs prepared by the method of company T(T) and the cell-only control.

[0232] The integrity of the mRNA prepared by the method of the present disclosure was analyzed by bioanalyzer to assess purity based on size. An Agilent RNA Nano 6000 kit was used. The X-axis indicates the length of the mRNA, and the Y-axis indicates the fluorescence intensity of the mRNA tested in capillary electrophoresis. The purity of the analyzed mRNA was analyzed by smear analysis to calculate the ratio of the target length ± 10% mRNA population. The results showed that the purity of the mRNA prepared by the method of the present disclosure was about 85% ( Figure 8A , in-house), which is 68% purer than the mRNA prepared by the method of company T ( Figure 8B ) and the purity of mRNA prepared by the method of company T was 79% ( Figure 8C ) is higher. The temperature of the IVT reaction is a key factor affecting the purity of mRNA. For 1kb mRNA eGFP, the reaction at 37°C produced 80% pure mRNA ( Figure 9C ) compared to the reaction at 31°C, which yielded 90% higher purity mRNA ( Figure 9B For 10 kb mRNA, the reaction was carried out at 31°C ( Figure 11B ) compared to the reaction at 25°C, which yielded higher purity mRNA ( Figure 11A ). Effect of temperature on mRNA integrity

[0233] Temperature can be an important factor in maintaining high integrity of mRNA produced by in vitro transcription. For example, the integrity of 10 kb mRNA produced by the aforementioned co-transcriptional capping method was tested using a bioanalyzer for 10 kb mRNA prepared at 31°C or 25°C. The integrity was analyzed using the smear analysis function of the software to obtain the main peak ratio. Figure 11C It was shown that for 10 kb mRNA, IVT conditions at 25°C for 3 hours produced 10 kb mRNA with 57% integrity, while in vitro transcription at 31°C for 3 hours produced mRNA with 6% integrity, as analyzed by bioanalyzer for main peak smear analysis. Figure 11D The results showed that although the mRNA yield at 31°C for 3 hours was higher than that at 25°C for 3 hours, the mRNA yield at 25°C for 4 hours was higher than that at 31°C for 4 hours. These results suggest that mRNA prepared at 25°C may have better integrity than mRNA prepared at 31°C. Effect of reaction time on mRNA integrity

[0234] In vitro transcription reaction time can be another important factor affecting mRNA integrity. Table 9 shows that for a 10 kb mRNA, when the IVT reaction was performed at 25°C, the integrity of the transcribed mRNA decreased from 57% after 3 hours of transcription to 52% at the 4-hour time point. When the IVT reaction was performed at 31°C, the mRNA integrity decreased from 90% after 1 hour of reaction to 6% after 1 hour of reaction. Table 9. Effect of IVT reaction time on 10Kb mRNA integrity 1 hour 2 hours 2.5 hours 3 hours 3.5 hours 4 hours 4.5 hours 25℃ 51% 53% 57% 57% 52% 52% 52% 31℃ 90% 6% 6% 6% 6% 6% 6% Example 6 mRNA purification

[0235] The mRNA obtained from Example 5 was further purified using silica membrane columns or magnetic beads. Briefly, in vitro transcribed mRNA was mixed with buffer and ethanol and added to a silica membrane column, followed by washing with 70% ethanol and elution with water or other storage buffer. The product from each purification method was tested for residual trimer caps using HPLC. The protein residues were assayed using the Nano Orange protein residue assay. Example 7 Transcription terminators reduce poly A tail length variation

[0236] The same GFP gene with different poly A segments (70nt, 100nt and 120nt) was connected to a pUC57 (no terminator) vector or a pUC57-terminator vector, wherein the rrnB-T1 terminator and rrnB-T2 terminator were located upstream of the T7 promoter and the λt0 terminator was located downstream of the poly A segment and cut by NheI-XhoI. The resulting plasmid was transformed into E. coli using standard methods and grown at 30°C. Ten clones were then randomly picked from the LB plate and Sanger sequencing was performed to verify the length of the poly A segment. The lengths of the poly A tails of these clones are shown in Table 10 and summarized in Table 10. Figure 13 middle. Table 10

[0237] Figure 13 It was shown that the variation in the length of the poly A tail produced by in vitro transcription using the pUC57-terminator vector was smaller than that produced by in vitro transcription using the pUC57 (no terminator) vector with different poly A segments (70 nt, 100 nt, and 120 nt). Example 8 Initiating IVT at the -1 position increases 5' end homogeneity of RNA products

[0238] To investigate the effect of initiating IVT at the -1 or +1 position of the DNA template on the 5'-end homogeneity of the RNA product, IVT reactions were performed in the presence of cap [I] using the DNA templates TAATACGACTCACTATAGGG (SEQ ID NO: 10) (IVT initiated at the -1 position from this DNA template) or TAATACGACTCACTATAAGG (SEQ ID NO: 12) (IVT initiated at the +1 position from this DNA template). RNA products were then reverse transcribed into cDNA using Illumina's NEBNext Single Cell / Low Input RNA Library Preparation Kit. DNA libraries were prepared using the NEB 7805 (FSDNA Library Preparation Kit with UMI), and alignments were generated using Geneuous Prime software.

[0239] Sequence alignment shows that the error rate (eg, 0.09%) of IVT starting from position -1 at the 5' end guanine (G) (indicated by an arrow) using the TAATACGACTCACTATAGGG (SEQ ID NO: 10) (TATA-GGG) template ( Figure 14) than the error rate (e.g., 0.19%) of IVT starting at the +1 position using the TAATACGACTCACTATAAGG (SEQ ID NO: 12) (TATA-AGG) template at the 5'-terminal guanine (G) (indicated by the arrow) ( Figure 15 In other words, 5' end sequence alignment from next generation sequencing (NGS) showed that IVT starting at the -1 position had more uniform 5' ends of RNA products than IVT starting at the +1 position. Example 9 RNA yield, purity, and capping efficiency under different IVT conditions Table 11

[0240] To identify IVT conditions that improve RNA yield, purity, and capping efficiency, IVT reactions were performed in conditions #1, #2, and #3 (Table 11). Condition #1 is also shown in Table 8 (Example 5). Table 12 Condition #1 Condition #2 Condition #3 Yield, ug / Ul IVT 9.9 3.7 4.4 purity,% 91% 67% 68% Capping efficiency 97.2% 88.0% 91.72%

[0241] Table 12 shows that the RNA yield, purity, and capping efficiency produced under condition #1 were better than those produced under conditions #2 and #3. In other words, using condition #1, the RNA in vitro transcription yield and final product purity were significantly improved. High purity may be critical for improving mRNA expression efficiency, such as Figure 5A 、 Figure 5B and Figure 6 The final mRNA size-based purity was measured by bioanalyzer capillary electrophoresis. Capping efficiency was determined using RNase H digestion followed by LC-MS analysis. Example 10 Assembling 5'UTR sequences for efficient mRNA expression

[0242] In eukaryotic cells, protein expression levels may be highly dependent on mRNA levels, which in turn may be controlled by transcription and translation mechanisms. In fact, the translation efficiency of transcripts may be particularly important for the efficiency and efficacy of mRNA therapeutics. In this context, the mRNA payload in gene therapy / vaccines can be optimized to enhance protein expression. mRNA generally contains the following elements, which include promoters (which may include enhancers), 5' untranslated regions (5'UTRs), protein coding regions, 3'UTRs, and polyadenylation (poly-A) signals. Among these elements, 5'UTR may be an attractive target for optimization. It has been shown that 5'UTR is critical for ribosome recruitment and can play a key role in regulating translation efficiency. Multiple regulatory elements within 5'UTR sequences can regulate gene expression. 5'UTR sequences with less complex mRNA structures and lower predicted minimum free energy may be associated with higher expression levels.

[0243] Rational design of 5'UTRs remains challenging due to difficulties in predicting RNA secondary structures and a lack of experimental data. Consequently, the efficacy of engineered 5'UTR sequences can deviate significantly from predictions.

[0244] Embodiments of the present disclosure may include collections of native and mutant 5'UTR sequences that exhibit enhanced protein translation efficiency compared to a reference sequence (e.g., 5'UTR-001 (SEQ ID NO: 70)) and can be used to produce high mRNA expression. Thus, the native or mutant 5'UTRs of the present disclosure that produce mRNA expression comparable to or superior to that of the reference sequence (e.g., 5'UTR-001) can be considered good candidates. While artificial design of 5'UTR sequences may produce promising candidates, modified 5'UTRs based on native sequences found in human genes may result in elements that are better recognized by the translation machinery in human cells.

[0245] For example, genes that are highly expressed in tissues and cells (such as hematopoietic cells and neuronal cells) can be selected. The 5'UTR sequences from the major transcript variants are then assembled into DNA templates for mRNA production, which are then expressed in cells for comparison with reference 5'UTR sequences. Those native 5'UTR sequences (full length or truncated) that result in improved protein expression are then selected for further modification (such as point mutations and / or deletions), and subsequently tested for their effects on mRNA expression. method 1. Sequence Selection and Criteria 1-1. Initial screening of natural sequences

[0246] For subset A of test sequences, literature searches identified genes known to be highly expressed in different tissues / cells, e.g., CD14 (primarily expressed by macrophages), CD19 (widely expressed in B cells), CD80 (primarily expressed in immune cells), MB (primarily expressed in skeletal and cardiac muscle), GMCSF (a cytokine secreted by immune and other cells), NeuN / RBFOX3 (a neuron-specific protein), and Enolase 2 (expressed at very high levels in neurons and neural tissues). The genomic and transcript sequence information for these genes was retrieved from NCBI. For each gene in this subset, the following criteria were set: (1) only the most common variant / isoform sequences were considered; (2) for 5'UTR sequences <106 bp in length, the entire sequence was included for subsequent testing; and (3) for those sequences >106 bp in length, only the first 106 bp of sequence were further tested.

[0247] For subset B of test sequences, a review of publicly available RNA-sequencing results identified genes highly expressed in neurons and astrocytes. Based on this review, 5'UTR sequences from the top 50 genes were selected. For each gene in this set, each unique transcript was considered, and similar criteria were used to assemble the final list of 5'UTR sequences for this study. 1-2. Mutant sequence

[0248] The sequences of the promising 5'UTR candidates obtained from the initial screening (Table 13) were used to generate mutant 5'UTR sequences for subsequent testing. In all instances, commercially available 5'UTR-001 (AAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGA) (SEQ ID NO: 70) was used as a reference sequence. For all experiments described below, the same KOZAK (e.g., GCCACC) and 3'UTR (HBA1) (TAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTT GGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTG AATAAAGTCTGAGTGGGCGGCA) (SEQ ID NO: 71) sequences were used to assemble the DNA templates. 2. IVT Template Assembly

[0249] For subset A, to generate the DNA template for IVT, PCR amplification was performed using the following: a plasmid encoding eGFP as a template, which also contained a 3'UTR sequence (HBA1) (SEQ ID NO: 71), a forward primer containing a T7 promoter (6.5), a separate 5'UTR sequence together with a strong KOZAK sequence, and a reverse primer containing poly A.

[0250] For subset B, a gene fragment encoding the following elements was first obtained: a T7 promoter (6.5), a separate 5'UTR sequence, a strong KOZAK sequence, an eGFP cDNA, and a 3'UTR sequence (HBA1) (SEQ ID NO: 71). To generate the final DNA template for IVT, PCR amplification was performed using a forward primer with the T7 promoter sequence (6.5) and a reverse primer containing poly A. 3. IVT and mRNA Expression

[0251] For IVT, use the above PCR product as a template. Produce and purify mRNA and transfect it into cells. Assess eGFP expression on a plate reader or flow cytometer. result Table 13. Natural 5'UTR sequences Table 14. Mutant 5'UTR sequences

[0252] Approximately 250 native 5'UTR sequences were screened. Table 13 is a list of native sequences that showed comparable or higher eGFP expression in different cell lines compared to the reference sequence (5'UTR-001) (SEQ ID NO: 70). Table 14 is a list of mutant 5'UTR sequences (SEQ ID NOs: 23-52) derived from promising native sequences that showed comparable or higher eGFP expression in different cell lines compared to the reference sequence (5'UTR-001) (SEQ ID NO: 70).

[0253] mRNA encoding eGFP and containing a native 5'UTR sequence (derived from a gene highly expressed in tissues / cells (e.g., immune cells, brain, muscle, adipose tissue, etc.)) was purified using a silica column and transfected into A549 cells seeded in 96-well plates at 200 ng / well. Figure 16A and Figure 16B ) or Jurkat cells ( Figure 16C ). After 24 hours, plate reader ( Figure 16A and Figure 16B ) or flow cytometry ( Figure 16C ) was used to measure eGFP fluorescence. The fold change in eGFP expression or mean fluorescence intensity is shown compared to cells expressing eGFP with a commercially available 5'UTR-001 reference sequence (SEQ ID NO: 70). These results demonstrate that the 5'UTRs disclosed herein perform better than the 5'UTR-001 reference sequence.

[0254] Figure 17A An example is shown in which purified mRNA encoding eGFP and containing a mutant 5'UTR sequence (Table 14) was transfected into A549 cells seeded in a 96-well plate at 100 ng / well. eGFP fluorescence was measured 24 hours later using a plate reader. As shown, the fold change in eGFP expression compared to cells expressing eGFP with a 5'UTR-001 reference sequence is plotted. Figure 17B In the assay, HeLa cells transfected with mRNA encoding eGFP (100 ng / well, which contained several mutant 5'UTR sequences, e.g., LIRF m3 (SEQ ID NO: 41), ENO2 m2 (SEQ ID NO: 32), and GMCSF m5 (SEQ ID NO: 39)) showed higher expression than HeLa cells transfected with mRNA having the reference sequence 5'UTR -001 (SEQ ID NO: 70).

[0255] Advantages of the present disclosure may include (1) in vitro transcription reaction mixtures and conditions that can increase the yield, integrity, and purity of mRNA, (2) DNA templates and cap analogs that bind to the -1 and / or +1 nucleotides of the promoter for in vitro transcription, thereby producing mRNA of longer complete length, allowing more flexible selection of the first mRNA base, and providing a +2 position open to customized sequences, and (3) 5'UTRs derived from natural and novel mutant 5'UTR sequences that exhibit high mRNA expression in specific tissues / cells can provide tissue-specific advantages over artificial sequences.

[0256] All references cited in this specification are incorporated herein by reference as if each reference were specifically and individually indicated to be incorporated herein by reference. Citation of any reference is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such reference by virtue of prior invention.

[0257] It will be understood that each of the above elements, or two or more of them, may also find useful application in other types of methods than those described above. Without further analysis, the foregoing will sufficiently reveal the gist of the present disclosure to enable others to readily adapt it to various applications by applying current knowledge, without omitting features that, from the perspective of the prior art, fairly constitute essential features of the general or specific aspects of the present disclosure as set forth in the appended claims. The foregoing embodiments are presented by way of example only; the scope of the present disclosure is limited only by the following claims.

Claims

1. A method for in vitro transcription of a DNA template into RNA, the method comprising Providing (1) a DNA template comprising a promoter operably linked to a nucleic acid comprising a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding the RNA, a 3'UTR, and a poly A region, and (2) A cap analog comprising the following structure wherein R1 and R2 are each CH3 or H; and B1 and B2 are each A, U, G or C, wherein the promoter comprises the sequence of TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), wherein A at position 17 is -1 nucleotide and X1 at position 18 is +1 nucleotide, When X1 is G, X2 and X3 are each A, T, G or C, then B1 is A and B2 is G, when X1 is C, X2 and X3 are each A, T, G or C, then B1 is A and B2 is C, and When X1 is T, X2 and X3 are each A, T, G or C, then B1 is A and B2 is U, wherein the cap analog binds to the -1 and +1 nucleotides of the promoter, and The DNA template and the cap analog are incubated in a reaction mixture, wherein the incubating comprises incubating the reaction mixture at from about 15° C. to about 35° C. for about 1 hour to about 12 hours, thereby producing the RNA.

2. The method of claim 1, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 10, 11, 13, and 14.

3. The method of claim 1 or 2, wherein the 5'UTR and the 3'UTR are SEQ ID NOs: 1 and 2, 1 and 4, 1 and 6, 3 and 2, 3 and 4, 3 and 6, 3 and 8, 5 and 2, 5 and 4, 5 and 6, 7 and 2, 7 and 4, 7 and 6, 7 and 8, 9 and 2, 9 and 4, 9 and 6, or 9 and 8, respectively.

4. The method of claim 3, wherein the 5'UTR and the 3'UTR are SEQ ID NOs: 1 and 2, 1 and 4, 3 and 2, 1 and 6, 7 and 4, 9 and 2, or 3 and 6, respectively.

5. The method of any one of claims 1 to 4, wherein the poly-A block comprises from about 60 to about 200 As.

6. The method of any one of claims 1 to 5, wherein the cap analog is selected from the group consisting of: m 7 , 7 , 2'Ome , 2'Ome , 2'Ome GpppApC, m 7 GpppApG, m 7 GpppApU, m 7 G 3'Ome pppApC, m 7 G 3'Ome pppApG, m 7 G 3'Ome pppApU, m 7 G 3' Ome pppA 2'Ome pC, m 7 G 3'Ome pppA 2'Ome pG, m 7 G 3'Ome pppA 2'Ome pU, m 7 GpppA 2'Ome pC, m 7 GpppA 2'Ome pG and m 7 GpppA 2'Ome pU.

7. The method of any one of claims 1 to 6, wherein the reaction mixture comprises a buffer substance at a concentration of from about 45 mM to about 55 mM, an RNase inhibitor at a concentration of from about 0.01 U / μl to about 0.03 U / μl, NTPs at a concentration of from about 3 mM to about 5 mM, a concentration of from about 6 mM to about 8 mM of said cap analog, one or more magnesium salts at a concentration of from about 20 mM to about 30 mM, a polyamine at a concentration of from about 1.5 mM to about 2.5 mM, the DNA template at a concentration of from about 0.01 μg / μl to about 0.05 μg / μl, pyrophosphatase at a concentration of from about 0.1 mU / μl to about 0.5 mU / μl, and The concentration is from about 0.01 μg / μl to about 0.05 μg / μl RNA polymerase.

8. The method of claim 7, wherein the RNA polymerase is selected from wild-type T7 RNA polymerase or a variant thereof.

9. The method of any one of claims 1-8, wherein the incubating comprises incubating the reaction mixture at from about 18°C to about 31°C.

10. The method of claim 9, wherein the incubating comprises incubating the reaction mixture at about 30°C for about 4 hours.

11. The method of any one of claims 1 to 10, wherein the DNA template further comprises at least one transcription terminator located upstream and / or downstream of the open reading frame (ORF).

12. The method of any one of claims 1-11, wherein X1 is G, X2 and X3 are each A, T, G or C, B1 is A, and B2 is G.

13. The method of any one of claims 1-11, wherein X1 is C, X2 and X3 are each A, T, G or C, B1 is A, and B2 is C.

14. The method of any one of claims 1-11, wherein X1 is T, X2 and X3 are each A, T, G, or C, B1 is A, and B2 is U.

15. The method of any one of claims 1-14, wherein the concentration of the cap analog is from about 0.5 mM to about 50 mM.

16. The method of claim 1, wherein incubating the reaction mixture is performed at about 25°C for from about 1 hour to about 5 hours.

17. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

10.

18. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

11.

19. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

13.

20. The method of claim 2, wherein the promoter comprises the sequence of SEQ ID NO:

14.

21. The method of claim 1, wherein the 5'UTR is selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, and 23-69.

22. The method of claim 21, wherein the 5'UTR is selected from SEQ ID NOs: 23-52.

23. The method of claim 21 or 22, wherein the 3'UTR is selected from SEQ ID NO: 2, 4, 6, 8 and 71.

24. A nucleic acid comprising, in the 5' to 3' direction, a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding RNA, and a 3'UTR, wherein the 5'UTR is selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, and 23-69.

25. The nucleic acid of claim 24, wherein the 5'UTR is selected from the group consisting of SEQ ID NOs: 23-52.

26. The nucleic acid of claim 24 or 25, wherein the 3'UTR is selected from SEQ ID NO: 2, 4, 6, 8 and 71.

27. A vector comprising the nucleic acid of any one of claims 24-26.

28. The vector of claim 27, further comprising a promoter.

29. The vector of claim 27 or 28, wherein the promoter is selected from the group consisting of SEQ ID NO: 10, 11, 13 and 14.

30. A nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23-52.

31. The nucleic acid of claim 30, wherein the nucleic acid is a 5'UTR or a 3'UTR.

Citation Information

Patent Citations

  • Improvement in snow-plows

    US165177A

  • Synthesis and use of anti-reverse mRNA cap analogues

    US7074596B2

  • Synthesis and use of anti-reverse phosphorothioate analogs of the messenger RNA cap

    US8153773B2

  • Dinucleotide MRNA cap analogs

    US8304529B2

  • mRNA cap analogs

    US8519110B2