Use of osdof3 protein or its coding gene in improving rice broad-spectrum disease resistance and regulating agronomic traits

By constructing OsDOF3 knockout mutants and overexpressing transgenic lines, the activity of OsDOF3 protein or the expression level of its encoding gene was regulated, which solved the problem of insufficient resistance to multiple diseases in rice, improved resistance and defense response, and affected agronomic traits.

CN120464674BActive Publication Date: 2026-03-20FUDAN UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510676264.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-24
Publication Date
2026-03-20
Estimated Expiration
2045-05-24

AI Technical Summary

Technical Problem

In the existing technology, DOF transcription factors have failed to effectively participate in the resistance regulation of various diseases in rice, resulting in insufficient resistance of rice to rice blast fungus, sheath blight fungus and bacterial blight fungus, which affects plant physiological metabolism and yield.

Method used

We constructed OsDOF3 knockout mutants and overexpression transgenic lines to regulate rice's resistance to three major diseases and its basic defense response, and to influence agronomic traits by controlling the activity of OsDOF3 protein or the expression level of its encoding gene.

Benefits of technology

It significantly improved rice's resistance to rice blast fungus, sheath blight fungus, and bacterial blight fungus, enhanced its basic defense response, and regulated rice agronomic traits such as plant height.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464674B_ABST
    Figure CN120464674B_ABST
Patent Text Reader

Abstract

The application belongs to the field of molecular biology, and particularly relates to application of OsDOF3 protein or its coding gene in improving broad-spectrum disease resistance and regulating agronomic traits of rice. The application constructs an OsDOF3 knockout mutant and overexpression transgenic line in a susceptible rice background, and through inoculation of various pathogenic bacteria (including Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae), resistance phenotype analysis is carried out, and it is confirmed that OsDOF3 participates in regulating the immune response pathway of rice to fungal diseases (rice blast and sheath blight) and bacterial diseases (white leaf blight). Meanwhile, it is found that after being driven by a strong promoter ubi, the overexpression material of OsDOF3 is shorter than the wild type plant, and OsDOF3 affects the normal growth and development of rice while triggering the immune response of the plant. The application provides important gene resources and molecular theoretical basis for developing new varieties of broad-spectrum disease-resistant rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of molecular biology, specifically relating to the application of OsDOF3 protein or its encoding gene in improving broad-spectrum disease resistance in rice and regulating agronomic traits. Background Technology

[0002] During the growth and development of rice (Oryza sativa L.), fungal diseases and bacterial pathogen infections caused by pathogens such as Magnaphaltheoryzae, Xanthomonas oryzae pv. oryzae, and Rhizoctonia solani constitute the main biological stress factors, leading to physiological metabolic disorders, reduced photosynthetic efficiency, and significant decline in yield traits. To address this key scientific issue, this study systematically identifies core genetic loci possessing multi-pathogen resistance, deeply analyzes their mediating immune synergistic interactions, and elucidates the molecular regulatory network of transcriptional reprogramming and systemically acquired resistance in the immune signal transduction network. This will provide a theoretical framework for establishing a molecular module-based rice disease-resistant design breeding system and has significant scientific value for improving the theory of immune regulation in monocotyledonous model crops.

[0003] Members of the DOF transcription factor family perform multi-level biological functions throughout the plant's life cycle. These functions include, but are not limited to, the dynamic balance of GA / ABA signaling during seed germination, vascular tissue morphogenesis and establishment of leaf dorsal and ventral polarity, activation of floral organ meristems and regulation of pollen fertility, and photoperiod-regulated determination of flowering time. They also participate in the dynamic balance of carbon and nitrogen assimilation pathways, the regulation of biosynthesis of phenylpropane and terpenoid secondary metabolites, and respond to abiotic / biotic stresses through ROS signaling pathways and hormone cross-talk mechanisms. DOF transcription factors play an important role in seed filling in rice, a gramineous crop; however, there are no reports of DOF transcription factors participating in resistance to multiple diseases, i.e., DOF transcription factor-mediated broad-spectrum disease resistance.

[0004] Different pathogens (such as rice blast fungus, rice sheath blight fungus, and rice bacterial blight fungus) have evolved highly specific pathogenic strategies to disrupt the rice's immune system in order to successfully infect rice. Therefore, identifying genes with broad-spectrum disease resistance is of great significance for rice to resist infection by complex and ever-changing pathogens. Summary of the Invention

[0005] To address the aforementioned problems, this application constructed OsDOF3 knockout mutants and overexpression transgenic lines in susceptible rice. Resistance phenotypic analysis using inoculation with various pathogens (including rice blast fungus, rice sheath blight fungus, and bacterial blight fungus) revealed that OsDOF3 significantly affects rice resistance to these three major diseases. Furthermore, it was found that while stimulating plant immune responses, OsDOF3 also affects normal rice growth and development.

[0006] On the one hand, this application provides the application of the OsDOF3 protein or its encoding gene as a target, wherein the application is any one of the following:

[0007] a) Application in regulating plant resistance to rice blast fungus, sheath blight fungus and bacterial blight fungus;

[0008] b) Application in screening substances that can regulate plant resistance to rice blast, sheath blight and bacterial blight;

[0009] c) Application in regulating the basic defense response of plants;

[0010] d) Application in screening substances that can regulate the basic defense response of plants;

[0011] e) Application in regulating plant agronomic traits.

[0012] In some embodiments, in application a), the activity of the OsDOF3 protein or the expression level of its encoding gene is upregulated, thereby upregulating the plant's resistance to rice blast fungus, sheath blight fungus and bacterial blight fungus; and the activity of the OsDOF3 protein or the expression level of its encoding gene is downregulated, thereby downregulating the plant's resistance to rice blast fungus, sheath blight fungus and bacterial blight fungus.

[0013] In this application, rice blast resistance specifically refers to rice's ability to defend against infection by the pathogenic fungus *Magnaporthe oryzae*. This disease is infectious throughout the entire growth cycle and can damage organs and tissues such as leaves, stems, and panicles. Typical symptoms include: spindle-shaped lesions with a grayish-white center and brown edges on leaves; panicle infection leads to impaired grain development and, in severe cases, total crop failure. This disease typically causes 10%-30% yield loss, but in extreme cases, it can reach 40%-50%. Some rice varieties carry susceptibility genes such as ROD1, which can suppress the immune response; while resistant varieties are less susceptible to infection due to the lack of corresponding susceptibility genes.

[0014] In this application, resistance to rice sheath blight refers to the rice's ability to resist the pathogenicity of Rhizoctonia solani. This disease begins to appear during the tillering stage of rice, with typical symptoms including: initially, small, dark green, water-soaked spots appear on the leaf sheaths near the water surface, which expand into elliptical, mottled spots as the disease progresses, characterized by brown edges and a light brown to grayish-white center. Severe infections result in large, irregular lesions that can extend to the leaves and stems, leading to premature leaf senescence, lodging, and ultimately yield losses such as reduced seed setting rate and decreased grain plumpness.

[0015] In this application, bacterial blight resistance specifically refers to the defense mechanism of rice against the pathogenicity of Xanthomonas oryzaepv. oryzae (Xoo). Bacterial blight of rice caused by this Gram-negative bacterium is a highly destructive bacterial disease. Its resistance genetic characteristics are controlled by a single gene or a few major genes; for example, the rice Xa23 gene is a typical major gene for bacterial blight resistance. Bacterial blight can occur at any stage of rice growth, primarily affecting the leaves and leaf sheaths. Initially, small, translucent yellow spots appear on the edges of the rice leaves. These spots then spread along one or both sides of the leaf margin, or along the midrib, becoming wavy yellow-green or gray-green lesions. After several days, the lesions turn grayish-white and curl inwards, spreading rapidly through the air via wind, rain, insects, or other means, eventually infecting the entire rice field. From a distance, the field appears withered and dry, hence the name bacterial blight.

[0016] In some embodiments, in application c), the activity of the OsDOF3 protein or the expression level of its encoding gene is upregulated to enhance the plant's basic defense response; the activity of the OsDOF3 protein or the expression level of its encoding gene is downregulated to weaken the plant's basic defense response.

[0017] In some embodiments, in application e), upregulating the activity of the OsDOF3 protein or the expression level of its encoding gene significantly reduces plant height.

[0018] In some embodiments, the amino acid sequence of the OsDOF3 protein is any one of the following (1)-(3):

[0019] (1) A protein composed of the amino acids shown in SEQ ID NO.1;

[0020] (2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid shown in SEQ ID NO.1;

[0021] (3) A protein or its derivative that has at least 95% sequence identity and has the same function as (1) and is derived from other varieties of rice or other species;

[0022] The nucleotide sequence of the gene encoding the OsDOF3 protein is shown in any of the following (4)-(6):

[0023] (4) A DNA molecule whose coding region is the sequence shown in SEQ ID NO.2;

[0024] (5) A DNA molecule that hybridizes to the DNA sequence defined in (4) under strict conditions and encodes a protein with the same function; (6) A DNA molecule that has at least 95% sequence identity with the DNA sequence defined in (4) and encodes a protein with the same function.

[0025] On the other hand, this application also provides the application of substances capable of upregulating or downregulating the activity of the OsDOF3 protein or the expression level of its encoding gene in regulating plant resistance to rice blast fungus, sheath blight fungus and bacterial blight fungus, in regulating the basic defense response of plants, and / or in regulating plant agronomic traits.

[0026] In some embodiments, the substance capable of upregulating the activity of the OsDOF3 protein or the expression level of its encoding gene includes a nucleic acid construct containing the OsDOF3 encoding gene.

[0027] In some embodiments, the substance capable of downregulating the activity of the OsDOF3 protein or the expression level of its encoding gene includes nucleic acids that specifically interfere with the transcription and expression of the OsDOF3 gene, preferably dsRNA, antisense nucleic acid, small interfering RNA, microRNA, shRNA, reRNA, sgRNA, and more preferably sgRNA.

[0028] In some embodiments, the sequence of the sgRNA is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0029] In some embodiments, the amino acid sequence of the OsDOF3 protein is as described above, and the nucleotide sequence of the gene encoding the OsDOF3 protein is as described above.

[0030] On the other hand, this application also provides a method for improving plant resistance to rice blast fungus, sheath blight fungus and bacterial blight fungus, enhancing the plant's basic defense response, and improving plant agronomic traits by introducing the substance into the plant cells or tissues.

[0031] In this application, the plant may be a grass, such as rice.

[0032] Compared to existing technologies, this application constructed OsDOF3 knockout mutants and overexpressing transgenic lines in susceptible rice. The experiments, conducted using field planting methods, systematically compared the differences in disease resistance among the transgenic materials, confirming that OsDOF3 participates in regulating the immune response pathways of rice against fungal diseases (rice blast, sheath blight) and bacterial diseases (bacterial leaf blight). Furthermore, this application also found that using the strong promoter ubi significantly reduced the plant height of OsDOF3-overexpressing materials compared to wild-type plants, indicating that OsDOF3 affects normal rice growth and development while stimulating plant immune responses. This application provides important genetic resources and a molecular theoretical basis for developing broad-spectrum disease-resistant rice varieties. Attached Figure Description

[0033] Figure 1 The images show the structural diagrams of the recombinant plasmids that overexpress the OsDOF3 gene; where A is the diagram of plasmid pUN1301-OsDOF3-Flag; and B is the diagram of plasmid pUN1301-OsDOF3-GFP.

[0034] Figure 2 Genotyping results of OsDOF3 knockout materials and protein level identification results of OsDOF3 overexpression materials.

[0035] Figure 3 A shows fluorescence of OsDOF3 localized in the nucleus of rice cells; A is a transiently infected tobacco cell, revealing that OsDOF3 has nuclear localization, with the previously reported nuclear marker gene OsNLS connected to the red fluorescent tag Mcherry as an indicator, scale bar 10 μm; B is a root cell of the stable transgenic material pUN1301-OsDOF3-GFP, revealing that OsDOF3 has nuclear localization.

[0036] Figure 4 This figure shows the results of OsDOF3 positively regulating rice resistance to rice blast fungus. In Figure A, OsDOF3 positively regulates rice resistance to rice blast fungus. This was achieved by inoculating OsDOF3 knockout lines, overexpressing lines, and wild-type TP309 with rice blast fungus in vitro, and statistically analyzing disease incidence 7-10 days after inoculation. Figure B shows the disease incidence as reflected by measuring the length of lesion expansion. All measured data are presented using scatter plots. Data analysis employed a two-tailed t-test, with asterisks indicating significant differences (**P<0.01, *P<0.05).

[0037] Figure 5This figure shows the results of OsDOF3 positively regulating rice resistance to sheath blight. In Figure A, OsDOF3 positively regulates rice resistance to sheath blight; OsDOF3 knockout lines and wild-type TP309 were inoculated with sheath blight, and disease incidence was recorded seven days after inoculation. In Figure B, disease incidence was reflected by measuring the length of lesion expansion. All data are represented and presented using scatter plots. Data analysis employed a two-tailed t-test, with asterisks indicating significant differences (**P<0.01, *P<0.05).

[0038] Figure 6 Figure A shows the results of OsDOF3 positively regulating rice resistance to bacterial blight. A represents the positive regulation of rice resistance to bacterial blight by OsDOF3. This was achieved by inoculating OsDOF3 knockout lines, overexpression lines, and wild-type TP309 with bacterial blight race PXO99A. Fourteen days later, disease incidence was statistically analyzed, and representative photos of diseased leaves with lengths near the average were selected. Figure B shows the statistical analysis of bacterial blight incidence. Disease incidence was characterized by measuring the length of lesions extending downwards from the incision site. All measurements were represented by points. Data analysis used a two-tailed t-test, with asterisks indicating significant differences (**P<0.01, *P<0.05).

[0039] Figure 7 OsDOF3 negatively regulates agronomic traits such as plant height and plant type in rice. Morphological images of wild-type TP309, OsDOF3 knockout plants, and OsDOF3 overexpressing plants grown in the field. Overexpression of OsDOF3 results in shorter rice plants. Detailed Implementation

[0040] The present application will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that: unless otherwise specified in the following embodiments, the conditions are carried out according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following embodiments can be obtained from commercially available sources.

[0041] Experimental materials

[0042] The wild type of the Japonica rice variety TP309 (TP309) is identified by the following pathogens: rice blast fungus (M. oryzae): TH12; Rhizoctonia solani Kühn: highly pathogenic strain RH-9; and Xanthomonas oryzae pv. Oryzae, Xoo: PXO99A.

[0043] Example 1: Construction of OsDOF3 gene knockout / overexpression plasmid

[0044] 1. OsDOF3 gene and protein structure composition

[0045] The rice OsDOF3 gene has NCBI accession number LOC4328903, with a full-length transcribed sequence of 1122 bp, including a 1122 bp CDS coding region, as shown in SEQ ID NO.2. This gene encodes 373 amino acids. The OsDOF3 protein sequence has NCBI number XP_015623741.1, and its amino acid sequence is shown in SEQ ID NO.1.

[0046] 2. Construction of rice OsDOF3 gene knockout plasmid

[0047] Knockout target sites for OsDOF3 were designed based on the genomic DNA sequence, and conserved regions cggcgcattatccccggtgg (SEQ ID NO.3) and gtgccgccgctactggaccc (SEQ ID NO.4) were selected as target sites. Primers OsDOF3-KO-1T-F: 5'-GCCGcggcgcattatccccggtgg-3' (SEQ ID NO.5), OsDOF3-KO-1T-R: 5'-AAACccaccggggataatgcgccg-3' (SEQ ID NO.6), OsDOF3-KO-2T-F: 5'-GGCAgtgccgccgctactggaccc-3' (SEQ ID NO.7), and OsDOF3-KO-2T-R: 5'-AAACgggtccagtagcggcggcac-3' (SEQ ID NO.4) were used. NO.8) The double-stranded DNA sequence was chemically synthesized, and then assembled into the U3 and U6a promoters by enzyme digestion, ligation and PCR. Subsequently, it was assembled into the binary vector pYLCRISPR / Cas9 by Golden Gate and Gibson Assembly cloning methods to obtain the rice OsDOF3 gene knockout recombinant plasmid pYLCRISPR / Cas9-OsDOF3, which was used to transform TP309 plants to obtain OsDOF3 knockout material.

[0048] 3. Construction of rice OsDOF3 gene expression vector

[0049] 3.1 Amplification of the target sequence: Using genomic cDNA as a template, high-fidelity DNA polymerase KOD FX was used for amplification.

[0050] The target fragment OsDOF3 was amplified using (TOYOBO, Cat#KFX-101), and the PCR system is shown in Table 1.

[0051] Table 1. PCR system for amplifying the target fragment OsDOF3

[0052] reagents volume template cDNA 1 μL (approximately 200 ng) 2×KOD FX buffer 25μL dNTP Mix (2mM) 5μL Primer F (10μM) 2μL Primer R (10μM) 2μL KOD-FX 1μL <![CDATA[ddH2O]]> Make up to 50 μL

[0053] PCR reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 68℃ extension at 1 kb / min, approximately 35 cycles; 68℃ extension for 10 min; 16℃ for 1 min. Primers used for the PCR reaction are shown in Table 2. The PCR products were purified by agarose gel electrophoresis and used for subsequent expression vector preparation.

[0054] Table 2 Primer sequences used for amplifying the target fragment

[0055]

[0056] 3.2 Enzyme digestion and ligation

[0057] The enzyme digestion systems of pUN1301-GFP and pUN1301-Flag plasmids are shown in Table 3.

[0058] Table 3 Plasmid digestion system

[0059]

[0060]

[0061] After gently mixing and briefly centrifuging, incubate in a 37°C water bath for 30-60 minutes.

[0062] Next, the enzyme digestion fragments were recovered and their concentrations were determined, according to... The IIOne Step Cloning Kit (Vazyme, Cat#C112-02) instructions state that the recombination reaction should be performed in 20 μL volumes as shown in Table 4, and the mixture should be kept at 37°C for 30 min.

[0063] Table 4 Plasmid Recombination Reaction System

[0064] reagents volume 5×CE II Buffer 4μL Exnase II 2μL gene fragments 20~200ng Linearized carrier 50~200ng <![CDATA[ddH2O]]> Make up to 20 μL

[0065] The map of the recombinant plasmid pUN1301-OsDOF3-Flag is as follows: Figure 1 As shown in Figure A, the spectrum of the recombinant plasmid pUN1301-OsDOF3-GFP is as follows. Figure 1 As shown in B.

[0066] Example 2: Obtaining gene-edited / overexpression rice lines

[0067] 1. Induction of callus tissue in mature rice embryos

[0068] 1) Use a threshing machine to remove the husks from the rice seeds, and manually screen and discard any moldy or deformed seeds.

[0069] 2) Add a small amount of 75% ethanol, shake by hand for about 30 seconds, and rinse once with sterile water.

[0070] 3) Add 25-30% (v / v) antifomin solution and shake on a shaker at 200 rpm for 30 minutes.

[0071] 4) Rinse with sterile water 5-6 times, 5-10 minutes each time.

[0072] 5) Place the seeds on sterile filter paper to absorb the moisture on the seed surface, and use sterile tweezers to sow the seeds on NBD medium to induce callus.

[0073] NBD rice screening medium (1L): NB Basal Medium (PhytoTech) 4.1g, sucrose 30g, glutamine 0.5g, proline 0.5g, hydrolyzed casein 0.5g, 1mL 2,4-D solution (1mg / mL), pH 5.8, and solids require the addition of 4.5g / L plant gel.

[0074] 6) After culturing in the dark for about 14 days, remove the endosperm, plumule, and radicle. The resulting callus can be used for transgenic and subculture. Subculture is performed every two weeks, and the number of subcultures depends on the state of the callus.

[0075] 2. Preparation of Agrobacterium-mediated transformation broth

[0076] 1) The constructed plasmids (recombinant plasmid pYLCRISPR / Cas9-OsDOF3, recombinant plasmid pUN1301-OsDOF3-Flag, and recombinant plasmid pUN1301-OsDOF3-GFP) were chemically transformed into EHA105 competent cells and cultured at 28°C for two days.

[0077] 2) Select a single clone and place it in 5 mL of LB liquid medium containing the corresponding antibiotic for culture. Incubate at 28°C with shaking for 48 h.

[0078] 3) Take 1 mL of the overnight culture and transfer it to 15 mL of AB (20 mg / L Rif + 50 mg / L Kan + 100 mg / LAS) liquid medium. Incubate at 28°C until OD600 = 0.5 (about 4 h). AB liquid medium (1 L): KH2PO4 3 g, NaH2PO4 1 g, NH4Cl 1 g, MgSO4·7H2O 300 mg, KCl 150 mg, CaCl2 10 mg, FeSO4·7H2O 2.5 mg, glucose 5 g.

[0079] 3. Co-culture of rice callus with Agrobacterium tumefaciens culture

[0080] 1) Centrifuge the bacterial culture at 4000 rpm for 10 min and discard the supernatant.

[0081] 2) Resuspend the bacterial cells in AAM containing 100 mg / L AS until the bacterial OD600 reaches 0.4-0.6.

[0082] 3) Co-culture the bacterial solution with rice callus for 20 minutes, shaking occasionally.

[0083] 4. Filtering

[0084] Blot the callus tissue dry with sterile filter paper and transfer it to a selection medium containing hygromycin and carbenicillin to screen for resistant callus tissue. Change the medium every two weeks.

[0085] Screening media: S1: 100 mg / L carbenicillin + 30 mg / L hygromycin, S2: 100 mg / L carbenicillin + 40 mg / L hygromycin, S3: 100 mg / L carbenicillin + 50 mg / L hygromycin.

[0086] 5. Differentiation

[0087] Selected rice callus tissues were transferred to rice differentiation medium and cultured under light. The medium was changed every two weeks until the callus differentiated into seedlings.

[0088] MS rice differentiation medium (1L): M&S BASAL MEDIUM w / VITAMINS (PhytoTech) 4.43g, sucrose 30g, 6-BA 3mg / L, NAA 0.5mg / L, pH 6.3, solids require the addition of 4.5g / L plant gel.

[0089] 6. Rooting

[0090] Transfer the seedlings from the differentiation medium to the rooting medium. After about 2 weeks of growth, remove the seedlings, wash off the agar medium, and culture them in water for 7 days before transplanting them into the soil.

[0091] 1 / 2MS rice rooting medium (1L): M&S BASAL MEDIUM w / VITAMINS (PhytoTech) 2.165g, sucrose 20g, pH 6.3, solids require the addition of 4.5g / L plant gel.

[0092] 1. PCR identification

[0093] Genomic DNA was extracted from the leaves of the regenerated plants, and PCR amplification was performed on the regenerated plants using the primers shown in Table 5. The amplified products were then sequenced.

[0094] Table 5 Primers for identifying regenerated rice plants

[0095]

[0096]

[0097] Based on the above identification, two mutant plants were screened from the regenerated plants and named CR-Osdof3#1 and CR-Osdof3#2, respectively. Sequencing analysis showed that, compared with the wild-type TP309 genomic DNA, [the following characteristics were observed]. Figure 2 As shown in Figure A, plant CR-Osdof3#1 has a deletion of a nucleic acid sequence in the gene encoding the OsDOF3 protein, while plant CR-Osdof3#2 has an insertion of one base A in the gene encoding the OsDOF3 protein. Simultaneously, overexpression materials of OsDOF3 driven by the strong promoter Ubiquitin, Ubi::OsDOF3-FLAG#1-#6, were obtained, as shown... Figure 2 As shown in Figure B, Western blotting revealed that Ubi::OsDOF3-FLAG#1-#6 were highly expressed.

[0098] Example 3: OsDOF3 is located in the nucleus of rice cells.

[0099] 1) The CDS sequence of the OsDOF3 protein was amplified and constructed into the 1301-GFP vector. After successful sequencing, the plasmid was transformed into Agrobacterium GV3101, shaken, and preserved.

[0100] 2) After centrifugation to collect the bacteria, resuspend the bacteria in a conversion solution containing 10 mmol / L MgCl2, 10 mmol / L MES (pH 5.6) and 150 μmol / L acetylsylgenone, and let it stand in the dark for 3 hours.

[0101] 3) Select tobacco materials with a growth cycle of 3 to 4 weeks, select healthy young leaves, and use a syringe with the needle removed to inject the mixed Agrobacterium transformation solution into the leaf tissue from the back of the tobacco leaf. After growing in the dark for several hours, culture under normal light conditions.

[0102] 4) After culturing for 32 hours, take leaves and observe the fluorescence of Confocal.

[0103] like Figure 3 As shown, OsDOF3 is located within the rice cell nucleus. In Figure A, transient transformation of tobacco reveals that OsDOF3 has nuclear localization. A GFP tag was fused to the gene terminal, and tobacco leaves were transiently transformed. Fluorescence distribution was observed 32 hours later. The previously reported nuclear marker gene OsNLS was tagged with the red fluorescent tag Mcherry as an indicator. Scale bar: 10 μm. Figure B shows observation of the root tips of stable transgenic rice materials, revealing that OsDOF3 has nuclear localization in rice cells.

[0104] Example 4: OsDOF3 positively regulates rice resistance to rice blast fungus.

[0105] 1) Field-harvested seeds are dried in a 42℃ oven for 4-7 days and then exposed to sunlight for a week. They are then soaked in water at room temperature for 24 hours, after which the soaking water is discarded. The seeds are rinsed three times with clean water, and then spread on damp paper towels to retain moisture. The seeds will germinate after 2 days at room temperature. When the seed buds reach about 0.5cm in length, they can be planted in greenhouse soil or in hydroponic containers. The rice cultivation environment is 28℃ with 12 hours of light and 12 hours of darkness.

[0106] 2) Activate rice blast fungus race TH12 using CM medium. Place a filter paper disc containing the rice blast fungus in the center of the CM solid medium. Incubate at 28℃ for 7-10 days to produce conidia (12 days of light / 12 days of darkness). Once the surface of the CM medium is covered with mycelium, wash off the spores with purified water containing 0.02% Tween 20, filter through double-layer gauze, and prepare a spore suspension. The spore concentration used for inoculation is 5 × 10⁻⁶. 5 The spores per ml averaged 30-50 per field of view under a 10×10x microscope.

[0107] 3) In vitro inoculation of OsDOF3 knockout lines, overexpression lines, and wild-type TP309 with rice blast fungus was carried out. The disease incidence was investigated 7-10 days after inoculation. The disease incidence and size of the lesions were recorded by statistically analyzing the length of the lesions and calculating the amount of fungal growth on the leaves.

[0108] The results are as follows Figure 4 As shown, the length of rice blast lesions on leaves of the knockout lines CR-Osdof3#1 and CR-Osdof3#2 was significantly increased compared to the wild-type TP309; while the length of rice blast lesions on leaves of the overexpressing lines Ubi::OsDOF3-FLAG#1-#2 was significantly decreased compared to the wild-type TP309. Therefore, this demonstrates that OsDOF3 positively regulates rice resistance to the fungal disease rice blast fungus.

[0109] Example 5: OsDOF3 positively regulates rice resistance to sheath blight pathogen.

[0110] 1) Take the sclerotia of the blight pathogen preserved in the laboratory and grow them on PDA solid medium at 28°C. PDA medium (1L): 200g of potato (cut into small pieces and boiled in water until the potato pieces are soft and mushy, filtered through four layers of gauze), 20g of glucose, and 15g / L agar powder added to the solid medium.

[0111] 2) Once the sclerotia have grown new hyphae, cut off the well-grown and uncontaminated hyphae with a sterile blade and place them on a new PDA medium for further cultivation.

[0112] 3) Repeat step 2 until there are no other microbial contaminations on the culture medium, and continue culturing for 2-3 days until sclerotia are produced.

[0113] 4) Cut the toothpicks into small pieces of about 2cm and sterilize them.

[0114] 5) Remove the sclerotia and place them on PDA medium. After culturing for 1-2 days, spread them on sterilized toothpicks and continue to grow for 2-3 days. When the mycelium has covered the toothpicks, they can be used to inoculate the sheath blight pathogen.

[0115] 6) Rice can be inoculated with sheath blight pathogen from about 2 months into its growth until before the booting stage. When inoculating, use tweezers to remove a toothpick and insert it into the second and third leaf sheaths from the bottom of the rice plant.

[0116] 7) The incidence of sheath blight can be observed 7 days after inoculation.

[0117] The results are as follows Figure 5 As shown, the length of leaf sheath lesions in the knockout lines CR-Osdof3#1 and CR-Osdof3#2 was significantly increased compared to the wild-type TP309, while the length of leaf sheath lesions in the overexpression lines Ubi::OsDOF3-FLAG#1-#2 was significantly decreased compared to the wild-type TP309, demonstrating that OsDOF3 positively regulates the resistance of rice to the fungal disease sheath blight.

[0118] Example 6: OsDOF3 positively regulates rice resistance to bacterial blight.

[0119] 1) Take the Xoo strain preserved in the laboratory, activate it 2-3 times on a PSA plate, and incubate it at 28℃ for 48-72 hours.

[0120] 2) After a single colony has grown, pick a single colony and transfer it to PSA liquid medium and shake gently for 1-2 days.

[0121] 3) Pipette 100 μl of bacterial culture onto a PSA plate, spread it evenly with a clean spreader, invert the plate and incubate at 28°C for 48-72 h. The resulting bacterial blight pathogen can be used for rice inoculation.

[0122] 4) Scrape the white leaf blight that has grown on the PSA medium with sterile water and dilute it to an OD value of 1.0.

[0123] 5) Dip scissors in the bacterial solution and cut the tip of the rice leaf at an angle 1-2 cm downwards.

[0124] 6) Measure the length of the leaf lesions 12-14 days after inoculation.

[0125] The results are as follows Figure 6As shown, the leaf lesion length of the knockout lines CR-Osdof3#1 and CR-Osdof3#2 was significantly increased compared to the wild-type TP309, while the leaf lesion length of the overexpression line Ubi::OsDOF3-FLAG#1-#2 was significantly decreased compared to the wild-type TP309. Therefore, it is demonstrated that OsDOF3 positively regulates the resistance of rice to the bacterial disease Bacillus thuringiensis.

[0126] Example 7: Observation on the negative regulation of rice agronomic traits by OsDOF3. The effects of OsDOF3 on rice agronomic traits were observed, such as... Figure 7 As shown, the overexpression lines Ubi::OsDOF3-FLAG#1-#2 of OsDOF3 were significantly shorter than the wild-type lines, indicating that OsDOF3 affects the normal growth and development of rice while stimulating the plant's immune response.

[0127] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. The application of OsDOF3 protein or its encoding gene as a target, characterized in that, The application is any of the following: a) Upregulate the activity of the OsDOF3 protein or the expression level of its encoding gene, thereby improving the resistance of rice to rice blast fungus, sheath blight fungus and bacterial blight fungus; b) Application of downregulating the activity of the OsDOF3 protein or the expression level of its encoding gene in screening for substances that can improve rice resistance to rice blast, sheath blight and bacterial blight; c) Upregulation of the OsDOF3 protein activity or the expression level of its encoding gene significantly reduced rice plant height; The amino acid sequence of the OsDOF3 protein is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

2. The application of substances capable of upregulating the activity of the OsDOF3 protein or the expression level of its encoding gene in improving the resistance of rice to rice blast fungus, sheath blight fungus, and bacterial blight fungus, and / or in reducing rice plant height, characterized in that, The substance capable of upregulating the activity of the OsDOF3 protein or the expression level of its encoding gene includes a nucleic acid construct containing the OsDOF3 encoding gene, wherein the amino acid sequence of the OsDOF3 protein is shown in SEQ ID NO.1 and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

3. The application of substances capable of downregulating the activity of the OsDOF3 protein or the expression level of its encoding gene in screening for substances that can improve rice resistance to rice blast, sheath blight, and bacterial blight, characterized in that... The substance capable of downregulating the activity of the OsDOF3 protein or the expression level of its encoding gene includes nucleic acids that specifically interfere with the transcription and expression of the OsDOF3 gene, wherein the nucleic acid is selected from dsRNA, antisense nucleic acid, small interfering RNA, microRNA, shRNA, reRNA, and sgRNA; the amino acid sequence of the OsDOF3 protein is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

4. A method for improving the resistance of rice to rice blast fungus, rice sheath blight fungus, and rice bacterial blight fungus, and / or reducing rice plant height, characterized in that, The substance described in claim 2 is introduced into the rice cells or tissues.

Citation Information

Patent Citations

  • Dof (dna binding with one finger) sequences and methods of use

    CN102174085A

  • Plants having enhanced yield-related traits and a method for making the same

    CN102459614A