Stable transfection cell model for detecting chicken pox-herpes zoster virus neutralizing antibody and application of stable transfection cell model

By constructing a stable cell model based on gradual truncation of promoters in the detection of varicella-zoster virus neutralizing antibodies, the time-consuming and labor-intensive problem of traditional methods is solved, and the effect of rapid detection and efficient evaluation of neutralizing antibodies is achieved.

CN120464684APending Publication Date: 2025-08-12BEIJING INSTITUTE OF PETROCHEMICAL TECHNOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510613838.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-08-12

AI Technical Summary

Technical Problem

Traditional plaque reduction assays are labor-intensive and time-consuming to screen and evaluate candidate compounds, and because varicella-zoster viruses grow slowly in tissue culture, it is difficult to quickly detect neutralizing antibody levels.

Method used

By gradually truncating the promoter, the upstream transcription element (USF) gene sequence was repeated 2-4 times, and followed by the RFP reporter gene, the PLVX-D/T/Q9G-RFP lentiviral steady-transfer plasmid was constructed for infection of Vero cells, screening and evaluating neutralizing antibodies.

Benefits of technology

It has achieved rapid detection of neutralizing antibody levels, which can efficiently evaluate the production of neutralizing antibodies of VZV vaccines and the effect of screening drugs on neutralizing antibodies, and provides a high titer stable cell model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464684A_ABST
    Figure CN120464684A_ABST
Patent Text Reader

Abstract

The invention discloses a Vero cell model based on VZV neutralizing antibody detection. The lentivirus is used for stably transfecting Vero cells to obtain a cell strain capable of recognizing the VZV virus, and meanwhile, an RFP reporter gene is carried, so that the condition of a neutralizing antibody in serum is conveniently detected. According to the construction method of the stably transfected cell strain for detecting the chicken pox-herpes zoster virus neutralizing antibody, the high-titer stably transfected cell strain for detecting the chicken pox-herpes zoster virus neutralizing antibody is obtained; the stably transfected cell strain for detecting the chicken pox-herpes zoster virus neutralizing antibody can be prepared into a stably transfected cell model for detecting the chicken pox-herpes zoster virus neutralizing antibody, and the cell model can be used for evaluating the influence of a VZV vaccine (chicken pox-herpes zoster virus vaccine) and related drugs on the neutralizing antibody. And the value of the neutralizing antibody in the serum is objectively and quantitatively detected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to a stably transfected cell model for detecting varicella-zoster virus neutralizing antibodies and an application thereof. Background Art

[0002] Herpes zoster is an acute infectious skin disease caused by the reactivation of the varicella-zoster virus (VZV). Initial VZV infection typically occurs in childhood, resulting in either chickenpox or an asymptomatic latent infection. Due to its neurotropic properties, VZV remains latent within the dorsal root ganglia of the spinal cord or the sensory ganglia of the cranial nerves. When patients experience fatigue, anxiety, or a weakened immune system, the virus reactivates and replicates, triggering herpes zoster, which typically lasts 2-3 weeks. Traditional plaque reduction assays are commonly used to screen and evaluate candidate compounds, but this method is laborious and time-consuming due to the slow growth of VZV in tissue culture. Summary of the Invention

[0003] The present invention aims to provide a method for constructing a stably transfected cell line for varicella-zoster virus neutralizing antibody detection, which is based on gradually truncating the promoter and positioning it as a 93bp long sequence. In cells infected and transfected with ie62, the relative promoter activity patterns between these constructs are similar. Introducing a 2-bp substitution in the upstream transcription element (USF) gene sequence reduces promoter activity. The upstream transcription element (USF) gene sequence is repeated 2-4 times, and then D9G, T9G, and Q9G are obtained. The RFP reporter gene is added to each of them, which can achieve rapid detection of neutralizing antibody levels.

[0004] The present invention is achieved through the following technical solutions:

[0005] A method for constructing a stably transfected cell line for detecting varicella-zoster virus neutralizing antibodies comprises the following steps:

[0006] S1. Construction of PLVX-D / T / Q9G-RFP lentiviral stable transfection plasmid:

[0007] The D / T / Q9G-RFP lentiviral stable transfection plasmid was constructed using the PLVX expression vector;

[0008] The D / T / Q9G-RFP lentivirus is obtained by repeating the upstream transcription element of SEQ ID NO.1 to obtain D9G as described in SEQ ID NO.2; T9G as described in SEQ ID NO.3; and Q9G as described in SEQ ID NO.4.

[0009] The D / T / Q9G sequence is connected to the RFP reporter gene;

[0010] S2. Obtaining lentiviral packaging plasmid:

[0011] The PLVX-D / T / Q9G-RFP lentiviral stable transfection plasmid constructed in S1 was selected and introduced into competent cells for transformation. The endotoxin-free plasmid was then extracted to obtain the lentiviral packaging plasmid PLVX-D / T / Q9G-RFP.

[0012] S3. Obtaining PLVX-D / T / Q9G-RFP Lentivirus:

[0013] The PLVX-D / T / Q9G-RFP lentiviral stable transfection plasmid constructed in S1 was introduced into lentiviral packaging cells for transfection to complete viral packaging and obtain high-titer PLVX-D / T / Q9G-RFP lentivirus;

[0014] S4. Obtaining Stable Cell Lines:

[0015] The high titer PLVX-D / T / Q9G-RFP lentivirus in S3 was added to Vero cells, and after a certain period of transfection, the cells were screened using blasticidin S hydrochloride to obtain a Vero-D / T / Q9G-RFP stably transfected cell line.

[0016] Preferably, in S1, the sequence of SEQ ID NO. 1 is repeated 2 to 4 times to obtain the D / T / Q9G-RFP lentivirus.

[0017] Preferably, in S1, the D / T / Q9G sequence is linked to the RFP reporter gene via PCR.

[0018] The above-mentioned D9G refers to duplicate of the transcription element; T9G refers to triple of the transcription element; Q9G refers to quadruplicate of the transcription element.

[0019] The specific construction process of the above PLVX-D / T / Q9G-RFP is as follows:

[0020] The upstream transcription element nucleotide sequence was repeated two to four times, named D / T / Q, and synthesized after being connected to the PLVX vector. The RFP nucleotide sequence was then connected by PCR.

[0021] In the above PCR amplification, the upstream primer is: 5'-CGTGAATCCgccaccatgcggagcagc-3'; the downstream primer is 5'-CTTGTCGACTCATTACAGGAACAGGTGGTGCC-3'.

[0022] Preferably, in S2, the competent cells are DH5α.

[0023] Preferably, in S3, the process for obtaining the PLVX-D / T / Q9G-RFP lentivirus is as follows:

[0024] S1. Use 293FT cells to produce high-titer lentivirus. When the cell density reaches 80%, replace 10 mL of fresh pre-warmed DMEM medium 2 hours before transfection. 2 hours later, prepare the calcium phosphate transfection mix.

[0025] S2. First, take 13.3 μg of PLVX-D / T / Q9G-RFP plasmid and 10 μL each of ITI1, ITI2, and ITI3 packaging plasmids, then add 50 μL of 2.5 M CaCl2 solution, and add ddH2O to 500 μL;

[0026] S3. Add 500 μL of 2×HEPES solution dropwise to the above mixture. Add a total of 1 mL of transfection mixture to the cell culture dish and place in a 37°C, 5% CO2 incubator for 16-18 hours.

[0027] S4. Then replace with 10 mL of fresh pre-warmed DMEM medium and continue culturing;

[0028] S5. Start timing from the time the transfection mixture is added to the cells. Collect the culture supernatant 48 hours later, centrifuge at 2000 rpm for 5 minutes, filter through a 0.45 μm filter membrane, and aliquot to obtain the virus. Store at -80°C.

[0029] Preferably, the process for obtaining the stably transfected cell line is as follows:

[0030] S1. 10,000 Vero cells were seeded into a 6-well plate and cultured in DMEM medium at 37°C in a 5% CO2 incubator until the cell density reached approximately 20-30% on the second day.

[0031] S2. Set up control experimental wells without virus addition, add 2 mL of recovered lentivirus to other wells, and infect for 24 hours;

[0032] S3. Then, add blasticidin S hydrochloride (5 μg / mL mass concentration) to the 6-well plate. Change the selection medium every 2 to 3 days according to the cell growth condition.

[0033] S4. Observe the cell status, growth, and gene expression levels and proportions daily until no cells survive in the control group and the proportion of surviving cells in the experimental group is greater than 90% as observed under a microscope.

[0034] S5. After trypsin digestion, the cells were transferred to a 10 cm culture dish and grown normally to obtain the Vero-D / T / Q9G-RFP stable cell line.

[0035] A stably transformed cell model for detecting varicella-zoster virus neutralizing antibodies, wherein the stably transformed cell model is obtained after verification of the stably transformed cell line.

[0036] A stably transfected cell model for detecting varicella-zoster virus neutralizing antibodies is used in the preparation and monitoring of VZV neutralizing antibody products.

[0037] Application of a stably transfected cell model for detecting varicella-zoster virus neutralizing antibodies in screening the effects of drugs on neutralizing antibodies.

[0038] Compared with the prior art, the present invention has at least the following technical effects:

[0039] The present invention provides a method for constructing a stably transfected cell line for varicella-zoster virus neutralizing antibody detection. The method is based on gradually truncating the promoter and positioning it as a 93bp long sequence. In cells infected and transfected with IE62, the relative promoter activity patterns between these constructs are similar. The introduction of a 2-bp substitution in the upstream transcription element (USF) gene sequence reduces promoter activity. The upstream transcription element (USF) gene sequence is repeated 2-4 times, and then D9G, T9G, and Q9G are obtained. The RFP reporter gene is added after each of them, which can realize rapid detection of neutralizing antibody levels.

[0040] After a high-titer stable cell line for varicella-zoster virus neutralizing antibody detection is constructed using the method for constructing a stable cell line for varicella-zoster virus neutralizing antibody detection, the stable cell line for varicella-zoster virus neutralizing antibody detection can be used to prepare a stable cell model for varicella-zoster virus neutralizing antibody detection. The cell model can be used to evaluate whether a VZV vaccine (varicella-zoster virus vaccine) can produce neutralizing antibodies and quantify the neutralizing antibody value in test serum, or to screen whether a certain antibody is a neutralizing antibody. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the construction of PLVX-D9G-RFP lentiviral stable transfection plasmid;

[0042] Figure 2 Schematic diagram of the construction of PLVX-T9G-RFP lentiviral stable transfection plasmid;

[0043] Figure 3 Schematic diagram of the construction of PLVX-Q9G-RFP lentiviral stable transfection plasmid;

[0044] Figure 4 Schematic diagram of the relationship between the virus titer concentration and the number of spots of Vero-D9G;

[0045] Figure 5 Schematic diagram of the relationship between the virus titer concentration and the number of spots of Vero-T9G;

[0046] Figure 6 Schematic diagram of the relationship between the virus titer concentration and the number of spots of Vero-Q9G. DETAILED DESCRIPTION

[0047] The embodiments of the present invention will be described in detail below with reference to the examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. Specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0048] Example 1 Construction of PLVX-D / T / Q9G-RFP Lentivirus Stable Transfection Plasmid

[0049] The D / T / Q9G-RFP lentiviral stable transfection plasmid was constructed using the PLVX expression vector. Figure 1-3 As shown:

[0050] Figure 1 Schematic diagram of the construction of PLVX-D9G-RFP lentiviral stable transfection plasmid;

[0051] Figure 2 Schematic diagram of the construction of PLVX-T9G-RFP lentiviral stable transfection plasmid;

[0052] Figure 3 Schematic diagram of the construction of PLVX-Q9G-RFP lentiviral stable transfection plasmid.

[0053] SEQ ID NO.1: Upstream transcription element (USF) gene sequence nucleotide:

[0054] TACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAA AGGGGCAGGCGTGTATAAGAGGGCCCCTGTTAATACGCGGTCTG.

[0055] SEQ ID NO.2: D9G nucleic acid sequence:

[0056] TACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTTAATACGCGGTCTGTACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTTAATACGCGGTCTGCCGTGTTTGGATATTTCACGACCCTATCGTTTATTTACGTAGAATTCTAGAGGGTATATAATGGAAGCTCGACTTCCAGGCCACCATGCGGAGCAGCAAGAACGTGATCAAGGAGTTCATGCGGTTCAAGGTGCGGATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGGCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCCAGTACGGCAGCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGGGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGC TGGGAGGCCAGCACCGAGCGGCTGTACCCACGGGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGAGCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACAGCAAGCTGGACATCACCAGCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGGACCGAGGGCCGGCACCACCTGTTCCTGTAA。

[0057] SEQ ID NO.3: T9G nucleic acid sequence:

[0058] TACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTAATACGCGGTCTGTACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTAATACGCGGTCTGGAATTCTAGAGGGTATATAATGGAAGCTCGACTTCCAGGCCACCATGCGGAGCAGCAAGAACGTGATCAAGGAGTTCATGCGGTTCAAGGTGCGGATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGGCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCCAGTACGGCAGCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGGGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCAGCACCGAGCGGCTGTACCCACGGGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCA CTACCTGGTGGAGTTCAAGAGCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACAGCAAGCTGGACATCACCAGCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGGACCGAGGGCCGGCACCACCTGTTCCTGTAA。

[0059] SEQ ID NO.4: Q9G nucleic acid sequence:

[0060] TACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTTAATACGCGGTCTGTACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTTAATACGCGGTCTGTACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTTAATACGCGGTCTGTACTCGTTCTGTATTACGCAGCACGTGGTAAACCCGTTTGCCTATAAAAGGGGCAGGCGTGTATAAGAGGGCCCCTGTTTAATACGCGGTCTGCCGTGTTTGGATATTTCACGACCCTATCGTTTATTTACGTAGAATTCTAGAGGGTATATAATGGAAGCTCGACTTCCAGGCCACCATGCGGAGCAGCAAGAACGTGATCAAGGAGTTCATGCGGTTCAAGGTGCGGATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGGCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCCAGTACGGCAGCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGGGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCAGCACCGAGCGGCTGTACCCACGGGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGAGCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACAGCAAGCTGGACATCACCAGCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGGACCGAGGGCCGGCACCACCTGTTCCTGTAA。

[0061] SEQ ID NO.5: RFP nucleotide sequence

[0062] .

[0063] SEQ ID NO.6-7:

[0064] The upstream primer was: 5′-CGTGAATCCGCCACCATGCGGAGCAGC-3′;

[0065] The downstream primer was 5′-CTTGTCGACTCATTACAGGAACAGGTGGTGCC-3′.

[0066] The specific process is to select two to four repeats of the sequence in SEQ ID NO. 1, designating them as D / T / Q, and then link them to a PLVX vector. After designing and sending them to the company for synthesis, the RFP sequence is then added to these repeats via PCR. The primer designs are shown in SEQ ID NOs. 6-7.

[0067] Example 2 PLVX-D / T / Q9G-RFP lentivirus acquisition:

[0068] Step 1: Obtaining lentiviral packaging plasmid: Construct the lentiviral plasmid PLVX-D / T / Q9G-RFP and transform DH5α.

[0069] After the single clone was picked and sequenced correctly, a large amount of endotoxin-free plasmid was extracted and the obtained lentiviral plasmid PLVX-D / T / Q9G-RFP was used for packaging of the four-plasmid system lentivirus.

[0070] Step 2: Producing PLVX-D / T / Q9G-RFP Lentivirus: Use 293FT cells (human embryonic kidney cells) to produce high-titer lentivirus. When the cell density reaches 80%, replace 10mL of fresh pre-warmed DMEM medium 2 hours before transfection. 2 hours later, prepare the calcium phosphate transfection mixture. First, take 13.3μg of PLVX-D / T / Q9G-RFP plasmid and 10μL each of ITI1, ITI2, and ITI3 packaging plasmids, then add 50μL of 2.5M CaCl2 solution and add ddH2O to 500μL. To this mixture, add 500μL of 2×HEPES solution dropwise. Add a total of 1mL of transfection mixture to the cell culture dish and place in a 37°C, 5% CO2 incubator for 16-18 hours. Then replace with 10mL of fresh pre-warmed DMEM medium and continue culturing. The timer starts from the addition of the transfection mixture to the cells. The culture supernatant can be collected 48 hours later, centrifuged at 2000 rpm for 5 minutes, filtered through a 0.45 μm filter membrane, and the virus can be aliquoted and stored at -80°C.

[0071] Example 3 Obtaining Vero-D / T / Q9G-RFP Stable Cell Line:

[0072] Reagents used in this example:

[0073] name factory serial number Blasticidin S hydrochloride Solebao IB2090

[0074] Step 1: 10,000 Vero cells were seeded into a 6-well plate and cultured in DMEM medium at 37°C in a 5% CO2 incubator until the cell density reached about 20-30% on the second day.

[0075] Step 2: Set up control experimental wells without adding virus, add 2 mL of recovered lentivirus to other wells, and infect for 24 hours.

[0076] Step 3: Add blasticidin S hydrochloride (5 μg / mL) to the 6-well plate. Change the selection medium every 2-3 days depending on cell growth. Observe cell status, growth, and gene expression levels and proportions daily until no cells survive in the control group and the proportion of viable cells in the experimental group exceeds 90% under a microscope. After trypsinization, transfer the cells to a 10 cm culture dish and allow normal growth to produce the Vero-D / T / Q9G-RFP stably transfected cell line.

[0077] Example 4 Identification of Vero-D / T / Q9G-RFP Stable Transfection Cell Lines

[0078] In order to determine whether the reporter gene expression of the Vero-D / T / Q9G-RFP stably transfected cell line is normal and whether the stable cell line is successfully constructed, an RFP reporter gene experiment was performed.

[0079] Step 1: Prepare a cell suspension by trypsinizing adherent Vero cells and stably transfected Vero-D / T / Q9G-RFP cells. Count the cells and dilute and seed the suspension into a 96-well plate, with 100 μL of suspension per well containing 1.5 × 105 cells. Do not seed the outermost wells; add 200 μL of PBS buffer to the wells surrounding the cell culture wells.

[0080] Step 2: Virus dilution: VZV (V-Oka) was serially diluted 1:1 in a 96-well plate. 120 μl of virus solution was added to 120 μl of culture medium and serially diluted eight times to 1:256. Starting from column 2, 100 μl of VZV (V-Oka) at various dilutions was added to each well, with triplicate wells for each dilution. Column 11 served as a control, with no virus added. The cells were incubated at 37°C in a 5% CO2 incubator for 48 h.

[0081] Step 3: After incubation for 48 hours, equilibrate at room temperature for half an hour. After reaching room temperature, detect RFP in an enzyme reader.

[0082] Figure 4 Schematic diagram of the relationship between the virus titer concentration and the number of spots of Vero-D9G;

[0083] Figure 5 Schematic diagram of the relationship between the virus titer concentration and the number of spots of Vero-T9G;

[0084] Figure 6 Schematic diagram of the relationship between the virus titer concentration and the number of spots of Vero-Q9G.

[0085] The results are as follows Figure 4-6As shown, compared with Vero cells, the fluorescence intensity of Vero-D / T / Q9G-RFP cells increased significantly, and the Vero-D / T / Q9G-RFP stable transfectant was successfully constructed.

[0086] As the VZV virus titer increased, the number of RFP spots increased, indicating that the Vero-D / T / Q9G-RFP cell model can effectively monitor VZV neutralizing antibodies.

[0087] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. A method for constructing a stably transfected cell line for detecting varicella-zoster virus neutralizing antibodies, characterized in that: The steps include: S1. Construction of PLVX-D / T / Q9G-RFP lentiviral stable transfection plasmid: The D / T / Q9G-RFP lentiviral stable transfection plasmid was constructed using the PLVX expression vector; The D / T / Q9G-RFP lentivirus is obtained by repeating the upstream transcription element of SEQ ID NO.1 to obtain D9G as described in SEQ ID NO.2; T9G as described in SEQ ID NO.3; and Q9G as described in SEQ ID NO.

4. The D / T / Q9G sequence is connected to the RFP reporter gene; S2. Obtaining lentiviral packaging plasmid: The PLVX-D / T / Q9G-RFP lentiviral stable transfection plasmid constructed in S1 was selected and introduced into competent cells for transformation. The endotoxin-free plasmid was then extracted to obtain the lentiviral packaging plasmid PLVX-D / T / Q9G-RFP. S3. Obtaining PLVX-D / T / Q9G-RFP Lentivirus: The PLVX-D / T / Q9G-RFP lentiviral stable transfection plasmid constructed in S1 was introduced into lentiviral packaging cells for transfection to complete viral packaging and obtain high-titer PLVX-D / T / Q9G-RFP lentivirus; S4. Obtaining Stable Cell Lines: The high titer PLVX-D / T / Q9G-RFP lentivirus in S3 was added to Vero cells, and after a certain period of transfection, the cells were screened using blasticidin S hydrochloride to obtain a Vero-D / T / Q9G-RFP stably transfected cell line.

2. The method for constructing a stably transfected cell line for detecting varicella-zoster virus neutralizing antibodies according to claim 1, characterized in that: In the above S1, the sequence of SEQ ID NO. 1 is repeated 2 to 4 times to obtain the D / T / Q9G-RFP lentivirus.

3. The method for constructing a stably transfected cell line for varicella-zoster virus neutralizing antibody detection according to claim 1, characterized in that: In the S1, the D / T / Q9G sequence is linked to the RFP reporter gene by PCR.

4. The method for constructing a stably transfected cell line for varicella-zoster virus neutralizing antibody detection according to claim 1, characterized in that: In the S2, the competent cells are DH5α.

5. The method for constructing a stably transfected cell line for varicella-zoster virus neutralizing antibody detection according to claim 1, characterized in that: In S3, the process for obtaining the PLVX-D / T / Q9G-RFP lentivirus is as follows: S1. Use 293FT cells to produce high-titer lentivirus. When the cell density reaches 80%, replace 10 mL of fresh pre-warmed DMEM medium 2 hours before transfection. 2 hours later, prepare the calcium phosphate transfection mix. S2. First, take 13.3 μg of PLVX-D / T / Q9G-RFP plasmid and 10 μL each of ITI1, ITI2, and ITI3 packaging plasmids, then add 50 μL of 2.5 M CaCl2 solution, and add ddH2O to 500 μL; S3. Add 500 μL of 2×HEPES solution dropwise to the above mixture. Add a total of 1 mL of transfection mixture to the cell culture dish and place in a 37°C, 5% CO2 incubator for 16-18 hours. S4. Then replace with 10 mL of fresh pre-warmed DMEM medium and continue culturing; S5. Start timing from the time the transfection mixture is added to the cells. Collect the culture supernatant 48 hours later, centrifuge at 2000 rpm for 5 minutes, filter through a 0.45 μm filter membrane, and aliquot to obtain the virus. Store at -80°C.

6. The method for constructing a stably transfected cell line for detecting varicella-zoster virus neutralizing antibodies according to claim 1, characterized in that: The process of obtaining the stably transfected cell line is as follows: S1. 10,000 Vero cells were seeded into a 6-well plate and cultured in DMEM medium at 37°C in a 5% CO2 incubator until the cell density reached approximately 20-30% on the second day. S2. Set up control experimental wells without virus addition, add 2 mL of recovered lentivirus to other wells, and infect for 24 hours; S3. Then, add blasticidin S hydrochloride at a concentration of 5 μg / mL to the 6-well plate. Change the selection medium every 2 to 3 days depending on the cell growth. S4. Observe the cell status, growth, and gene expression levels and proportions daily until no cells survive in the control group and the proportion of surviving cells in the experimental group is greater than 90% as observed under a microscope. S5. After trypsin digestion, the cells were transferred to a 10 cm culture dish and grown normally to obtain the Vero-D / T / Q9G-RFP stable cell line.

7. A stably transfected cell model for detecting varicella-zoster virus neutralizing antibodies, characterized in that: The stable cell model is obtained by verifying the stable cell line according to any one of claims 1 to 6.

8. Use of the stably transfected cell model for detecting varicella-zoster virus neutralizing antibodies according to claim 7 in preparing a product for monitoring VZV neutralizing antibodies.

9. Use of the stably transfected cell model for detecting varicella-zoster virus neutralizing antibodies according to claim 7 in screening the effects of drugs on neutralizing antibodies.