Varicella attenuated live vaccine Oka strain gE gene specificity real-time fluorescent quantitative PCR detection primer probe set and application thereof in virus dynamic proliferation monitoring in vaccine production

Abstract

The invention belongs to the technical field of vaccine production, and particularly relates to a varicella attenuated live vaccine Oka strain gE gene specificity real-time fluorescent quantitative PCR detection primer probe set and application thereof in virus dynamic proliferation monitoring in vaccine production. The method comprises the following steps: selecting a target gene gE-Oka (gE-Oka; gE-Oka) with high conservative and species specificity gE protein genome of a varicella attenuated live virus Oka strain; the invention relates to a qPCR (quantitative polymerase chain reaction) detection method based on a target gene, the qPCR detection method based on the target gene is established by designing a primer pair and a probe group aiming at the target gene, the primer probe group and the detection method can be used for accurate monitoring of a vaccine production virus proliferation process, detection can be directly carried out, and a sample to be detected does not need to be inoculated into cells and cultured for several days before detection. Compared with a traditional plaque method, the method has the advantages that the detection period is shortened from 7-10 days to 4-8 hours, the detection cost and time consumption are remarkably reduced, and the production efficiency is improved.

Description

Technical Field

[0001] The present invention belongs to the field of vaccine production technology, specifically relating to a real-time fluorescence quantitative PCR primer probe set specific for the gE gene of the live attenuated varicella vaccine Oka strain, and its application in monitoring the dynamic proliferation of viruses during vaccine production. The qPCR primer probe set, designed based on the Oka strain gE gene (Genbank accession number: AB097932.1), can accurately monitor viral proliferation during vaccine production by quantitatively detecting the gE gene copy number in viral culture fluid. Background Art

[0002] Varicella is an acute infectious disease caused by the varicella-zoster virus (VZV). Due to its convenient infection route and the latent nature of the virus, the current level of varicella infection in the population is very high. VZV belongs to the Herpesviridae family and has only one serotype. The VZV genome has 71 genes, encoding 67 different proteins, including 7 glycoproteins named gE, gB, gH, gI, gC, gK and gL. The gE protein is one of the 7 membrane proteins on the surface of VZV and plays an important role in the process of viral entry into target cells. In existing literature, the gE protein is often selected as a vaccine target due to its high expression level and immunogenicity, but there are few patents that directly use it for qPCR detection of viral proliferation dynamics.

[0003] In the production process of live attenuated varicella virus vaccine, the harvesting of virus liquid is one of the key steps. The traditional method is to use the plaque method (current edition of the Chinese Pharmacopoeia) for virus titration: take the test sample and make a suitable multiple serial dilution; inoculate the human diploid cell 2BS strain or MRC-5 strain for each dilution, and incubate at 37℃±1℃, 5% carbon dioxide for 7 to 10 days to determine the result; by monitoring the changes in the virus titer of the virus harvest liquid, the dynamics of virus proliferation and the optimal harvesting time point are determined. However, the plaque method has obvious limitations and its detection cycle is long, which brings many inconveniences and challenges to related work during process optimization and actual production.

[0004] Quantitative real-time PCR (qPCR) is a technique that calculates the initial DNA concentration by monitoring changes in fluorescence intensity during each cycle of PCR amplification. Compared to traditional PCR monitoring methods, qPCR offers significant advantages. It not only enables precise quantitative monitoring of gE protein content in the template but also significantly improves the specificity and accuracy of gE protein detection by simplifying the protocol and reducing mismatches.

[0005] Existing varicella vaccine-related patents mostly focus on vaccine preparation (such as the preparation method of a new attenuated live vaccine CN117442714A) or antibody detection (CN115807126A, CN109913589B), while there is relatively little research on the quality control of virus liquid during the production process of biological products. Summary of the Invention

[0006] The present invention aims to overcome the shortcomings of the existing technology by providing a real-time fluorescence quantitative PCR primer and probe set specific for the gE gene of the live attenuated varicella vaccine strain Oka, and its application in monitoring the dynamic proliferation of the virus during vaccine production. The present invention is primarily used for quality control of the viral fluid during the production of the live attenuated varicella virus vaccine. By detecting the copy number of the gE gene in the viral fluid, the viral proliferation process can be accurately monitored.

[0007] Through extensive literature research and analysis, the present invention selected the highly conserved and species-specific target gene gE-Oka (gE-Oka; Genbank Accession No.: AB097932.1), a genomic marker of the gE protein of the live attenuated varicella virus strain Oka. A specific primer probe set (SEQ ID NOs. 1-3) was designed targeting the conserved region of the gE-Oka gene to avoid cross-reactions with other viruses (such as HSV and influenza virus). This method was then used to establish a qPCR detection method based on this target gene, specifically for detecting relative expression of the target gene or for absolute quantification and copy number analysis.

[0008] The technical solution of the present invention to solve the technical problem is as follows:

[0009] In a first aspect of the present invention, a primer-probe set for real-time fluorescence quantitative PCR detection of the gE gene of the live attenuated varicella vaccine Oka strain is provided, comprising a primer pair and a probe, wherein the primer-probe set is selected from any one of the following:

[0010] 1) Forward primer gE-Oka-F as shown in SEQ ID NO. 1, reverse primer gE-Oka-R as shown in SEQ ID NO. 2, and probe gE-Oka-P as shown in SEQ ID NO. 3;

[0011] 2) Functionally equivalent sequences that have no more than 4 nucleotide substitutions, deletions, or additions compared to the sequence described in (1);

[0012] 3) It has 85%-99.99% homology with the sequence described in (1) and can specifically amplify the sequence of the gE-Oka gene.

[0013] The specific sequence information of SEQ ID NO.1-3 is shown in Table 1:

[0014] Table 1 Names and sequences of primers and probes

[0015]

[0016]

[0017] Preferably, both ends of the probe gE-Oka-P are labeled with a fluorescent group and a quenching group, respectively, and are homologous to the middle portion of the sequence of the respective amplified fragments.

[0018] Preferably, the fluorescent group is FAM and the quenching group is NFQ-MGB.

[0019] In a second aspect of the present invention, a qPCR detection method for detecting the gE gene of the live attenuated varicella virus Oka strain using the primer probe set described in the first aspect is provided. This method is not used for diagnosis and treatment of diseases and comprises the following steps:

[0020] 1) Nucleic acid extraction: Extract DNA from the live attenuated varicella virus strain Oka to be tested;

[0021] 2) Set up the reaction system: Prepare 20 μL of quantitative PCR reaction solution, including: DNA template, 2xT5 Fast qPCR Mix (probe), forward primer, reverse primer, probe, EASYDilution, and ddH2O;

[0022] 3) Amplification program: 1 cycle of pre-denaturation at 95°C for 2 min; 40 cycles of denaturation at 95°C for 15 s and annealing and extension at 60°C for 30 s;

[0023] 4) Result detection: including real-time fluorescence signal interpretation; obtaining Ct value.

[0024] Preferably,

[0025] The method further comprises the steps of:

[0026] 5) Standard curve construction: Use a known concentration of gE-Oka standard plasmid (e.g., 69.39 pg / μL) for serial dilution and generate a Ct value-gE gene copy number standard curve by qPCR;

[0027] 6) Sample detection: Substitute the Ct value of the sample to be tested into the standard curve to calculate the gE gene copy number.

[0028] Preferably, the concentration and dosage of each component in the quantitative PCR reaction solution are as follows: 10.0 μL of 2xT5 Fast qPCR Mix (probe), 0.7 μL each of a 10 μM forward primer and a 10 μM reverse primer, 0.6 μL of a 10 uM probe, 1.0 μL of a DNA template, and the remainder is made up to 20 μL with ddH2O.

[0029] In a third aspect of the present invention, a kit for detecting the gE gene of live attenuated varicella virus is provided, comprising the primer probe set described in the first aspect, 2xT5 Fast qPCR Mix (probe) and EASYDilution buffer.

[0030] In a fourth aspect of the present invention, a method for monitoring the dynamic proliferation of viruses in the production of varicella live attenuated virus vaccine is provided, comprising the following steps:

[0031] 1) Virus culture: Varicella-zoster virus is inoculated into human diploid cell culture to produce a live attenuated varicella virus vaccine;

[0032] 2) Sampling: Taking the viral culture fluid at different time points in step 1), and applying the primer probe set described in the first aspect and the qPCR detection method described in the second aspect to obtain the Ct value of the gE gene of the viral culture fluid to be tested;

[0033] 3) Standard curve construction: Using a virus solution of known titer, perform serial dilutions of the virus solution and generate a Ct value-virus titer standard curve by qPCR;

[0034] 4) Sample testing: Substitute the Ct value of the virus culture medium to be tested in step 2) into the standard curve in step 3) to calculate the titer of the live attenuated varicella virus culture medium, thereby accurately monitoring the virus proliferation process during vaccine production.

[0035] Preferably, the human diploid cell line is 2BS strain or MRC-5 strain.

[0036] Compared with the prior art, the main innovations and beneficial effects of the present invention are as follows:

[0037] 1. The present invention selects the target gene gE-Oka (gE-Oka; Genbank accession number: AB097932.1) whose gE protein genome is highly conserved and species-specific in the live attenuated varicella virus Oka strain, and then designs primer pairs and probe groups for the target gene, thereby establishing a qPCR detection method based on the target gene. The primer probe group and detection method of the present invention can be used for accurate monitoring of the virus proliferation process in vaccine production, and can be directly detected without first inoculating the sample to be tested into cells and culturing them for several days before testing. Compared with the traditional plaque method, the detection cycle is shortened from 7-10 days to 4-8 hours, which significantly reduces the detection cost and time consumption and improves production efficiency. The method of the present invention provides reliable data support for the optimization of important parameters of the production process, which helps to ensure the quality stability of the vaccine product. From the experimental verification of the embodiment, it can be seen that the qPCR detection method of the present invention has a sensitivity of up to 3.23E+04 copies / uL for gE-Oka gene copy number detection, which is far higher than the conventional standard requirement; the sensitivity for DNA detection can reach 0.0009291pg / μL; the titer of varicella attenuated live virus culture fluid is linear in the range of 0.0057lgPFU / mL to 5.8500lgPFU / mL; the qPCR detection method of the present invention has good specificity, and no positive amplification results were found for rabies virus (Vero cells), herpes simplex virus (HSV), influenza A virus H1N1, and influenza B virus BV virus liquid genomes. Therefore, the method of the present invention has the advantages of low cost, high sensitivity, strong specificity, and simple operation.

[0038] 2. The qPCR detection method of the gE protein gene based on the varicella live attenuated virus Oka strain virus liquid of the present invention has important application value in the production process development of varicella live attenuated vaccine (Oka strain). Through this method, enterprises can efficiently and economically monitor the proliferation dynamics of the virus, accurately determine the optimal harvest time point of the virus liquid, and optimize the production process. This move not only reduces production costs and improves economic benefits, but also improves the quality control level of vaccine production. The application of this method provides a feasible alternative for the biopharmaceutical industry, solves the problems of high cost and low efficiency of traditional detection methods, and is of great significance to promoting the innovation and development of vaccine production technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is a method for detecting the gE protein gene of the live attenuated varicella virus (Oka strain) virus fluid.

[0040] Figure 2 This is the DNA amplification curve of the gE protein gE-Oka gene standard plasmid of the live attenuated varicella virus (Oka strain).

[0041] Figure 3This is the gE-Oka gene standard curve of the gE protein gE-Oka gene standard plasmid of the live attenuated varicella virus (Oka strain).

[0042] Figure 4 The results are shown for the amplification of the gE-Oka gene of the live attenuated varicella virus (Oka strain) with different DNA concentrations.

[0043] Figure 5 This is the standard curve of gE-Oka gene of live attenuated varicella virus Oka strain with different DNA concentrations.

[0044] Figure 6 These are the results of amplification of the gE-Oka gene of the live attenuated varicella virus (Oka strain) with different virus titers.

[0045] Figure 7 This is the standard curve for amplification of the gE-Oka protein gene of live attenuated varicella virus (Oka strain) with different virus titers. DETAILED DESCRIPTION

[0046] Exemplary embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The following embodiments are only used to illustrate the present invention and should not be considered to limit the scope of the present invention.

[0047] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified. Among them, RNA / DNA extraction kits and reverse transcription kits were purchased from Takara Bio. The gE-Oka standard plasmid, primers, and probes were commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis; 2xT5 Fast qPCR Mix (probe), EASY Dilution, and Buffer required for the PCR reaction system were all purchased from TakaraBio; the fluorescence quantitative PCR instrument was ABI QuantStudio3; the UV-visible spectrophotometer UV-8000 was purchased from Shimadzu Instruments (Suzhou) Co., Ltd.; rabies virus liquid (Vero cells), influenza A virus liquid H1N1, influenza B virus liquid BV, and herpes simplex virus (HSV) were all from Jindik Biotechnology Co., Ltd.

[0048] However, it is apparent that one or more embodiments can be practiced without these specific details. If specific conditions are not specified in the embodiments, they can be carried out according to conventional conditions or conditions recommended by the manufacturer.

[0049] Molecular biology experimental methods not specifically described in the following examples were performed with reference to the specific methods listed in J. Sambrook's Molecular Cloning: A Laboratory Manual (3rd edition), or in accordance with the kit and product instructions. This method is intended solely for quality control of viral fluids during vaccine production and does not involve the diagnosis or treatment of human or animal diseases. Therefore, this invention does not constitute a method for disease diagnosis and meets the basic requirements for patent protection under the Patent Law.

[0050] The present invention provides a primer and probe combination designed based on the gE protein gE-Oka genome of the live attenuated varicella virus Oka strain, and also develops a qPCR detection method for detecting the gE protein gE-Oka genome of the virus fluid of the live attenuated varicella virus Oka strain. The specific embodiments of the present invention are described below, and the specific contents are as follows:

[0051] Example 1 Design of primer probe set

[0052] In this experiment, primers and corresponding probes for fluorescence quantitative PCR detection were designed for the gE-Oka gene (Genbank accession number: AB097932.1). Primer Premier 5.0 online primer design software was used to design the primer and probe combinations. Both primers and probes were synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequences are shown in Table 1 below:

[0053] Table 1 Names and sequences of primers and probes

[0054] Targeted genes Primer name Sequence (5'-3') Sequence Listing No. gE-Oka gE-Oka-F GCTTTTTGCCGTCATTAACCTG SEQ ID NO.1 gE-Oka-R CGCAATCCACATCCACCACC SEQ ID NO.2 gE-Oka-P TCTTGAAAGCATGTTGTATGT SEQ ID NO.3

[0055] The probe gE-Oka-P is labeled with a fluorescent group (FAM) and a quencher (NFQ-MGB) at both ends, and is homologous to the middle portion of the amplified fragment.

[0056] 1.2 qPCR reaction system

[0057] The qPCR reaction system containing the above primer probe set has the following components:

[0058] 1) Forward primer and reverse primer, final concentration is 10 μM each; probe, final concentration is 10 μM;

[0059] 2) PCR reaction reagents, including 2xT5 Fast qPCR Mix (probe) and EASYDilution, were purchased from TakaraBio.

[0060] 3) Positive control: gE-Oka standard plasmid, live attenuated varicella virus (Oka strain) protein DNA.

[0061] 4) Negative control: ddH2O.

[0062] Example 2 Establishment of a qPCR Detection Method for the gE-Oka Gene of Live Attenuated Varicella Virus (Oka Strain)

[0063] 2.1 Preparation of standard plasmid

[0064] The gE-Oka standard plasmid was synthesized by Beijing Qingke Biotechnology Co., Ltd. Based on the measured OD value, the standard plasmid concentration was calculated to be approximately 6.939 ng / μL, and the gE-Oka gene copy number was 2.25E+09 copies / uL. Based on the known gE-Oka gene copy number, the standard plasmid was diluted using EASY Dilution to 3.23E+08 copies / uL, 3.23E+07 copies / uL, 3.23E+06 copies / uL, 3.23E+05 copies / uL, and 3.23E+04 copies / uL, respectively. These were used as six DNA reaction samples of known concentrations. NTC was used as a negative control for the sample. The PCR reaction system was prepared using the following primers and probes:

[0065] 2.2 Reaction system / gE-Oka detection

[0066] Forward detection primer gE-Oka-R (10 μM, 0.7 μL) and reverse detection primer gE-Oka-F (10 μM, 0.7 μL), detection probe gE-Oka-P (10 μM, 0.6 μL), 2xT5 Fast qPCR Mix (probe) (10 μL), DNA template 1 μL, add deionized water to 20 μL, that is, the total reaction system is 20 μL.

[0067] 2.3 Reaction procedure

[0068] The amplification program was set up on a fluorescence quantitative PCR instrument: Step 1: pre-denaturation at 95°C for 2 minutes; Step 2: denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 30 seconds, and collection of the fluorescence of the FAM reporter group after derivatization; Step 2 was repeated for 40 cycles.

[0069] 2.4 Standard curve construction:

[0070] Using a gE-Oka standard plasmid of known concentration (e.g., 69.39 pg / μL serial dilution), a Ct value-copy number log value standard curve was generated by qPCR.

[0071] 2.4 Test results

[0072] Using primers and probes designed based on the gE-Oka gene of live attenuated varicella virus, six DNA samples with known concentrations (gE-Oka gene copy numbers: 3.23E+08 copies / uL, 3.23E+07 copies / uL, 3.23E+06 copies / uL, 3.23E+05 copies / uL, 3.23E+04 copies / uL) were amplified and detected. Figure 2 ) and standard curve ( Figure 3 ) It can be seen that the linear detection parameters are good and the correlation coefficient (R 2 ) was 1.000, the amplification efficiency (E value) was 91.5%, and the linear results met the requirements of fluorescence quantitative PCR (qPCR) detection.

[0073] Among the six DNA samples with known concentrations, when the lowest concentration of the gE-Oka gene copy number was 3.23E+04 copies / μL, the corresponding primer and probe combination of the gE-Oka gene showed positive amplification, and the detection method of the varicella live attenuated virus protein gene described in the present invention was deduced, and the sensitivity could reach at least 3.23E+04 copies / μL.

[0074] Example 3 qPCR Detection Method for gE-Oka Protein Gene in Live Attenuated Varicella Virus (Oka Strain) Virus Fluid

[0075] 3.1 Preparation of DNA template

[0076] A known concentration of attenuated varicella virus (Oka strain) was used to extract viral DNA (DNA concentration was 92.91 pg / μL) from a live attenuated varicella virus (virus titer: 6.8 lgPFU / mL, determined according to the Chinese Pharmacopoeia 2020 edition method) according to the instructions of the TaKaRa MiniBEST Viral RNA / / DNA Extraction Kit Ver.5.0. The prepared DNA was diluted to 6 different concentrations of DNA template using EASY Dilution: 92.91 pg / μL, 9.291 pg / μL, 0.9291 pg / μL, 0.09291 pg / μL, 0.0009291 pg / μL, and 0.00009291 pg / μL. These were used as 6 DNA samples of known concentrations. NTC was used as a negative control for the sample, and the qPCR reaction system was prepared using primers and probes.

[0077] 3.2 Reaction System / gE-Oka Detection

[0078] Forward detection primer gE-Oka-R (10 μM, 0.7 μL) and reverse detection primer gE-Oka-F (10 μM, 0.7 μL), detection probe gE-Oka-P (10 μM, 0.6 μL), 2xT5 Fast qPCR Mix (probe) (10 μL), DNA template 1 μL, add deionized water to 20 μL, that is, the total reaction system is 20 μL.

[0079] 3.3 Reaction procedure

[0080] The amplification program was set up on a fluorescence quantitative PCR instrument: Step 1: pre-denaturation at 95°C for 2 minutes; Step 2: denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 30 seconds, and collection of the fluorescence of the VIC reporter group after derivatization; Step 2 was repeated for 40 cycles.

[0081] 3.4 Test results

[0082] Using primers and probes designed based on the gE protein gE-Oka gene of live attenuated varicella virus, six DNA samples with known concentrations (92.91pg / μL, 9.291pg / μL, 0.9291pg / μL, 0.09291pg / μL, 0.009291pg / μL, 0.0009291pg / μL) were amplified and detected. Figure 4 ) It can be seen that in the six DNA samples with known concentrations, positive amplification can be seen by the corresponding primer and probe combination of gE-Oka gene. The amplification curve of gE-Oka detection ( Figure 4 ) and standard curve ( Figure 5 ) shows good linear detection parameters, with a correlation coefficient (R²) of 0.9945 and an amplification efficiency (E-value) of 109.0%. These linear results meet the requirements for fluorescence quantitative PCR (qPCR) detection. This indicates that the detection method for the gE-Oka target gene associated with the gE protein of the live attenuated varicella virus described herein can achieve a sensitivity of at least 0.0009291 pg / μL.

[0083] 3.5 Specificity

[0084] Use EASYDilution to dilute the extracted and prepared influenza A virus H1N1, rabies virus (Vero cells), herpes simplex virus (HSV), and influenza B virus BV genomes to a concentration of not less than 50 pg / μL. Take 1 μL of rabies virus liquid (Vero cells), influenza A virus liquid H1N1, herpes simplex virus liquid (HSV), and influenza B virus liquid genomes as templates and add them to the reaction system. The total reaction system is 20 μL.

[0085] As shown in Table 2 below, this experiment validated the detection platform constructed using a primer and probe combination targeting the gE protein gene of the live attenuated varicella virus (Oka strain). No positive amplification results were observed when 1 μL of rabies virus (Vero cells), herpes simplex virus (HSV), influenza A (H1N1), or influenza B (BV) viral genomes were added to each reaction. This demonstrates the high specificity of the qPCR detection method described herein based on DNA from the gE protein gene of the live attenuated varicella virus (Oka strain).

[0086] Table 2 Specificity verification experimental results

[0087]

[0088] Note: N / A: Not detected.

[0089] Example 4 Method for Monitoring Dynamic Virus Proliferation in the Production of Live Attenuated Varicella Virus Vaccine

[0090] 4.1 Virus culture

[0091] 1) Cell culture: Human diploid cell line MRC-5 was used for cell culture. Cells were inoculated into T25 culture flasks, and appropriate amount of cell culture medium (such as MEM + 10% FBS) was added and placed at 37°C.

[0092] Culture in an incubator until the cell density reaches 80%-90%.

[0093] 2) Virus inoculation: Inoculate the cultured cells with the varicella-zoster virus (Oka strain) at a 0.01 MOI (Multiplicity of Infection). Gently shake the culture bottle to evenly distribute the virus and continue incubating in a 36°C incubator.

[0094] 3) Virus proliferation: Samples were collected every 24 hours for a total of three times (i.e., 24, 48, and 72 hours of culture). For each sampling, 1 mL of culture medium was taken and centrifuged to remove cell debris. The supernatant was used for subsequent qPCR and plaque assays.

[0095] 4.2 qPCR detection

[0096] 1) Nucleic acid extraction: Viral DNA was extracted using TaKaRa Mini BEST Viral RNA / DNA Extraction Kit Ver. 5.0 according to the instructions to obtain a DNA template.

[0097] 2) Reaction system construction: Forward detection primer gE-Oka-R (10 μM, 0.7 μL) and reverse detection primer gE-Oka-F (10 μM, 0.7 μL), detection probe gE-Oka-P (10 μM, 0.6 μL), 2xT5 Fast qPCR Mix (probe) (10 μL), DNA template 1 μL, deionized water was added to 20 μL, that is, the total reaction system was 20 μL.

[0098] 3) Reaction Procedure: Set the amplification program on a fluorescence quantitative PCR instrument as follows: Step 1: pre-denaturation at 95°C for 2 minutes; Step 2: denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 30 seconds, and collection of the fluorescence of the VIC reporter group after derivatization; repeat Step 2 for 40 cycles.

[0099] 4) Result detection: Monitor the fluorescence signal in real time and record the Ct value.

[0100] 4.3 Standard curve construction

[0101] 1) Sample dilution: A live attenuated varicella virus (Oka strain) with a known virus titer (5.85 lgPFU / mL, determined according to the Chinese Pharmacopoeia 2020 edition) was serially diluted to the following concentrations:

[0102] Original, 4-fold, 16-fold, 64-fold, 256-fold, and 1024-fold dilutions.

[0103] 2) qPCR detection: According to the above reaction system and amplification procedure, qPCR detection was performed on the standard samples to generate a Ct value-virus titer standard curve.

[0104] 4.4 Sample testing

[0105] Substitute the Ct value into the standard curve: Substitute the Ct value obtained in step 4.2 into the standard curve in step 4.3.

[0106] Calculate the virus titer at each time point and draw the virus proliferation curve.

[0107] 4.5 Results Analysis

[0108] The attenuated live varicella virus (Oka strain) with a known virus titer (5.85 lgPFU / mL, determined by the method of the Chinese Pharmacopoeia 2020) was serially diluted to the following concentrations: original, 4-fold, 16-fold, 64-fold, 256-fold, and 1024-fold dilutions. The test was performed according to the above reaction system and reaction procedure. The amplification curve of the qPCR test was ( Figure 6 ) and standard curve ( Figure 7 ) detection parameters are good, and the correlation coefficient (R 2 ) was 0.9998. This showed that the method had high accuracy and reliability in detecting virus titer.

[0109] Comparison of qPCR and the traditional plaque assay revealed good consistency in viral titer detection between the two methods (Table 3). As can be seen, the qPCR and plaque assays produced very similar viral titer results at 48, 60, and 72 hours, demonstrating that qPCR accurately reflects the dynamics of viral proliferation. In particular, at 24 hours, qPCR was able to detect low viral titers, whereas the plaque assay, due to its lower sensitivity, was unable to do so, further demonstrating the superiority of qPCR in detection sensitivity.

[0110] In addition, the detection cycle of the qPCR method is significantly shortened from 7-10 days of the traditional plaque method to 4-8 hours, which greatly improves the detection efficiency and provides more timely and accurate data support for virus proliferation monitoring during vaccine production.

[0111] Table 3 Comparison of titers between qPCR detection method and traditional plaque assay

[0112] Culture time (h) qPCR method (1g PFU / mL) Plaque assay (lgPFU / mL) 24 0.123 - 48 2.609 2.70 60 3.830 3.78 72 5.006 4.95

[0113] In actual research, the inventors selected gene sequences with characteristics such as highly repetitive sequences and species-specific correlation based on the gE protein of the live attenuated varicella virus Oka strain as the target amplification fragments through literature and NCBI database, and designed primer and probe sequences. The primers and probes described in the present invention were screened out through a large number of experiments (inappropriate primer sequences are not described in detail here), which can ensure certain sensitivity and specificity. In addition, in order to improve the success rate of establishing a qPCR detection method with good specificity, high sensitivity and good stability, factors such as the selection of target genes (good specificity and high sensitivity), the size of the amplified product (amplification efficiency), the annealing temperature of the primers and probes and the GC content control, the Tm difference control between primers and between primers and probes, and the avoidance of dimers between primers and between primers and probes were comprehensively considered in the early stage.

[0114] During the research and development process, the inventors further optimized a series of technical issues such as the reaction system and reaction procedure. Therefore, the beneficial effects described in the present invention were obtained through a lot of creative work during the design and verification of many experiments. Finally, it was also verified by virus samples of varicella live attenuated virus (Oka strain) with different virus titers, proving that the DNA detection sensitivity of the qPCR detection method of the present invention can reach 3.23E+04 copies / uL, far exceeding the conventional standard requirements; the DNA detection sensitivity can reach 0.0009291pg / μL; the varicella live attenuated virus culture fluid titer is linear in the range of 0.0057lgPFU / mL to 5.8500lgPFU / mL, while avoiding false positive reactions.

[0115] Specific embodiments of the present invention have been described in detail so that those skilled in the art will readily understand. However, based on the disclosed description, various modifications or substitutions may be made to those details, and such modifications are within the scope of protection of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. A real-time fluorescence quantitative PCR primer and probe set for detecting the gE gene of the live attenuated varicella vaccine Oka strain, comprising a primer pair and a probe, characterized in that: The primer probe set is selected from any one of the following: 1) Forward primer gE-Oka-F as shown in SEQ ID NO. 1, reverse primer gE-Oka-R as shown in SEQ ID NO. 2, and probe gE-Oka-P as shown in SEQ ID NO. 3; 2) Functionally equivalent sequences that have no more than 4 nucleotide substitutions, deletions, or additions compared to the sequence described in (1); 3) It has 85%-99.99% homology with the sequence described in (1) and can specifically amplify the sequence of the gE-Oka gene.

2. The real-time fluorescence quantitative PCR detection primer probe set for gE gene specificity of the live attenuated varicella vaccine Oka strain according to claim 1, characterized in that: The two ends of the probe gE-Oka-P are respectively labeled with a fluorescent group and a quenching group, and are homologous to the middle part of the sequence of the respective amplified fragments.

3. The real-time fluorescence quantitative PCR detection primer probe set for gE gene specificity of the live attenuated varicella vaccine Oka strain according to claim 2, characterized in that: The fluorescent group is FAM, and the quenching group is NFQ-MGB.

4. A qPCR detection method for detecting the gE gene of the live attenuated varicella virus Oka strain using the primer probe set according to any one of claims 1 to 3, wherein the method is not used for diagnosis and treatment of diseases, and is characterized in that: The following steps are involved: 1) Nucleic acid extraction: Extract DNA from the live attenuated varicella virus strain Oka to be tested; 2) Set up the reaction system: Prepare 20 μL of quantitative PCR reaction solution, including: DNA template, 2xT5 Fast qPCR Mix (probe), forward primer, reverse primer, probe, EASYDilution, and ddH2O; 3) Amplification program: 1 cycle of pre-denaturation at 95°C for 2 min; 40 cycles of denaturation at 95°C for 15 s and annealing and extension at 60°C for 30 s; 4) Result detection: including real-time fluorescence signal interpretation; obtaining Ct value.

5. The method according to claim 4, characterized in that The method further comprises the steps of: 5) Standard curve construction: Using a known concentration of gE-Oka standard plasmid, a Ct value-gE gene copy number standard curve was generated by qPCR; 6) Sample detection: Substitute the Ct value of the sample to be tested into the standard curve to calculate the gE gene copy number.

6. The method according to claim 4, characterized in that In the quantitative PCR reaction solution of step 2), the concentration and dosage of each component are as follows: 10.0 μL of 2xT5 Fast qPCR Mix (probe), 0.7 μL each of a 10 μM forward primer and a 10 μM reverse primer, 0.6 μL of a 10 μM probe, 1.0 μL of DNA template, and the balance is made up to 20 μL with ddH2O.

7. A kit for detecting the gE gene of live attenuated varicella virus, characterized in that: The method comprises the primer probe set according to any one of claims 1 to 3, 2xT5 Fast qPCR Mix (probe) and EASY Dilution buffer.

8. A method for monitoring the dynamic proliferation of viruses in the production of live attenuated varicella virus vaccine, characterized in that: The following steps are involved: 1) Inoculating varicella-zoster virus into human diploid cell culture to produce a live attenuated varicella virus vaccine; 2) taking the viral culture fluid at different time points in step 1), and applying the primer probe set according to any one of claims 1 to 3 and the qPCR detection method according to claim 4 to obtain the Ct value of the gE gene of the viral culture fluid to be tested; 3) Standard curve construction: Using a virus solution of known titer, perform serial dilutions of the virus solution and generate a Ct value-virus titer standard curve by qPCR; 4) Sample testing: Substitute the Ct value of the virus culture medium to be tested in step 2) into the standard curve in step 3) to calculate the titer of the live attenuated varicella virus culture medium, thereby accurately monitoring the virus proliferation process during vaccine production.

9. The monitoring method according to claim 8, characterized in that: The human diploid cell line is a 2BS strain or an MRC-5 strain.

Images