Molecular marker influencing sheep weight traits and application thereof
The molecular markers affecting the weight traits of sheep were screened through genomic association analysis, and the parents were selected using specific mutation sites, which solved the problem of insufficient purebred resources of Suffolk sheep and improved the weight and growth rate of offspring.
Patent Information
- Application Number
- CN202510983273.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2045-07-17
AI Technical Summary
Currently, Suffolk sheep purebred resources in my country are insufficient, and some populations have inbreeding declines, which affects genetic diversity. Weight is an important indicator for measuring the growth traits of Suffolk sheep. It is difficult for the existing technology to effectively improve its growth rate and meat production performance.
Through genomic association analysis, molecular markers that affect sheep weight traits were screened out, including markers one and markers two. Using whole-genome sequencing and whole-genome association analysis methods, specific mutation sites on sheep chromosome 4 were identified, and individuals with TT or AA genotypes were selected as parents to increase offspring weight.
By selecting specific genotype individuals as parents, the weight of Suffolk sheep offspring is significantly improved, the growth rate and meat production performance is enhanced, and the problem of insufficient purebred resources of Suffolk sheep is solved.
Smart Images

Figure CN120464759A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic breeding, and in particular to a molecular marker affecting sheep weight traits and an application thereof. Background Art
[0002] The Suffolk sheep is one of the world's largest meat sheep breeds, originating in Suffolk, Norfolk, Cambridgeshire, and Essex in southeast England. Developed in 1859, it is a hybrid of the South Downs sheep (male) and the larger, leaner, older, black-headed Norfolk sheep (female). Since 1978, my country has imported Suffolk sheep from Australia and New Zealand for purebred breeding and as sires for hybridization with local sheep. The Suffolk's rapid growth rate and high-quality meat shorten the breeding cycle, reduce feed costs, and increase profitability.
[0003] With increasing consumer demand for high-quality lamb, high-end Suffolk lamb meat products hold broad market prospects. However, my country currently faces a shortage of purebred Suffolk lamb resources, with some populations experiencing inbreeding depression, which compromises genetic diversity. Weight is a key growth trait in Suffolk lambs. To further improve growth rate and meat production in Suffolk lambs, it is crucial to identify molecular markers influencing weight through genomic association analysis. Summary of the Invention
[0004] To solve the above problems, the present invention provides a molecular marker affecting sheep weight traits and its application, which can be used to identify sheep weight traits and to breed heavy-weight sheep.
[0005] The present invention is achieved through the following technical solutions: A molecular marker affecting sheep body weight traits, comprising marker one and / or marker two.
[0006] The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, and a mutation from T to C occurs at the 101 bp site.
[0007] The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 2, and a mutation from A to G occurs at the 101 bp site.
[0008] The molecular marker is used to identify the weight trait of sheep.
[0009] Preferably, identifying the body weight trait of sheep comprises the following steps.
[0010] Extract genomic DNA from sheep blood.
[0011] The genomic DNA is fragmented to obtain DNA fragments, and then a library is constructed using the DNA fragments. The library is sequenced to obtain sequencing data.
[0012] The sequencing data is subjected to identification and screening of variant sites, and genome-wide association analysis is used to detect that when the genotype of the marker 1 at the 101bp position on sheep chromosome 4 is TT, the sheep is heavy weight; or when the genotype of the marker 2 at the 101bp position on sheep chromosome 4 is AA, the sheep is heavy weight; heavy weight refers to a weight greater than 84kg.
[0013] Preferably, the length of the DNA fragment is 320 bp to 380 bp.
[0014] Preferably, the threshold of the genome-wide association analysis is set to P=1 / 620054.
[0015] The application of the molecular marker in sheep genetic breeding.
[0016] Preferably, the weight of the offspring is increased by selecting individuals with TT or AA genotype as parents.
[0017] Preferably, the sheep are Suffolk sheep.
[0018] Compared with the prior art, the present invention has the following beneficial effects: The present invention discloses molecular markers that affect sheep weight traits, comprising marker one and / or marker two. The nucleotide sequence of marker one is shown in SEQ ID NO. 1, with a T-to-C mutation occurring at the 101st bp position; the nucleotide sequence of marker two is shown in SEQ ID NO. 2, with an A-to-G mutation occurring at the 101st bp position. The present invention screens for molecular markers that affect sheep weight traits, namely marker one and marker two, through methods such as genome sequencing, identification of variant sites, and genome-wide association analysis. These markers are used to identify sheep weight traits, and by selecting individuals with the TT or AA genotype as sires or dams, offspring weight can be increased. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0020] Figure 1 This is the distribution diagram of SNPs in a 1Mb window of chromosome after quality control in the present invention. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.
[0021] Figure 2 This is a visualization diagram of the G matrix of the present invention.
[0022] Figure 3 This is the principal component analysis diagram of the present invention, with the first two explained variance percentages PC1 and PC2 as the X and Y axes.
[0023] Figure 4 Manhattan Plots and QQ-plots of the present invention show the GWAS results of Suffolk sheep weight, and the genome-wide significant SNPs are shown in red; A is the Manhattan plot of the Suffolk sheep weight trait; B is the QQ plot of the Suffolk sheep weight trait. DETAILED DESCRIPTION
[0024] To facilitate understanding of the present invention, the present invention will be described more fully below, along with preferred embodiments of the present invention. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present invention.
[0025] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0026] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0027] Example Source of experimental animals and phenotypes: The experimental sheep in this invention were all obtained from Sino Sheep Breeding Technology Co., Ltd. in Inner Mongolia Autonomous Region. Phenotypic records of weight traits of Suffolk sheep at one year of age from 2020 to 2024 were measured, as shown in Table 1. Blood samples were collected from 300 Suffolk sheep. All samples were immediately stored at -80°C after collection, transported to the laboratory on dry ice, and then stored at -80°C for a long time.
[0028] Table 1 Description of body weight traits of Suffolk sheep
[0029] 1. Genomic DNA Extraction and Quality Inspection DNA was extracted from blood samples using the phenol-chloroform method. The DNA concentration, the absorption wavelength ratio of the highest absorption peaks of nucleic acids, proteins, and phenolic substances (260 nm / 280 nm), and the absorption wavelength ratio of the highest absorption peak of carbohydrates (260 nm / 230 nm) were detected using a NanoDrop 2000 spectrophotometer. DNA quality was evaluated by 1% agarose gel electrophoresis.
[0030] 2. Library Construction and Sequencing After processing qualified genomic DNA samples, the DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments were then subjected to end-repair, poly A addition, sequencing adapters, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and the effective concentration of the library was accurately quantified using qPCR to ensure library quality. After passing the library quality test, sequencing was performed using the BGI-T7 sequencing platform in PE150 mode.
[0031] 3. Identification, screening, and annotation of variant sites The raw sequencing data were quality controlled and preprocessed using fastp software version V0.20.0 to obtain clean reads data. A genome index was established for the reference genome, and the quality-controlled clean reads were aligned with the sheep reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version V0.7.17. The aligned sam files were converted into bam files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in the Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and SNP variation detection was performed using the HaplotypeCaller module in the GATK software. The obtained vcf files were filtered using the VariantFiltration module. The ANNOVAR software package is used to perform functional annotation on the detected genetic variants. Based on the location of the variant site on the reference genome and the gene position information on the reference genome, the region where the variant site occurs in the genome, such as the intergenic region, intron region or CDS region, and the impact of the variant, such as synonymous and non-synonymous mutations, can be obtained.
[0032] 4. Data Quality Control and Population Stratification Correction Detection rate, English name is call rate; minimum allele frequency, English abbreviation is MAF; Hardy-Weinberg equilibrium, English abbreviation is HWE.
[0033] Whole-genome resequencing was performed on 300 Suffolk sheep individuals to establish a genotype database, generating a total raw read size of 17,243.32 Gb and obtaining a total of 47,506,993 SNPs. The genotyping data were quality-controlled using Plink software version 1.90. Individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and SNPs with a Hardy-Weinberg equilibrium test P value of less than 10 were excluded. -6 A total of 20,182,599 high-quality SNPs were identified in the Suffolk population. These sites were evenly distributed on the 26 pairs of autosomes in sheep. Figure 1 shown.
[0034] The first five principal components were calculated using the "--pc5" parameter of Plink software version V1.90. PCA was plotted using R version V3.6.0. The results are shown in the figure below. Figure 2 As shown, Figure 2 Each small square in the figure represents the kinship value between the first and last samples. The smaller the value, the closer it is to light green, that is, the more distant the kinship between the two individuals, and vice versa. The experimental samples are stratified, and the genetic correlation between individuals is high. The first five principal components need to be used as covariates to correct for the stratification of the Suffolk sheep population. Plinkv1.90 was used to perform a genomic kinship analysis based on the G matrix on this population. The results are shown in the figure below. Figure 3 As shown, the top density distribution of PC1 shows principal component 1, that is, the distribution of all data points on PC1 and the degree of data variation along the PC1 axis. The right density distribution of PC2 shows principal component 2, that is, the distribution of all data points on PC2 and the degree of data variation along the PC2 axis. The results show that the average kinship between Suffolk sheep individuals is relatively distant.
[0035] 5. Genome-wide association analysis The association analysis between SNPs and body weight traits was performed using the fastGWA-mlm model in the GCTA software V1.94.0beta.
[0036] y=X snp β snp +X c β c +g+e; Where y is the phenotype vector; X snp is the genotype vector, whose effect is β snp ;X cis the correlation matrix with sex, measurement year and the first five PCAs as fixed covariates, and the corresponding coefficient is β c ; g is the vector of total genetic effects captured by the SNP-derived genetic relationship matrix, g~N(0, ); π is the genetic relationship matrix vector derived from SNPs, where all off-diagonal elements are set to 0; e is the residual vector, e~N(0, ).
[0037] Because the Bonferroni correction method is used, the significance threshold of 0.05 / number of SNPs is too strict to determine the significance threshold of GWAS. After the linkage disequilibrium (LD), independent SNPs are obtained and used to calculate the threshold. The parameters are 50: window size, i.e., number of SNPs; 10: step length, i.e., number of SNPs; 0.2: r 2 value, delete one of the SNP pairs with LD greater than 0.2. The present invention adjusts the threshold of genome-wide significant association to P=1 / 620054, where 620054 is the number of independent SNPs screened by LD. The genomic expansion factor of the test statistic, i.e. λ, is calculated by the slope of the linear regression between the observed quantile and the theoretical quantile in R version V3.6.0. After calculation, the λ value of the weight trait is 0.971, indicating that there is no genome expansion. Based on the resequencing data of 300 Suffolk sheep, 29 significant SNP sites associated with weight traits were detected, which are located on chromosomes 1, 4, 6, 9, 14, 23, and 26, respectively, as shown in Tables 2 and 3. Figure 4 shown.
[0038] Table 2 Significant SNPs associated with weight at one year old
[0039] 6. SNPs affecting body weight traits in Suffolk sheep Further research on SNPs that reached genome-wide significance levels revealed that the T→C mutation at position 4460379 on chromosome 4 of the Suffolk sheep genome can significantly affect the weight trait of Suffolk sheep.
[0040] The association analysis between the SNP site 4460379 on chromosome 4 of the Suffolk sheep genome and body weight traits is as follows: Table 3 Polymorphisms at position 4460379 on chromosome 4 of the Suffolk sheep genome
[0041] Note: Different lowercase letters indicate significant differences. P <0.05, the same letter indicates no significant difference, P>0.05.
[0042] As shown in Table 3, the individuals with genotype TT have the largest weight, while the individuals with genotype CC have the smallest weight.
[0043] In genome-wide association analysis, the SNP marker at position 4460379 on chromosome 4 in the Suffolk sheep genome reached genome-wide significance, as shown in Table 2. This indicates that this marker is significantly associated with the weight trait in Suffolk sheep. Furthermore, when the genotype of this marker is TT, it favors a larger body weight in Suffolk sheep, exceeding 84 kg. The gene and genotype frequencies of the SNP at position 4460379 on chromosome 4 in the Suffolk sheep genome are shown in Table 4.
[0044] Table 4 SNP gene frequency and genotype frequency at position 4460379 on chromosome 4 of Suffolk sheep genome
[0045] The molecular marker containing the T→C mutation site at position 4460379 on chromosome 4 is marker 1, and its nucleotide sequence is shown in SEQ ID NO. 1, specifically: CTCATTGGTTAAGGCTCCCAATCAGAAGATGCAGAAGAGTGACTGGGTGCAGAAGCTGTCATAGCTGTGCAAGGTGTCTTGGGTGGAAGGTGTCACAATTYACGTTACCTTCAGCATTTAAACTCAACCTTGGCGCTGCTGAGCGTGGTACTATGGCTGCACCACCACAATAGACTCTGAGGTGGGGGTGCGCTCCAAATG, where Y is T / C. The nucleotide sequence shown in SEQ ID NO. 1 represents the 100 bp before and after the mutation site.
[0046] Further research on SNPs that reached genome-wide significance levels revealed that the A→G mutation at position 4460400 on chromosome 4 of the Suffolk sheep genome can significantly affect the weight trait of Suffolk sheep.
[0047] The association analysis between the SNP site 4460400 on chromosome 4 of the Suffolk sheep genome and body weight traits is as follows: Table 5 Polymorphisms at position 4460400 on chromosome 4 of the Suffolk sheep genome
[0048] Note: Different lowercase letters indicate significant differences. P <0.05, the same letter indicates no significant difference, P>0.05.
[0049] As shown in Table 5, the individuals with genotype AA have the largest weight, while the individuals with genotype GG have the smallest weight.
[0050] In genome-wide association analysis, the SNP marker at position 4460400 on chromosome 4 of the Suffolk sheep genome reached genome-wide significance, as shown in Table 2. This indicates that this marker is significantly associated with the weight trait of Suffolk sheep. Furthermore, when the genotype of this marker is AA, it favors Suffolk sheep with a larger body weight, exceeding 84 kg. The gene and genotype frequencies of the SNP at position 4460400 on chromosome 4 of the Suffolk sheep genome are shown in Table 6.
[0051] Table 6 SNP gene frequency and genotype frequency at position 4460400 on chromosome 4 of Suffolk sheep genome
[0052] The molecular marker containing the A→G mutation site at position 4460400 on chromosome 4 is marker 2, and its nucleotide sequence is shown in SEQ ID NO. 2, specifically: TCAGAAGATGCAGAAGAGTGACTGGGTGCAGAAGCTGTCATAGCTGTGCAAGGTGTCTTGGGTGGAAGGTGTCACAATTTACGTTACCTTCAGCATTTAAYCTCAACCTTGGCGCTGCTGAGCGTGGTACTATGGCTGCACCACCACAATAGACTCTGAGGTGGGGGTGCGCTCCAAATGCCCAGTGGGGATGCGCCATCT, where Y is A / G. The nucleotide sequence shown in SEQ ID NO. 2 represents the 100 bp before and after the mutation site.
[0053] It can be seen from this that a large-bodied Suffolk sheep breed can be bred through the T→C mutation at position 4460379 on chromosome 4 of the Suffolk sheep genome, or through the A→G mutation at position 4460400 on chromosome 4 of the Suffolk sheep genome, to breed large-bodied Suffolk sheep. By selecting individuals with TT or AA genotypes as sires or dams, the weight of Suffolk sheep offspring can be increased.
[0054] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.
[0055] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0056] The above-described embodiments merely represent several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent. A person skilled in the art would be able to make various modifications and improvements without departing from the spirit of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be based on the appended claims.
Claims
1. A molecular marker affecting sheep weight traits, characterized in that: The molecular marker includes marker one and / or marker two; The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, and a mutation from T to C occurs at the 101 bp site; The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 2, and a mutation from A to G occurs at the 101 bp site.
2. Use of the molecular marker as claimed in claim 1 in identifying the body weight trait of sheep.
3. The use according to claim 2, characterized in that The sheep are Suffolk sheep.
4. The use of the molecular marker according to claim 2 in identifying the weight trait of sheep, characterized in that: The identification of sheep weight traits involves the following steps: Extract genomic DNA from sheep blood; The genomic DNA is fragmented to obtain DNA fragments, and then a library is constructed using the DNA fragments. The library is sequenced to obtain sequencing data; The sequencing data is subjected to identification and screening of variant sites, and genome-wide association analysis is used to detect that when the genotype of the marker 1 at the 101bp position on sheep chromosome 4 is TT, the sheep is heavy-weight; or when the genotype of the marker 2 at the 101bp position on sheep chromosome 4 is AA, the sheep is heavy-weight; heavy weight refers to a weight greater than 84kg.
5. The use according to claim 4, characterized in that The length of the DNA fragment is 320 bp to 380 bp.
6. The use according to claim 4, characterized in that The threshold for the genome-wide association analysis was set to P = 1 / 620054.
7. Use of the molecular marker as claimed in claim 1 in sheep genetic breeding.
8. The use according to claim 7, characterized in that By selecting individuals with TT or AA genotype as parents, the weight of offspring can be increased.
9. The use according to claim 7, characterized in that The sheep are Suffolk sheep.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to goat weight character and application thereof
CN117778592A
SNP (Single Nucleotide Polymorphism) marker influencing early growth traits of down producing goats and application of SNP marker
CN118726617A
Molecular marker for identifying body weight of Zhongwei goats and application of molecular marker
CN118813829A
Cited By
Application of molecular marker for grassland short-tailed sheep weight character breeding
CN121653269A
Application of molecular marker for weight trait selection of grassland short-tailed sheep
CN121653269B
Application of molecular marker related to weaning weight character of sheep
CN121674585A
Application of molecular marker related to daily gain character of sheep before weaning
CN121674587A
Use of a molecular marker associated with pre-weaning average daily gain in sheep
CN121674587B