A primer-probe combination and kit for simultaneously detecting IBV and its six genotypes

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a primer-probe combination and a kit for simultaneously detecting IBV and its six genotypes. The primer-probe combination is for detecting GI-1 genotype of avian infectious bronchitis virus, for detecting GI-13 genotype of avian infectious bronchitis virus, for detecting GI-19 genotype of avian infectious bronchitis virus, for detecting GI-22 genotype of avian infectious bronchitis virus, for detecting GVI-1 genotype of avian infectious bronchitis virus, for detecting GI-7 genotype of avian infectious bronchitis virus or for detecting universal genotype of avian infectious bronchitis virus. The detection throughput of the present invention is high, and typing and universal detection of six genotypes can be completed in a single-tube reaction system, which is time-saving and efficient; the channel utilization rate is high, and each fluorescent channel supports typing of two genotypes, effectively expanding the multiplexing capability; the typing accuracy is strong, the typing signal is clear, and the accuracy rate is high.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a primer-probe combination and a kit for simultaneously detecting IBV and its six genotypes. Background Art

[0002] IBV (Infectious Bronchitis Virus), a member of the Coronavirus family, is the pathogen that causes infectious bronchitis (IB) in chickens. The virus is highly contagious and primarily attacks the respiratory, reproductive, and urinary systems of chickens. Clinical manifestations include coughing, sneezing, wheezing, decreased egg production, and kidney enlargement. In severe cases, it can lead to death, resulting in significant economic losses.

[0003] IBV has an extremely high genetic variation rate, especially within the S1 gene coding region, which is prone to point mutations, insertions, deletions, or recombination, leading to significant differences in the virus's antigenicity and pathogenicity. Currently, the six main IBV genotypes prevalent in my country are GI-1 (Mass-like), GI-13 (4 / 91-like), GI-19 (QX-like), GI-22 (LDT3A-like), GVI-1, and GI-7 (TW-I-like). These genotypes differ significantly in geographic distribution, seasonality, and vaccine response characteristics. Furthermore, due to the limited cross-protection of vaccines, accurate identification of the infecting IBV genotype in clinical practice is crucial for guiding vaccine selection and developing prevention and control strategies.

[0004] Currently, IBV detection and typing methods primarily include RT-PCR (reverse transcription polymerase chain reaction), real-time quantitative PCR (qPCR), gene sequencing, and restriction fragment length polymorphism (RFLP). Real-time PCR is widely used due to its high sensitivity, strong specificity, rapid detection, and suitability for high-throughput operations. Traditional fluorescent PCR typing methods primarily rely on different fluorescently labeled probes to identify genotypes. However, due to the limited number of fluorescent channels (usually a maximum of four), it is difficult to detect multiple genotypes in parallel within a single reaction system.

[0005] Probe Melting Curve Analysis (PMCA) uses the difference in melting temperature (Tm value) after the fluorescent probe binds to the target sequence to distinguish them. The Tm values ​​corresponding to different sequences have characteristic differences, so multi-target identification can be achieved through Tm values ​​in the same fluorescent channel, effectively improving the multiple typing capabilities. Although some studies have attempted to apply probe melting curve technology to avian virus detection (such as double or triple melting curve detection), the following defects still exist: insufficient throughput and typing capabilities. Existing methods are mostly limited to double or triple detection, which cannot meet the needs of simultaneous typing of the six major genotypes and can easily lead to missed detections or misjudgments; channel interference is a prominent problem. Traditional methods rely on multiple fluorescence channels to distinguish targets, which can easily lead to signal overlap and crosstalk in four-channel devices; there is a lack of standards for Tm value design, and the Tm difference of the probe melting curve needs to be precisely designed. If the design is inappropriate, it will lead to melting peak overlap, affecting typing accuracy and repeatability; lack of an integrated detection platform: existing technologies mostly target a single genotype or gene locus, and an integrated system for IBV universal detection and genotype identification has not been established, making it difficult to meet the needs of rapid and accurate diagnosis in clinical settings.

[0006] In summary, existing technologies are unable to efficiently complete universal IBV detection and precise typing of the six major genotypes in a single detection system. These technologies suffer from low throughput, weak typing capabilities, high costs, and complex operations. Therefore, the development of a high-throughput, highly sensitive, and highly specific primer-probe combination and kit for clinically applicable IBV multiple typing detection is of great practical significance. Summary of the Invention

[0007] In response to the shortcomings of the existing technology, the present invention aims to overcome the shortcomings of the existing technology such as low IBV detection throughput, serious waste of channel resources, easy signal interference and difficulty in identifying overlapping melting curves, and provide a primer probe and kit for detecting IBV through a seven-probe melting curve, which can realize the detection of two genotypes in one channel, and can simultaneously realize the accurate typing of six IBV genotypes, GI-1, GI-13, GI-19, GI-22, GVI-1 and GI-7, in a single detection reaction, and can simultaneously detect the universal type of IBV.

[0008] To achieve the above objectives, the present invention adopts the following technical solutions: a primer-probe combination for simultaneously detecting IBV and its six genotypes, wherein the primer-probe combination is used to detect one or more of avian infectious bronchitis virus of GI-1 genotype, avian infectious bronchitis virus of GI-13 genotype, avian infectious bronchitis virus of GI-19 genotype, avian infectious bronchitis virus of GI-22 genotype, avian infectious bronchitis virus of GVI-1 genotype, avian infectious bronchitis virus of GI-7 genotype or avian infectious bronchitis virus of universal genotype;

[0009] The composition for detecting the GI-1 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 1; a downstream primer having a nucleotide sequence as shown in SEQ NO: 2; and a probe having a nucleotide sequence as shown in SEQ NO: 3;

[0010] The composition for detecting the GI-13 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 4; a downstream primer having a nucleotide sequence as shown in SEQ NO: 5; and a probe having a nucleotide sequence as shown in SEQ NO: 6;

[0011] The composition for detecting the GI-19 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 7 or SEQ NO: 22; a downstream primer having a nucleotide sequence as shown in SEQ NO: 8; and a probe having a nucleotide sequence as shown in SEQ NO: 9;

[0012] The composition for detecting the GI-22 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 10; a downstream primer having a nucleotide sequence as shown in SEQ NO: 11; and a probe having a nucleotide sequence as shown in SEQ NO: 12;

[0013] The composition for detecting the avian infectious bronchitis virus of the GVI-1 genotype comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 13; a downstream primer having a nucleotide sequence as shown in SEQ NO: 14; and a probe having a nucleotide sequence as shown in SEQ NO: 15;

[0014] The composition for detecting the GI-7 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 16; a downstream primer having a nucleotide sequence as shown in SEQ NO: 17; and a probe having a nucleotide sequence as shown in SEQ NO: 18;

[0015] The composition for detecting the universal genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 19; a downstream primer having a nucleotide sequence as shown in SEQ NO: 20, and a probe having a nucleotide sequence as shown in SEQ NO: 21.

[0016] Furthermore, the 5' ends of SEQ NO: 3 and SEQ NO: 6 were modified with FAM, and the 3' ends were modified with BHQ1.

[0017] Furthermore, the 5' ends of SEQ NO: 9 and SEQ NO: 12 were modified with HEX, the 3' end of SEQ NO: 9 was modified with BHQ2, and the 3' end of SEQ NO: 12 was modified with MGB.

[0018] Furthermore, the 5' ends of SEQ NO: 15 and SEQ NO: 18 were modified with CY5, the 3' end of SEQ NO: 15 was modified with MGB; and the 3' end of SEQ NO: 18 was modified with BHQ2.

[0019] Furthermore, the 5' end of SEQ NO: 21 was modified with ROX, and the 3' end was modified with BHQ2.

[0020] Furthermore, bases 4, 7, 10, and 13 at the 5' end of SEQ NO: 3 are modified with locked nucleic acid;

[0021] The 8th and 11th bases at the 5' end of SEQ NO: 6 were modified with locked nucleic acid.

[0022] Furthermore, the fourth base at the 5' end of SEQ NO:9 is modified with a locked nucleic acid;

[0023] The 4th, 7th and 10th bases at the 5' end of SEQ NO: 12 were modified with locked nucleic acid.

[0024] Further,

[0025] The 4th, 7th, 10th and 13th bases at the 5' end of SEQ NO: 15 are modified with locked nucleic acid;

[0026] The 4th and 7th bases at the 5' end of SEQ NO: 18 were modified with locked nucleic acid.

[0027] A kit for simultaneously detecting IBV and its six genotypes containing the primer-probe combination described above,

[0028] It also includes reverse transcriptase, Taq enzyme, buffer, magnesium ions, dNTPs, PCR enhancer TMAO, positive control and negative control.

[0029] Further,

[0030] The reaction system includes:

[0031] 5µL of buffer, Mg 2+ 25mM 3µL, dNTP 20mM 0.1µL, mixed upstream and downstream primers 20µM 4.1µL, mixed probe 20µM 0.95µL, DNA polymerase 5U / µL 0.1µL, reverse transcriptase 200U / µL 0.05µL, RNase inhibitor 40U / µL 0.25µL, sucrose (mass percentage concentration 50%) 2µL, glycerol 0.875µL, TMAO 5M 1µL, and ddH2O were added to a total volume of 20µL;

[0032] Among the mixed upstream and downstream primers:

[0033] 0.3 µL each of the upstream and downstream primers for detecting the GI-1 genotype, 0.35 µL each of the upstream and downstream primers for detecting the GI-13 genotype, 0.2 µL each of the upstream and downstream primers for detecting the GI-19 genotype, 0.4 µL each of the upstream and downstream primers for detecting the GI-22 genotype, 0.25 µL each of the upstream and downstream primers for detecting the GVI-1 genotype, 0.25 µL each of the upstream and downstream primers for detecting the GI-7 genotype, and 0.3 µL each of the upstream and downstream primers for detecting the universal genotype;

[0034] In the hybrid probe:

[0035] The probe for detecting GI-1 genotype was 0.15 µL, the probe for detecting GI-13 genotype was 0.15 µL, the probe for detecting GI-19 genotype was 0.15 µL, the probe for detecting GI-22 genotype was 0.2 µL, the probe for detecting GVI-1 genotype was 0.1 µL, the probe for detecting GI-7 genotype was 0.1 µL, and the probe for detecting universal genotype was 0.1 µL.

[0036] The beneficial technical effects of the present invention are:

[0037] The detection throughput of the present invention is high, and typing and universal detection of six genotypes can be completed in a single-tube reaction system, which is time-saving and efficient; the channel utilization rate is high, and each fluorescence channel supports typing of two genotypes, effectively expanding the multiplexing capability; the typing accuracy is strong, the Tm temperature difference is ≥3°C, the typing signal is clear, and the accuracy rate is high; the adaptability is wide, and it is compatible with most four-channel or five-channel fluorescence quantitative PCR equipment; the operation is simple and the cost is low, and no additional equipment or sequencing is required, which is suitable for grassroots laboratories or mobile detection; quantitative typing can be performed, and the amplification efficiency of the universal type and six genotypes of IBV is between 90% and 110%, and the correlation coefficient R 2The value is not less than 0.98, which is suitable for quantitative analysis of pathogen infection status or vaccine immune efficacy. The sensitivity is high, not exceeding 10 copies / µL, and can detect low-concentration samples, providing a basis for early diagnosis of viral infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the sensitivity amplification curve of the GI-1 genotype in the embodiment of the present invention;

[0039] Figure 2 This is the sensitivity amplification curve of the GI-13 genotype in the embodiment of the present invention;

[0040] Figure 3 This is the sensitivity amplification curve of the GI-19 genotype in the embodiment of the present invention;

[0041] Figure 4 This is the sensitivity amplification curve of the GI-22 genotype in the embodiment of the present invention;

[0042] Figure 5 This is the sensitivity amplification curve of the GVI-1 genotype in the embodiment of the present invention;

[0043] Figure 6 This is the sensitivity amplification curve of the GI-7 genotype in the embodiment of the present invention;

[0044] Figure 7 This is the sensitivity amplification curve of the IBV universal genotype in the embodiment of the present invention;

[0045] Figure 8 This is a melting curve diagram of the comparative test of the PCR enhancer TMAO in an embodiment of the present invention;

[0046] Figure 9 This is a melting curve diagram of the comparative test of MGB modification at the 3' end of the probe according to the embodiment of the present invention;

[0047] Figure 10 This is a melting curve diagram of the comparative test of LNA modification of the probe according to the embodiment of the present invention;

[0048] Figure 11 This is the GI-1 standard curve of the embodiment of the present invention;

[0049] Figure 12 This is the GI-13 standard curve of the embodiment of the present invention;

[0050] Figure 13 This is the GI-19 standard curve of the embodiment of the present invention;

[0051] Figure 14 This is the GI-22 standard curve of the embodiment of the present invention;

[0052] Figure 15This is the GVI-1 standard curve of the embodiment of the present invention;

[0053] Figure 16 This is the GI-7 standard curve of the embodiment of the present invention;

[0054] Figure 17 This is the IBV standard curve of the embodiment of the present invention;

[0055] Figure 18 This is a melting curve diagram of the GI-1 genotype sample detection in the embodiment of the present invention;

[0056] Figure 19 This is a melting curve diagram of the GI-13 genotype sample detection in the embodiment of the present invention;

[0057] Figure 20 This is a melting curve diagram of the GI-1 and GI-13 genotype samples after mixing and testing in the embodiment of the present invention;

[0058] Figure 21 For the present invention Figures 18-20 The result graph after overlapping the melting curve graph;

[0059] Figure 22 This is a melting curve diagram of the GI-19 genotype sample detection in the embodiment of the present invention;

[0060] Figure 23 This is a melting curve diagram of the GI-22 genotype sample detected in the embodiment of the present invention;

[0061] Figure 24 This is a melting curve diagram of the mixed GI-19 and GI-22 genotype samples tested in the embodiment of the present invention;

[0062] Figure 25 For the present invention Figure 22-24 The result graph after overlapping the melting curve graph;

[0063] Figure 26 This is a melting curve diagram of the GVI-1 genotype sample detection in the embodiment of the present invention;

[0064] Figure 27 This is a melting curve diagram of the GI-7 genotype sample detection in the embodiment of the present invention;

[0065] Figure 28 This is a melting curve diagram of the GVI-1 and GI-7 genotype samples after mixing and testing in the embodiment of the present invention;

[0066] Figure 29 For the present invention Figure 26-Figure 28 The result graph after overlapping the melting curve graph;

[0067] Figure 30 This is a melting curve diagram of a specific sample according to an embodiment of the present invention. DETAILED DESCRIPTION

[0068] The specific implementation is further described below with reference to the accompanying drawings.

[0069] The reagents and instruments in the following examples are all conventional experimental reagents and instruments.

[0070] Example 1

[0071] A primer-probe combination for simultaneously detecting IBV and its six genotypes, wherein the primer-probe combination is used to detect GI-1 genotype of avian infectious bronchitis virus, used to detect GI-13 genotype of avian infectious bronchitis virus, used to detect GI-19 genotype of avian infectious bronchitis virus, used to detect GI-22 genotype of avian infectious bronchitis virus, used to detect GVI-1 genotype of avian infectious bronchitis virus, used to detect GI-7 genotype of avian infectious bronchitis virus and used to detect universal genotype of avian infectious bronchitis virus.

[0072] Based on the S1 gene sequence variation characteristics of each IBV genotype (GI-1, GI-13, GI-19, GI-22, GVI-1 and GI-7), six pairs of genotype-specific probes and their matching primers were designed. Combined with one IBV universal probe and its matching primers, a seven-fold detection system was formed.

[0073] The six genotype probes are assigned to the three fluorescence channels of FAM, VIC, and CY5 in pairs; the two probes in each channel have different melting temperatures (Tm) and can be distinguished by melting curves;

[0074] The fourth channel ROX is used for universal IBV detection, using common TaqMan probes to identify conserved regions without differentiation by melting curves.

[0075] The nucleotide sequences of the primers and probes for multicolor probe melting curve detection of IBV genotypes (GI-1, GI-13, GI-19, GI-22, GVI-1, and GI-7) are as follows:

[0076] 1. Primer probe for GI-1 (reference strain: H120, gene accession number: ON350836.1):

[0077] (1) Name: GI-1 upstream primer; Sequence number: SEQ NO: 1; Sequence information (5'-3'): TGTGGTTTAATTCACTTTCA

[0078] (2) Name: GI-1 downstream primer; Sequence number: SEQ NO: 2; Sequence information (5'-3'): ACCGCTCTTAGTAACATAA

[0079] (3) Name: GI-1 probe; Sequence number: SEQ NO: 3; Sequence information (5'-3'): FAM-tgcTtaCggTccTcttcaaggt-BHQ1

[0080] 2. Primer probe for GI-13 (reference strain: 4 / 91, gene accession number: KF377577.1)

[0081] (1) Name: GI-13 upstream primer; Sequence number: SEQ NO: 4; Sequence information (5'-3'): CCTTGTTTGTGCTAGAGA

[0082] (2) Name: GI-13 downstream primer; Sequence number: SEQ NO: 5; Sequence information (5'-3'): CCACCTAAAGCCATAGAG

[0083] (3) Name: GI-13 probe; Sequence number: SEQ NO: 6; Sequence information (5'-3'): FAM-tggcttgCttGtgttgcctcctat-BHQ1

[0084] 3. Primer probe for GI-19 (reference strain: QX, gene accession number: OP868815.1):

[0085] (1) Name: GI-19 upstream primer 1; Sequence number: SEQ NO: 7; Sequence information (5'-3'): GTGCCATAGATGTCTTTG; Name: GI-19 upstream primer 2; Sequence number: SEQ NO: 22; Sequence information (5'-3'): GTGCCATAGATGTTTTTG

[0086] (2) Name: GI-19 downstream primer; Sequence number: SEQ NO: 8; Sequence information (5'-3'): GAACCTGTTTCATTTCTAGA

[0087] (3) Name: GI-19 probe; Sequence number: SEQ NO: 9; Sequence information (5'-3'): HEX-attGccaccagacactaca-BHQ2

[0088] 4. Primer probe for GI-22 (reference strain: LDT3, gene accession number: MH427496.1):

[0089] (1) Name: GI-22 upstream primer; Sequence number: SEQ NO: 10; Sequence information (5'-3'): TGGCTTGTGGTTTAATTC

[0090] (2) Name: GI-22 downstream primer; Sequence number: SEQ NO: 11; Sequence information (5'-3'): GCGAGGACCATTATATGA

[0091] (3) Name: GI-22 probe; Sequence number: SEQ NO: 12; Sequence information (5'-3'): HEX-taaCaaCaaGtggctctac-MGB

[0092] 5. Primer probe for GVI-1 (reference strain: GVI-1, gene accession number: MH427409.1): (1) Name: GVI-1 upstream primer; Sequence number SEQ NO: 13; Sequence information (5'-3'): GGCAGTCGTATATTTACTTC

[0093] (2) Name: GVI-1 downstream primer; Sequence number: SEQ NO: 14; Sequence information (5'-3'): CCTTCACAGAATCAGTTATATTAG

[0094] (3) Name: GVI-1 probe; Sequence number: SEQ NO: 15; Sequence information (5'-3'): CY5-cctTgaCctActCtacca-MGB

[0095] 6. Primer probe for GI-7 (reference strain: TW-I, gene accession number: MW560640.1)

[0096] (1) Name: GI-7 upstream primer; Sequence number: SEQ NO: 16; Sequence information (5'-3'): TGGCAATTTTAGATACTTCA

[0097] (2) Name: GI-7 downstream primer; Sequence number: SEQ NO: 17; Sequence information (5'-3'): GTCAGAATGCCTACTAAC

[0098] (3) Name: GI-7 probe; Sequence number: SEQ NO: 18; Sequence information (5'-3'): CY5-accGccTgacactacaaactgct-BHQ2

[0099] 7. Primer probe for universal genotype (reference strain: IBV, gene accession number: OR778292.1): (1) Name: IBV upstream primer; Sequence number: SEQ NO: 19; Sequence information (5'-3'): CAGCAGCATCTAGTAGAG

[0100] (2) Name: IBV downstream primer; Sequence number: SEQ NO: 20; Sequence information (5'-3'): CACGAGCAATAAGATCATC

[0101] (3) Name: IBV probe; Sequence number: SEQ NO: 21; Sequence information (5'-3'): ROX-agaaccactcctgcgaccac-BHQ2

[0102] Note: The capital letters in the above probes represent the LNA modified positions.

[0103] This application utilizes a unique probe melting temperature (Tm) control design based on the formation mechanism of the melting temperature peak (Tm value) in the probe melting curve method—this characteristic peak originates from the melting process of the double-stranded structure formed by specific hybridization between the probe and the target sequence. The Tm value is determined by key parameters such as probe length, GC base content, and chemical modification method. The core design requirement of this solution is that within the same fluorescence detection channel, different genotype probe systems must exhibit significantly different Tm values ​​(ΔTm value ≥ 3°C) to ensure that the spatial separation of the melting peak signal meets the needs of clinical interpretation. To achieve these technical indicators, this study innovatively introduced locked nucleic acid (LNA) modification technology and a minor groove binder (MGB) probe structure. LNA is a modified form of nucleotide structure in which a methylene bridge (O2′–C4′) is formed between the 2' oxygen and 4' carbon of the sugar ring, locking the C3'-endo conformation of the ribose, resulting in a more stable and rigid base pair structure. Each LNA base modification can increase the Tm by approximately 2-8°C. LNA results in stable and tighter binding, more "synchronous" debonding during melting, and a narrower Tm peak. MGB is a class of small molecules that can bind to the minor groove of the DNA double helix. They are often located at the 3' end of the probe and form a non-covalent auxiliary binding force with the target DNA, thereby improving the overall stability of the probe and target DNA. With the same probe sequence, MGB modification can increase the Tm by 5–10°C. After MGB binding, the annealing and melting process is more concentrated, and the Tm peak is more concentrated and symmetrical, making it suitable for melting curve typing. Two probe modification methods enable clear typing of any two IBV genotypes across the FAM, VIC, and CY5 channels, ensuring accurate melting curve peak separation without overlap. By precisely controlling the stability of the probe's secondary structure and hybridization kinetics, the specificity of the detection system is significantly improved while effectively expanding the Tm typing differences between different target sequences.

[0104] This application uses probes modified with both MGB and LNA for probe melting curve typing analysis, which has the following advantages:

[0105] Significantly improved Tm values: MGB modification enhances the stability of the probe-template duplex by binding to the minor groove of DNA, and alone can increase Tm by 5–10°C. LNA bases further enhance base pairing affinity by locking the ribose conformation, with each LNA addition increasing Tm by 2–8°C.

[0106] Clearer melting curve typing: MGB provides additional stabilization by binding to the minor groove of DNA, while LNA enhances base pairing affinity by restricting ribose conformation. This results in a tighter, more stable hybrid duplex between the probe and target, reducing interstrand isomerism and promoting a more coordinated and concentrated melting process, resulting in a sharp, symmetrical Tm peak. The modification enhances probe sensitivity to mismatched bases, resulting in a higher Tm for homologous binding and a significantly lower Tm for mismatches. This can particularly widen Tm differences by 2–6°C in typing (e.g., for SNPs and variants), resulting in a better "Tm window" distribution in multiplex channels and effective discrimination between similar genotypes. The dually modified probe exhibits enhanced thermal stability, allowing for stable binding to low-abundance templates, effectively suppressing weak binding and false-positive signals, resulting in clearer and more reproducible Tm peaks and less overlap between peaks.

[0107] Probes can be shortened to avoid overlapping interference: Conserved regions across different IBV genotypes are relatively short, requiring shorter probes to achieve the ideal Tm value. The MGB structure inserts into the minor groove of the DNA double helix, enhancing probe binding to target DNA. Even with probes only 13–16 nt, the Tm can be increased by 5–10°C, preventing debonding due to insufficient length. LNA bases lock their conformation, increasing base pairing affinity. Each LNA modification can increase the Tm by 2–8°C, ensuring a sufficiently high binding temperature for short probes.

[0108] Example 2

[0109] A kit for simultaneous detection of IBV and its six genotypes.

[0110] Includes the following components:

[0111] (1) Specific primers and probes for the six genotypes: GI-1, GI-13, GI-19, GI-22, GVI-1, and GI-7;

[0112] (2) primers and probes targeting universal IBV;

[0113] (3) Reverse transcriptase, Taq enzyme, buffer, magnesium ions, dNTPs, PCR enhancer TMAO, etc.;

[0114] (4) Positive control and negative control

[0115] The optimal reaction system (1×, 20µL / reaction) is as follows:

[0116] Buffer (Tris-HCl, KCl): 5×, 5µL

[0117] Mg²⁺: 25mM, 3µL

[0118] dNTP: 20mM, 0.1µL

[0119] GI-1 upstream primer: 20µM, 0.3µL

[0120] GI-1 downstream primer: 20µM, 0.3µL

[0121] GI-1 probe: 20µM, 0.15µL

[0122] GI-13 upstream primer: 20µM, 0.35µL

[0123] GI-13 downstream primer: 20µM, 0.35µL

[0124] GI-13 probe: 20µM, 0.15µL

[0125] GI-19 upstream primer: 20µM, 0.2µL

[0126] GI-19 downstream primer: 20µM, 0.2µL

[0127] GI-19 probe: 20µM, 0.15µL

[0128] GI-22 upstream primer: 20µM, 0.4µL

[0129] GI-22 downstream primer: 20µM, 0.4µL

[0130] GI-22 probe: 20µM, 0.2µL

[0131] GVI-1 upstream primer: 20µM, 0.25µL

[0132] GVI-1 downstream primer: 20µM, 0.25µL

[0133] GVI-1 probe: 20µM, 0.1µL

[0134] GI-7 upstream primer: 20µM, 0.25µL

[0135] GI-7 downstream primer: 20µM, 0.25µL

[0136] GI-7 probe: 20µM, 0.1µL

[0137] IBV upstream primer: 20µM, 0.3µL

[0138] IBV downstream primer: 20µM, 0.3µL

[0139] IBV probe: 20µM, 0.1µL

[0140] DNA polymerase: 5U / µL, 0.1µL

[0141] Reverse transcriptase: 200 U / µL, 0.05 µL

[0142] RNase inhibitor: 40U / µL, 0.25µL

[0143] Sucrose: 50% by mass, 2µL

[0144] Glycerol: 0.875µL

[0145] TMAO: 5M, 1µL

[0146] ddH2O: Add to a total volume of 20µL

[0147] In the present invention, the positive control uses the amplified target sequences of 6 genotypes and IBV as templates to construct recombinant vectors as positive controls, and nuclease-free water is used as a negative control. The detailed information of the target sequences is as follows:

[0148] 1. Name: GI-1 genotype; Sequence number: SEQ NO: 23; Amplified fragment sequence (5'-3'): TGTGGTTTAATTCACTTTCAGTTTCAATTGCTTACGGTCCTCTTCAAGGTGGTTGCAAGCAATCTGTCTTTAGTGGTAGAGCAACCTGTTGTTATGCTTACTCATATGGAGGTCCTTTGCTGTGTAAAGGTGTTTATTCAGGTGAGTTAGATCATAATTTTGAATGTGGACTGTTAGTTTATGTTACTAAGAGCGGT

[0149] 2. Name: GI-13 genotype; Sequence number: SEQ NO: 24; Amplified fragment sequence (5'-3'): CCTTGTTTGTGCTAGAGAGTATAATGGCTTGCTTGTGTTGCCTCCTATTATTACTGCAGACATGCAAACTATGTATACTAGCTCTTTAGTAGCCTCTATGGCTTTAGGTGG

[0150] 3. Name: GI-19 genotype; Sequence number: SEQ NO: 25; Amplified fragment sequence (5'-3'): GTGCCATAGATGTCTTTGTTGTACAGGGCAGCTATGGTCTTAATTATTACAAGGTCAATCCTTGTGAAGATGTTAACCAACAGTTTGTAGTGTCTGGTGGCAATATAGTTGGCATTCTTACTTCTAGAAATGAAACAGGTTC

[0151] 4. Name: GI-22 genotype; Sequence number: SEQ NO: 26; Amplified fragment sequence (5'-3'): TGGCTTGTGGTTTAATTCATTGTCAGTTTCGCTTGCTTATGGACCACTTCAAGGTGGGTGTAAGCAGTCGGTTTTTAGTAGTAGAGCCACTTGTTGTTATGCTTATTCATATAATGGTCCTCGC

[0152] 5. Name: GVI-1 genotype; Sequence number: SEQ NO: 27; Amplified fragment sequence (5'-3'): GGCAGTCGTATATTTACTTCTGAAACAGTACCTACTGTCACTGTTAATTTTGTAAATAATGTGGTTTTAGATAGGTGTGTTGATTATAATATCTATGGTAGAGTAGGTCAAGGTTTTATTTCTAATATAACTGATTCTGTGAAGG

[0153] 6. Name: GI-7 genotype; Sequence number: SEQ NO: 28; Amplified fragment sequence (5'-3'): TGGCAATTTTAGATACTTCAGGTGCCATAGACACTTTCGTTGTACAAGGTGAATATGGTCCCAATTATTATAAGGTTAACCCTTGTGAAGATGTTAATCAGCAGTTTGTAGTGTCAGGCGGTAAGTTAGTAGGCATTCTGAC

[0154] 7. Name: IBV; Sequence number: SEQ NO: 29; Amplified fragment sequence (5'-3'): CAGCAGCATCTAGTAGAGCACCATCACGTGAAGTTTCGCGTGGTCGCAGGAGTGGTTCTGAAGATGATCTTATTGCTCGTG

[0155] In probe melting curve analysis, primer and probe concentration parameters are key variables influencing detection efficiency. Their optimization directly determines amplification kinetics and melting curve morphology (including Tm peak resolution and nonspecific signal level). Primer concentration indirectly affects the total amount of probe-template complex formed by regulating amplification efficiency and target sequence copy number yield, ultimately reflecting changes in Tm peak height and stability. Probe concentration, on the other hand, influences target sequence capture efficiency through a competitive binding mechanism and is positively correlated with fluorescence signal intensity, directly determining the signal-to-noise ratio and background interference level of the melting curve.

[0156] Excessive primer concentration (>300nM) can easily trigger nonspecific amplification products and primer-dimer formation, leading to the appearance of pseudo-melting peaks. Conversely, insufficient concentration (<100nM) can reduce amplification efficiency and target yield, manifesting as a significant decrease in Tm peak intensity or even signal loss. Similarly, too low a probe concentration (<150nM) can reduce detection sensitivity and melting peak resolution, while too high a concentration (>200nM) can cause background fluorescence quenching, resulting in melting curve baseline drift, peak overlap, and difficulties in genotyping.

[0157] The primer-probe optimization scheme proposed in the present invention mainly includes the following steps:

[0158] (1) Single-channel system optimization: First, five primer concentration gradients were set at 50 nM intervals in the range of 100-300 nM (the probe was fixed at 150 nM), and the optimal primer concentration was screened based on the Ct value, Tm peak height, and background signal intensity of real-time fluorescence quantitative PCR; then, five probe concentration gradients were set at 12.5 nM increments in the range of 150-200 nM for secondary optimization;

[0159] (2) Dual-target system interference test: Select a combination, adjust the primer concentration ratio (200:150 → 150:150 → 100:150) under the condition of fixed probe concentration, and analyze the competitive amplification effect through melting curve analysis;

[0160] (3) Seven-fold system calibration: For targets with ambiguous melting peaks, the primer concentration is moderately increased (increase ≤ 25nM), and for targets with non-specific peaks, the concentration is gradually reduced (reduction ≤ 50nM). This hierarchical optimization strategy effectively achieves the specific separation of each target melting peak and optimization of signal intensity in the multiplex detection system through system regulation.

[0161] Optimizing the reaction system is a key technical step in probe melting curve analysis. In addition to primer and probe concentrations, key parameters such as buffer composition, Mg²⁺ concentration, dNTP levels, and PCR enhancers significantly influence the peak height characteristics, peak width parameters, Tm stability, and specific typing efficiency of the melting curve. The buffer, as the microenvironmental foundation for maintaining PCR enzyme activity and nucleic acid hybridization, directly influences the binding stability of the probe-template complex by regulating ionic strength, thereby determining the extent of Tm shift and peak resolution. As a key cofactor of Taq DNA polymerase, Mg²⁺ not only stabilizes the molecular recognition between primer / probe and DNA template but also influences Tm determination by regulating the thermodynamic properties of the nucleic acid duplex. However, its excessive presence can enhance mismatch binding and primer-dimer formation, leading to decreased specificity. As substrates for DNA synthesis, dNTPs must maintain a stoichiometric balance with Mg²⁺ in their concentration gradient. Excessive concentrations can trigger Mg²⁺ chelation, interfering with enzyme activity and Tm accuracy.

[0162] PCR enhancers improve reaction performance through multiple mechanisms of action: increasing primer binding specificity, increasing amplification product yield, and inhibiting nonspecific amplification. Commonly used enhancers can be divided into two categories: ① nonionic surfactants (such as Triton X-100, Tween 20, and NP-40) and ② specificity-enhancing components (such as TMAC, betaine, SSB, glycerol, trehalose, BSA, DMSO, and formamide).

[0163] This study systematically optimized basic parameters such as the buffer system (pH 7.2-8.5), Mg²⁺ gradient (2-5 mM), and dNTP concentration (50-200 µM). Furthermore, the novel introduction of trimethylamine-N-oxide (TMAO) as a novel PCR enhancer led to the construction of a highly efficient and specific melting curve analysis system. TMAO, as an osmotic pressure regulator, promotes correct nucleic acid folding and inhibits mismatch formation. Experiments confirmed that 0.1-1 M TMAO significantly improved the analytical efficiency of probe melting curves. Its mechanisms of action include enhancing the thermal stability of DNA polymerase, enhancing probe-target binding specificity, and inhibiting primer-dimer formation.

[0164] Example 3

[0165] A detection method for a kit for simultaneously detecting IBV and its six genotypes,

[0166] 1. Nucleic Acid Extraction

[0167] Nucleic acid was extracted using a commercial nucleic acid extraction kit.

[0168] 2. PCR Amplification

[0169] Calculate the number of samples to be tested, take n+2 PCR reaction tubes, and add 20µL of reaction solution to each tube; add 5µL each of the negative control, positive control, and sample nucleic acid from the one-step extraction reagent tube to the above PCR reaction tubes, and place them in the fluorescence quantitative PCR instrument.

[0170] The reaction conditions were set up as follows:

[0171] 1. Signal acquisition:

[0172] (1) GI-1 genotype and GI-13 genotype: FAM channel collects fluorescence signals

[0173] (2) GI-19 genotype and GI-22 genotype: fluorescence signal collected in HEX channel

[0174] (3) GVI-1 genotype and GI-7 genotype: fluorescence signal collected in Cy5 channel

[0175] (4) IBV: ROX channel collects fluorescence signals

[0176] 2. PCR reaction conditions:

[0177] (1) Pre-denaturation: 95°C for 30 seconds, cycle number 1

[0178] (2) PCR: first stage 95℃ for 10 seconds, second stage 60℃ for 30 seconds (set to collect fluorescence signal at the end of this stage), cycle number 40

[0179] (3) Melting curve analysis: first stage 95℃ 60 seconds, second stage 40℃ 60 seconds, third stage 65℃ 1 second, fourth stage 93℃ 1 second, cycle number 1

[0180] 3. Result determination

[0181] (1) Determination of the effectiveness of the test kit:

[0182] 1) Weak positive control: Ct values ​​of FAM, HEX, Cy5, and ROX channels are ≤32, and the amplification curve has a clear exponential growth phase.

[0183] 2) Blank control: No amplification curve is observed in the FAM, HEX, Cy5, or ROX channels, or the amplification curve is a straight line or slightly sloping line with no obvious exponential growth period.

[0184] The test results are determined as follows:

[0185] 1GI-1 genotype positive: There are amplification curves in both FAM and ROX channels, and a melting curve peak at 82.0℃±0.5℃ in the FAM channel

[0186] 2. GI-13 genotype positive: There are amplification curves in both FAM and ROX channels, and a melting curve peak at 77.5℃±0.5℃ in the FAM channel

[0187] 3. GI-19 genotype positive: There are amplification curves in both HEX and ROX channels, and a melting curve peak at 79.5℃±0.5℃ in the HEX channel

[0188] 4. GI-22 genotype positive: There are amplification curves in both HEX and ROX channels, and a melting curve peak at 84.5℃±0.5℃ in the HEX channel

[0189] 5. GVI-1 genotype positive: both CY5 and ROX channels have amplification curves, and CY5 has a melting curve peak at 85.5℃±0.5℃

[0190] 6. GI-7 genotype positive: There are amplification curves in both CY5 and ROX channels, and CY5 has a melting curve peak at 81.5±0.5℃

[0191] Experimental results:

[0192] 1. Sensitivity:

[0193] GI-1, GI-13, GI-19, GI-22, GVI-1, GI-7 and IBV standards were diluted 10-fold in a gradient, with a gradient dilution interval of 1×10 6 Copy / uL to 1×10 0 Copies / μL, according to the above reaction system and reaction conditions, the results are shown in Figure 1-Figure 7 The minimum detection limit of GI-1, GI-13, GI-19, GI-22, GVI-1, GI-7 and IBV can reach 1×10 0 copies / μL, showing good sensitivity.

[0194] Figure 1 is the sensitivity amplification curve of GI-1 genotype; Figure 2 is the sensitivity amplification curve of GI-13 genotype; Figure 3 is the sensitivity amplification curve of GI-19 genotype; Figure 4 is the sensitivity amplification curve of GI-22 genotype; Figure 5 GVI-1 genotype sensitivity amplification curve Figure 6 The sensitivity amplification curve for GI-7 is the genotype; Figure 7 This is the sensitivity amplification curve of IBV universal genotype.

[0195] 2. Effect of PCR enhancer TMAO on melting curve:

[0196] The GI-1 genotype standard was tested with and without TMAO added according to the above reaction system and reaction conditions. The results are as follows: Figure 8 As shown in the figure, after adding TMAO, the melting curve shows a single peak, while the melting curve without TMAO shows a non-specific melting peak. This result shows that an appropriate amount of TMAO can enhance the specificity of the reagent.

[0197] 3. Effect of probe MGB modification on melting curve:

[0198] The HEX channel probe of GI-22 genotype was modified with MGB and BHQ at the 3' end respectively, and tested according to the above reaction system and reaction conditions. The results are as follows: Figure 9 As shown in the figure, the Tm values ​​of MGB and BHQ modification were 80.45 and 76.80, respectively, indicating that MGB modification can significantly improve Tm.

[0199] 4. Effect of probe LNA modification on melting curve:

[0200] The CY5 channel probe sequence of the GVI-1 genotype was modified with only 0, 1, 2, 3, and 4 LNAs, and tested according to the above reaction system and reaction conditions. The results are as follows: Figure 10 As shown, the Tm values ​​after modification with 0, 1, 2, 3, and 4 LNAs were 76.80, 77.41, 78.47, 81.06, and 82.48, respectively, indicating that Tm was significantly improved with the increase of LNA modification.

[0201] 5. IBV seven-fold standard curve:

[0202] like Figure 11-17 As shown, in 1×10 6 copies / µL~1×10 2 The amplification curve has a good linear relationship within the dilution gradient range of copies / µL. The standard curve of the detection method was established in this range, and the amplification efficiency was between 90-110%. The correlation coefficient R 2 ≥0.99, which can achieve accurate quantification of viral load.

[0203] Correlation coefficient R of GI-1 standard curve 2 is 0.99, amplification efficiency E=101%, and the standard curve calculation formula is Y=-3.2908X+37.80;

[0204] Correlation coefficient R of GI-13 standard curve 2 is 1.00, amplification efficiency E=103%, and the standard curve calculation formula is Y=-3.2627X+36.89;

[0205] Correlation coefficient R of GI-19 standard curve 2is 1.00, amplification efficiency E=99%, and the standard curve calculation formula is Y=-3.3475X+36.50;

[0206] Correlation coefficient R of GI-22 standard curve 2 is 1.00, amplification efficiency E=103%, and the standard curve calculation formula is Y=-3.2507X+36.63;

[0207] GVI-1 standard curve correlation coefficient R 2 is 1.00, amplification efficiency E=93%, and the standard curve calculation formula is Y=-3.5043X+37.15;

[0208] Correlation coefficient R of GI-7 standard curve 2 is 1.00, amplification efficiency E=106%, and the standard curve calculation formula is Y=-3.1787X+35.60;

[0209] Universal genotype standard curve correlation coefficient R 2 is 1.00, the amplification efficiency E=104%, and the standard curve calculation formula is Y=-3.2187X+36.13.

[0210] Example 4

[0211] Clinical sample testing:

[0212] The positive samples used in this application include six major genotypes of avian infectious bronchitis virus (IBV): GI-1 (Mass-like), GI-13 (4 / 91-like), GI-19 (QX-like), GI-22 (LDT3-A-like), GVI-1, and GI-7 (TW-I-like). These samples were collected from chickens suspected of IBV infection at farms in various regions of China. The subjects exhibited typical clinical symptoms, including respiratory distress, decreased egg production, and renal lesions. Sample types included pharyngeal swabs, respiratory tissue, and renal tissue, all commonly used clinical materials for IBV isolation and detection.

[0213] To evaluate the specificity of the detection method, clinically positive samples of four common poultry viruses were selected as non-target pathogens for verification, namely: Infectious Bursal Disease Virus (IBDV); Newcastle Disease Virus (NDV); Chicken Anemia Virus (CAV); and Avian Reovirus (ARV).

[0214] All clinical samples were typed and identified by Shandong Xinde Technology Co., Ltd. through virus isolation, RT-PCR amplification and sequencing analysis. After positive results were confirmed, they were stored at -80°C for a long time to ensure the stability and data reliability of subsequent experiments.

[0215] 1. The collected GI-1 and GI-13 genotype strains and the samples infected with the two strains were tested according to the above detection method. The results are as follows: Figure 18-21 As shown, the peak values ​​of the FAM channel melting curves after single infection and mixed infection of the two viruses showed high consistency.

[0216] 2. The collected GI-19 and GI-22 genotype strains and the samples infected with the two strains were tested according to the above detection method. The results are as follows: Figure 22-25 As shown, the peak values ​​of the HEX channel melting curves after single infection and mixed infection of the two viruses showed high consistency.

[0217] 3. The collected GVI-1 and GI-7 genotype strains and the samples infected with the two strains were tested according to the above detection method. The results are as follows: Figures 26-29 As shown, the melting curve peaks of the CY5 channel after single infection and mixed infection of the two viruses showed high consistency.

[0218] 4. Specific samples including avian bursal disease virus (IBDV), Newcastle disease virus (NDV), chicken infectious anemia virus (CAV), and avian reovirus (ARV) were tested. The results were as follows: Figure 30 As shown, it shows that it has good specificity and no melting curve peak.

[0219] The above embodiments are intended only to illustrate the technical concepts and features of the present invention. Their purpose is to enable those skilled in the art to understand the contents of the present invention and implement them accordingly. They are not intended to limit the scope of protection of the present invention. Any equivalent changes or modifications made based on the essence of the present invention are intended to be covered by the scope of protection of the present invention.

Claims

1. A primer-probe combination for simultaneous detection of IBV and its six genotypes, characterized by: The primer-probe combination is used to detect avian infectious bronchitis virus of GI-1 genotype, avian infectious bronchitis virus of GI-13 genotype, avian infectious bronchitis virus of GI-19 genotype, avian infectious bronchitis virus of GI-22 genotype, avian infectious bronchitis virus of GVI-1 genotype, avian infectious bronchitis virus of GI-7 genotype or avian infectious bronchitis virus of universal genotype; The composition for detecting the GI-1 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 1; a downstream primer having a nucleotide sequence as shown in SEQ NO: 2; and a probe having a nucleotide sequence as shown in SEQ NO: 3; The composition for detecting the GI-13 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 4; a downstream primer having a nucleotide sequence as shown in SEQ NO: 5; and a probe having a nucleotide sequence as shown in SEQ NO: 6; The composition for detecting the GI-19 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 7 or SEQ NO: 22; a downstream primer having a nucleotide sequence as shown in SEQ NO: 8; and a probe having a nucleotide sequence as shown in SEQ NO: 9; The composition for detecting the GI-22 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 10; a downstream primer having a nucleotide sequence as shown in SEQ NO: 11; and a probe having a nucleotide sequence as shown in SEQ NO: 12; The composition for detecting the avian infectious bronchitis virus of the GVI-1 genotype comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 13; a downstream primer having a nucleotide sequence as shown in SEQ NO: 14; and a probe having a nucleotide sequence as shown in SEQ NO: 15; The composition for detecting the GI-7 genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 16; a downstream primer having a nucleotide sequence as shown in SEQ NO: 17; and a probe having a nucleotide sequence as shown in SEQ NO: 18; The composition for detecting the universal genotype of avian infectious bronchitis virus comprises: an upstream primer having a nucleotide sequence as shown in SEQ NO: 19; a downstream primer having a nucleotide sequence as shown in SEQ NO: 20; and a probe having a nucleotide sequence as shown in SEQ NO: 21; The 5' ends of SEQ NO: 9 and SEQ NO: 12 were modified with HEX, the 3' end of SEQ NO: 9 was modified with BHQ2, and the 3' end of SEQ NO: 12 was modified with MGB; The 5' ends of SEQ NO: 15 and SEQ NO: 18 were modified with CY5, the 3' end of SEQ NO: 15 was modified with MGB, and the 3' end of SEQ NO: 18 was modified with BHQ2; The 4th, 7th, 10th and 13th bases at the 5' end of SEQ NO: 3 are modified with locked nucleic acid; The 8th and 11th bases at the 5' end of SEQ NO: 6 are modified with locked nucleic acid; The fourth base at the 5' end of SEQ NO: 9 is modified with a locked nucleic acid; The 4th, 7th and 10th bases at the 5' end of SEQ NO: 12 are modified with locked nucleic acid; The 4th, 7th, 10th and 13th bases at the 5' end of SEQ NO: 15 are modified with locked nucleic acid; The 4th and 7th bases at the 5' end of SEQ NO: 18 were modified with locked nucleic acid.

2. The primer-probe combination for simultaneous detection of IBV and its six genotypes according to claim 1, characterized in that: The 5' ends of SEQ NO: 3 and SEQ NO: 6 were modified with FAM, and the 3' ends were modified with BHQ1.

3. The primer-probe combination for simultaneous detection of IBV and its six genotypes according to claim 1, characterized in that: The 5' end of SEQ NO: 21 was modified with ROX, and the 3' end was modified with BHQ2.

4. A kit for simultaneously detecting IBV and its six genotypes comprising the primer-probe combination according to any one of claims 1 to 3, characterized in that: It also includes reverse transcriptase, Taq enzyme, buffer, magnesium ions, dNTPs, PCR enhancer TMAO, positive control and negative control.

5. The kit for simultaneous detection of IBV and its six genotypes according to claim 4, characterized in that: The reaction system includes: 5µL of buffer, Mg 2+ 25mM 3µL, dNTP 20mM 0.1µL, mixed upstream and downstream primers 20µM 4.1µL, mixed probe 20µM 0.95µL, DNA polymerase 5U / µL 0.1µL, reverse transcriptase 200U / µL 0.05µL, RNase inhibitor 40U / µL 0.25µL, sucrose 50% mass percentage concentration 2µL, glycerol 0.875µL, TMAO 5M 1µL, ddH2O was added to a total volume of 20µL; Among them, in the mixed upstream and downstream primers: 0.3 µL each of the upstream and downstream primers for detecting the GI-1 genotype, 0.35 µL each of the upstream and downstream primers for detecting the GI-13 genotype, 0.2 µL each of the upstream and downstream primers for detecting the GI-19 genotype, 0.4 µL each of the upstream and downstream primers for detecting the GI-22 genotype, 0.25 µL each of the upstream and downstream primers for detecting the GVI-1 genotype, 0.25 µL each of the upstream and downstream primers for detecting the GI-7 genotype, and 0.3 µL each of the upstream and downstream primers for detecting the universal genotype; In the hybrid probe: The probe for detecting GI-1 genotype was 0.15 µL, the probe for detecting GI-13 genotype was 0.15 µL, the probe for detecting GI-19 genotype was 0.15 µL, the probe for detecting GI-22 genotype was 0.2 µL, the probe for detecting GVI-1 genotype was 0.1 µL, the probe for detecting GI-7 genotype was 0.1 µL, and the probe for detecting universal genotype was 0.1 µL.

Images