Magnetic control type electrochemical biosensor of MWCNTs-MoS2 based on CRISPR / Cas12a as well as preparation method and application of magnetic control type electrochemical biosensor

Abstract

The invention provides a magnetic control type electrochemical biosensor of MWCNTs-MoS2 based on CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a as well as a preparation method and application of the magnetic control type electrochemical biosensor. The magnetic control type electrochemical biosensor comprises an aminated multi-walled carbon nanotube-molybdenum disulfide modified screen-printed carbon electrode, wherein a CRISPR-crRNA-Target DNA ternary complex and a ferroferric oxide-gold-single-stranded nucleotide probe are dropwise added on the surface of the screen-printed carbon electrode, and the probe is sheared after the reaction of the CRISPR-crRNA-Target DNA ternary complex and the ferroferric oxide-gold-single-stranded nucleotide probe; the magnetic control type electrochemical biosensor respectively shows wide linear response in the range of 4.6 * 10 < 1 >-4.6 * 10 < 7 > CFU / mL of staphylococcus aureus and 5.5 * 10 < 7 > CFU / mL of salmonella, the detection limit of the magnetic control type electrochemical biosensor to two pathogenic bacteria is as low as 2CFU / mL, and the magnetic control type electrochemical biosensor has good specificity to interfering bacteria, can be used for rapid detection of food safety and has good practicability.

Description

Technical Field

[0001] The present invention belongs to the field of sensor preparation and biological detection technology, and specifically relates to a CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor and its preparation method and application. Background Art

[0002] Milk is rich in protein and milk fat, nutrients that foster the growth and reproduction of microorganisms, particularly Staphylococcus aureus and Salmonella, two major foodborne pathogens. Staphylococcus aureus and Salmonella are widely present in food processing, storage, and consumption. Staphylococcus aureus can cause food poisoning by producing enterotoxins, while Salmonella is a major cause of diarrhea and other serious gastrointestinal illnesses. These two pathogens pose a serious threat to certain populations, such as those with weakened immune systems. Therefore, while implementing source control, developing rapid detection methods for foodborne pathogens is crucial for ensuring dairy product safety and protecting public health.

[0003] At present, the classic detection methods for foodborne pathogens include plate counting and qPCR. Although these diagnostic technologies have a certain degree of sensitivity, they are often time-consuming and cumbersome to operate. Therefore, the development of a fast, highly sensitive and convenient detection method is crucial to ensuring food safety. Electrochemical analysis driven by electrical signals has become one of the hot topics in food pathogen detection research in recent years due to its rapid and sensitive advantages. However, conventional electrochemical biosensors require long-term incubation of small molecules such as aptamers and single-stranded nucleic acids, and the detection operation is relatively cumbersome, making it impossible to quickly and easily detect foodborne pathogens. Therefore, it is necessary to develop a sensor that is easy to operate, highly sensitive, specific and stable for the detection of foodborne pathogens. Summary of the Invention

[0004] In view of some deficiencies in the prior art, the present invention provides a CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor and its preparation method and application. The magnetically controlled electrochemical biosensor comprises an amino-modified multi-walled carbon nanotube-molybdenum disulfide-modified screen-printed carbon electrode, on the surface of which a CRISPR-crRNA-Target DNA ternary complex and a probe sheared by a ferroferric oxide-gold-single-stranded nucleotide probe are dripped. The magnetically controlled electrochemical biosensor is respectively tested on 4.6×10 1 ~4.6×10 7 CFU / mL CFU / mL, Salmonella 5.5×10 1 ~5.5×10 7The assay showed a wide linear response within the range of CFU / mL, with the detection limit for both pathogens as low as 2 CFU / mL and good specificity for interfering bacteria. It can be used for rapid detection of food safety and has good practicality.

[0005] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0006] The present invention first provides a CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor; the magnetically controlled electrochemical biosensor comprises: a screen-printed carbon electrode modified with amino-modified multi-walled carbon nanotubes and molybdenum disulfide, and a shear product dripped onto the surface of the screen-printed carbon electrode;

[0007] The sheared product is obtained by assembling and shearing the CRISPR-crRNA-Target DNA ternary complex and the ferroferric oxide-gold-single-stranded nucleotide probe;

[0008] The ferroferric oxide-gold-single-stranded nucleotide probe comprises a gold-coated ferroferric oxide composite material and a single-stranded nucleotide ssDNA fixed on its surface, which is modified with a thiol group at the 5' end and methylene blue (MB) at the 3' end; the sequence of the ssDNA is HS-SH C6-TTTTTTTTTTTTTTTTTTTT-MB;

[0009] The CRISPR-crRNA-Target DNA ternary complex is obtained by combining CRISPR / Cas12a, crRNA and Target DNA;

[0010] The crRNA includes one or both of the crRNA of the Salmonella target and the crRNA of the Staphylococcus aureus target;

[0011] The target DNA includes one of Staphylococcus aureus target DNA and Salmonella target DNA.

[0012] Preferably, the nucleotide sequence of the crRNA of the Staphylococcus aureus target is shown in SEQ ID NO.1;

[0013] The nucleotide sequence of the crRNA of the Salmonella target is shown in SEQ ID NO.2;

[0014] The nucleotide sequence of the Staphylococcus aureus Target DNA is shown in SEQ ID NO.3;

[0015] The nucleotide sequence of the Salmonella Target DNA is shown in SEQ ID NO.4.

[0016] The present invention also provides a method for preparing the above-mentioned CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor, the preparation method comprising:

[0017] (1) Preparation of Fe3O4-Au-single-stranded nucleotide probe:

[0018] Fe3O4 was dissolved in ultrapure water, and then chloroauric acid (HAuCl4) solution and iced sodium borohydride (NaBH4) solution were added thereto, and the mixture was stirred and mixed in an ice-water bath to obtain Fe3O4@Au;

[0019] The Fe3O4@Au was mixed with the activated ssDNA and incubated to obtain the Fe3O4@Au-ssDNA probe after the incubation.

[0020] (2) Preparation of Aminated Multi-walled Carbon Nanotube-Molybdenum Disulfide Modified Screen-Printed Carbon Electrode:

[0021] The amino-modified multi-walled carbon nanotubes were ultrasonically dispersed in pure water and drop-coated on the surface of screen-printed carbon electrode (SPCE). The screen-printed carbon electrode modified with multi-walled carbon nanotubes was dried and designated as MWCNTs / SPCE.

[0022] MoS2 was ultrasonically dispersed in ultrapure water to obtain a MoS2 dispersion, which was then drop-coated onto the surface of MWCNTs / SPCE to obtain a multi-walled carbon nanotube / molybdenum disulfide material-modified screen-printed carbon electrode, denoted as MWCNTs-MoS2 / SPCE.

[0023] (3) Preparation of MWCNTs-MoS2 magnetically controlled electrochemical biosensor based on RPA-CRISPR / Cas12a:

[0024] CRISPR / Cas12a, crRNA, 10× NE buffer 2.1, enzyme-free water, and target nucleic acid Target DNA were mixed and self-assembled to obtain a CRISPR-crRNA-Target DNA ternary complex;

[0025] The CRISPR-crRNA-Target DNA ternary complex was mixed with Fe3O4@Au-ssDNA and reacted. After the reaction, the precipitate was collected by an external magnet, and the supernatant was added dropwise to the MWCNTs-MoS2 / SPCE surface to obtain the CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor.

[0026] Preferably, in step (1), the dosage ratio of Fe3O4, ultrapure water, chloroauric acid and iced sodium borohydride solution is 15 mg:150 mL:3 mL:0.9 mL; the concentration of the chloroauric acid solution is 6 mg / mL, the concentration of the iced sodium borohydride is 0.2 M, and the stirring time in the ice-water bath is 15 min.

[0027] Preferably, in step (1), the step of activating ssDNA comprises: thiolating the ssDNA with Tris-HCl (10 mM, pH 6) containing EDTA, NaCl, and TCEP, and then dissolving the ssDNA in TE buffer to obtain activated ssDNA;

[0028] The volume ratio of the activated ssDNA and Fe3O4@Au is 1:1;

[0029] The mixed incubation conditions are: incubation at 4°C overnight.

[0030] Preferably, in step (2), the ratio of the amino-modified multi-walled carbon nanotube material to pure water is 1 mg:2 mL, and the drop-coating amount is 10 μL;

[0031] The usage ratio of MoS2 and ultrapure water is 5 mg:1 mL, and the drop coating volume is 10 μL.

[0032] Preferably, in step (3), the amounts of CRISPR / Cas12a, crRNA, 10×NE buffer 2.1, enzyme-free water, and target nucleic acid Target DNA are 1 μL: 1.5 μL: 3 μL: 21.5 μL: 3 μL; wherein the concentration of CRISPR / Cas12a is 1 μM; the concentration of crRNA is 1 μM;

[0033] The crRNA includes one or both of the crRNA of the Salmonella target and the crRNA of the Staphylococcus aureus target;

[0034] The target DNA includes one of Staphylococcus aureus target DNA and Salmonella target DNA.

[0035] Preferably, in step (3), the self-assembly conditions are: self-assembly at 37°C for 10 min;

[0036] The dosage ratio of the CRISPR-crRNA-Target DNA ternary complex to Fe3O4@Au-ssDNA is 30 μL:2 μL, wherein the concentration of Fe3O4@Au-ssDNA is 5 μM;

[0037] The reaction conditions include: reacting at 37° C. for 30 min.

[0038] The present invention also provides the use of the above-mentioned CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor in detecting foodborne pathogens.

[0039] Preferably, the foodborne pathogens include foodborne pathogens in milk.

[0040] Preferably, the foodborne pathogenic bacteria include one of Staphylococcus aureus and Salmonella.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] (1) In the present invention, MWCNTs (multi-walled carbon nanotubes) and MoS2 (molybdenum disulfide) with high conductivity and large specific surface area are used as electrode materials. Among them, MWCNTs can promote electron transfer, and MoS2 enhances the electrochemical reaction activity of the sensor. The combination of the two greatly improves the response speed and signal strength of the electrochemical sensor, making the signal detection more sensitive, and can effectively solve the problem that the signal is usually not firmly fixed and easily lost, and can form a signal probe to amplify the electrochemical signal. The miniaturized screen-printed carbon electrode (SPCE) used in the present invention not only ensures good electrochemical performance, but can also be used in convenient handheld devices, thereby improving the adaptability and practicality of detection. Its efficient and fast detection performance makes it have great application potential in fields such as rapid diagnosis and on-site detection.

[0043] (2) The present invention combines RPA (Recombinase Polymerase Amplification) and CRISPR / Cas12a technology to significantly improve the sensitivity and selectivity of the biosensor. As an isothermal amplification technology, RPA can amplify target DNA or RNA sequences without high temperature conditions through a special recombinase system, greatly reducing the dependence on equipment, and can perform rapid and sensitive amplification at low temperatures. This allows the sensor to generate a detectable signal through the amplification reaction even when the concentration of the target molecule is extremely low, ensuring the accuracy and reliability of the test results. CRISPR technology brings extremely high specificity to the sensor. The CRISPR system can accurately identify and bind to specific nucleic acid sequences by introducing specific gene editing effects into the target DNA sequence. This high specificity enables the sensor to accurately distinguish the target molecule and avoid cross-reactions or interference with other non-target molecules, thereby greatly improving the selectivity of the detection. This study combines the precise recognition capabilities of CRISPR with the efficient amplification capabilities of RPA to create a CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor. This sensor not only exhibits extremely high sensitivity but also effectively filters out noise in complex biological samples, further improving detection accuracy and reliability. This combination of technologies gives the sensor significant advantages in detecting low-concentration targets, making it particularly suitable for applications requiring high sensitivity and accuracy, such as early diagnosis and on-site testing.

[0044] (3) The magnetic control technology in the present invention can effectively control the working process of the sensor, especially in the enrichment and separation of target substances, through the precise regulation of the external magnetic field. During the detection process, the magnetic material can be quickly attracted by the magnetic field, and the signal substance in the supernatant is more easily enriched on the sensor surface, thereby increasing the concentration of the target substance. This process not only significantly improves the sensitivity of the detection, but also reduces the errors caused by impurities or non-specific molecular interference in the sample, making the detection results more accurate. The sensor of the present invention avoids the complex process of incubating aptamers, ssDNA, hpDNA on the electrode of conventional electrochemical biosensors, which not only improves the sample processing efficiency and reduces errors, but also enhances the recognition ability of the sensor in complex samples, so that the sensor can play its advantages in more application scenarios.

[0045] (4) The RPA-CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor prepared in the present invention effectively improves the sensitivity and specificity in the detection process of Staphylococcus aureus / Salmonella, shortens the detection time, and obtains the electrochemical signal generated by CRISPR cutting ssDNA to separate the electrical signal analyte MB from the electrode within 30 minutes. This sensor can not only accurately detect the presence of Staphylococcus aureus and Salmonella in a wide concentration range, but is also easy to operate and has no special requirements for detection personnel, and can achieve rapid and trace detection of different pathogens.

[0046] (5) Based on pure culture medium, the 1 ~4.6×10 7 CFU / mL (Staphylococcus aureus) and 5.5×10 1 ~5.5×10 7 The sensor exhibited good linearity across the CFU / mL (Salmonella) concentration range, with a detection limit of 2 CFU / mL. Furthermore, compared to ELISA and fluorescence methods for Staphylococcus aureus, which have detection limits exceeding 4.3 CFU / mL and detection times exceeding 3 hours, the sensor of the present invention was able to detect Staphylococcus aureus in just 65 minutes with a detection limit of 2 CFU / mL. Compared to fluorescence, colorimetry, and electrochemical methods described in the prior art for Salmonella, which have detection limits exceeding 40 CFU / mL and times exceeding 2 hours, the sensor of the present invention was able to detect Salmonella in just 65 minutes with a detection limit of 2 CFU / mL. Therefore, the magnetically controlled biosensor of the present invention offers superior performance and faster detection times. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 TEM images of Fe3O4(A) and Fe3O4@Au(B) composite materials.

[0048] Figure 2 Hysteresis regression curves of Fe3O4 and Fe3O4@Au.

[0049] Figure 3 Circular dichroism spectra of Fe3O4@Au and Fe3O4@Au-ssDNA.

[0050] Figure 4 SEM characterization images of nanomaterials MWCNTs (A), nanomaterials MoS2 (B) and MWCNTs-MoS2 (C).

[0051] Figure 5 X-ray diffraction patterns (XRD) of MWCNTs-MoS2, MWCNTs, and MWCNTs-MoS2.

[0052] Figure 6 The electrodes with different modified materials were exposed to 5mM [Fe(CN)6] 3- / 4- CV graphs in solution (A) and electrodes with different modified materials at 10 mM [Fe(CN)6] 3- / 4- EIS graph in solution (B).

[0053] Figure 7 Agarose gel electrophoresis (2%) shows the RPA amplification validation of Staphylococcus aureus (A) and Salmonella (B).

[0054] Figure 8 Figure 1 is an electrochemical verification diagram of the magnetic electrochemical biosensor; Figure A is an electrochemical verification diagram of Staphylococcus aureus; Figure B is an electrochemical verification diagram of Salmonella.

[0055] Figure 9 This is a PAGE verification diagram for CRISPR / Cas12a cleavage conditions; Figure A is a verification diagram for the cleavage conditions of Staphylococcus aureus; Figure B is a verification diagram for the cleavage conditions of Salmonella.

[0056] Figure 10 The performance optimization of the magnetic electrochemical biosensor based on different factors is shown, where A is the optimization of the volume addition ratio of MWCNTs and MoS2; B is the optimization of the ssDNA incubation concentration; C is the optimization of the volume addition ratio of Cas12a and crRNA; and D is the optimization of the system incubation time.

[0057] Figure 11 Schematic diagram of the standard curve, where A is the drawing of the standard curve of pure culture of Staphylococcus aureus, B is the drawing of the standard curve of pure culture of Salmonella, C is the drawing of the standard curve of Staphylococcus aureus in milk samples; D is the drawing of the standard curve of Salmonella in milk samples.

[0058] Figure 12 Schematic diagram of the specificity of the electrochemical biosensor for detecting Staphylococcus aureus (A) and Salmonella (B).

[0059] Figure 13 Schematic diagram of the stability of the magnetic electrochemical biosensor.

[0060] Figure 14 Schematic diagram of the difference between the biosensor before and after adding the material. DETAILED DESCRIPTION

[0061] The present invention will be further described below in conjunction with the accompanying drawings and specific examples, but the scope of protection of the present invention is not limited thereto. It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used are not indicated by manufacturers and are conventional products that can be purchased from the market.

[0062] In the following examples, the sequences involved are:

[0063] Staphylococcus aureus crRNA (SEQ ID NO.1):

[0064] UAAUUUCUACUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC, biosynthesized by Qingke.

[0065] Salmonella crRNA (SEQ ID NO.2):

[0066] UAAUUUCUACUAAGUGUAGAUAAATAGAAGAGTACGCTTAAAAC, biosynthesized by Qingke.

[0067] Staphylococcus aureus target nucleic acid Target DNA (SEQ ID NO.3):

[0068] GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGT.

[0069] Salmonella target nucleic acid Target DNA (SEQ ID NO.4):

[0070] GCGGCTGCTCGCCTTTGCTGGTTTAGGTTTTGGCGGCGCTACGTTTTGCTTCACGGAATTTAAAATAGAAGAGTACGCTTAAAACCACCGATAAAATAACAAAAACCGGCAGTGGGAATCCCGGCAGAGTTCCCATTGAAATGGTCAAAATAGCCGTAACAACCAATACAAATGGGT.

[0071] ssDNA: HS-SH C6-TTTTTTTTTTTTTTTTTTTT-MB (SEQ ID NO. 5), synthesized by Sangon;

[0072] Partial nuc gene of Staphylococcus aureus (PCR product of Staphylococcus aureus, SEQ ID NO.6):

[0073] .

[0074] Salmonella-specific invA partial gene (Salmonella PCR product, SEQ ID NO.7):

[0075] CTAACGACGACCCTTCTTTTTCCTCAATACTGAGCGGCTGCTCGCCTTTGCTGGTTTTAGGTTTGGCGGCGCTACGTTTTGCTTCACGGAATTTAAAATAGAAGAGTACGCTTAAAACCACCGATAAAAATAACAAAAACCGGCAGTGGGAATCCCGGCAGAGTTCCCATTGAAATGGTCAAAA TAGCCGTAACAACCAATACAAATGGGTTGTTCAACAGCTGCGTCATGATATTCCGCCCCATATTATCGCTATCGCCATTTACGCGGGTCACGATAAAACCGGCACTAATCGCAATCAACAATGCGGGGATCTGGGCGACAAGACCATCACCAATGGTCAGCATGGTATAAGTAGACAGGGCGG.

[0076] Example 1: Preparation of MWCNTs-MoS2 magnetically controlled electrochemical biosensor based on RPA-CRISPR / Cas12a S1. Preparation of ferroferric oxide-gold-single-stranded nucleotide probe Fe3O4@Au-ssDNA:

[0077] Preparation of S11.Fe3O4@Au

[0078] Fe3O4 was synthesized via a coprecipitation method. The steps involved dissolving FeCl3·6H2O and FeCl2·4H2O in deionized water at a molar ratio of 2:1 and stirring under nitrogen to prevent the formation of Fe2O3. Sodium hydroxide solution was then added dropwise at 60°C to adjust the solution's pH to 10 and allowed to react for 30-60 minutes. Black Fe3O4 formed with the addition of the alkali solution. After the reaction, the precipitate was collected by magnetic separation, washed repeatedly with deionized water and ethanol to remove impurities, and finally dried under vacuum at 60°C to obtain pure Fe3O4 powder.

[0079] 15 mg of the Fe3O4 powder prepared above was dissolved in 150 mL of ultrapure water and mixed by ultrasonication. Then, 3 mL of 6 mg / mL HAuCl4 was added and stirred in an ice-water bath for 1 h. Then, 0.9 mL of 0.2 M ice-cold NaBH4 was slowly added within 3 min. The mixture was stirred in the ice-water bath for 15 min. When the color of the solution changed from light brown to dark purple, it was collected by magnetic separation, washed three times with anhydrous ethanol, and dried in vacuum at 50°C to obtain Fe3O4@Au.

[0080] Figure 1TEM characterization of Fe3O4 and Fe3O4@Au. It can be seen from the figure that the Fe3O4 nanoparticles are spherical and densely stacked together ( Figure 1 A). The particle size of Fe3O4@Au increases significantly, and it can be seen that multiple gold nanoparticles are immobilized on Fe3O4 ( Figure 1 B), Demonstrated, efficient synthesis of Fe3O4@Au.

[0081] Figure 2 The hysteresis regression curves (VSM) of Fe3O4 and Fe3O4@Au further prove the successful synthesis of the composite material Fe3O4@Au.

[0082] S12. Thiolation of ssDNA and preparation of Fe3O4@Au-ssDNA:

[0083] The disulfide bonds of ssDNA were thiolated using Tris-HCl (10 mM, pH 6) containing 1 mM EDTA, 10 mM NaCl, and 100 mM TCEP, and the solution was diluted to 10 μM to obtain a ssDNA stock solution. The ssDNA stock solution was stored at -20°C, and TCEP was prepared before use.

[0084] Take 50 μL of ssDNA stock solution and mix it evenly with 50 μL of Fe3O4@Au with a concentration of 1 mg / mL. The mixture is placed in a refrigerator and incubated overnight to allow ssDNA to tightly bind to Fe3O4@Au through Au-S bonds. Finally, Fe3O4@Au-ssDNA with a final concentration of 5 μM is prepared.

[0085] Figure 3 Circular dichroism spectra of Fe3O4@Au and Fe3O4@Au-ssDNA characterized the molecular chirality and secondary structure of Fe3O4@Au bound to ssDNA. The results confirmed the successful preparation of Fe3O4@Au-ssDNA.

[0086] Preparation of S2.MWCNTs-MoS2 / SPCE:

[0087] 1.0 mg of MWCNTs was weighed and placed in 2 mL of ultrapure water, and ultrasonicated at room temperature for 1 h to obtain a 0.5 mg / mL MWCNTs uniform dispersion.

[0088] 0.6g Na2MnO4 and 0.75g CH4N2S were weighed and added to 60mL ultrapure water. After ultrasonic stirring for 30 minutes, the mixture was evenly dispersed in a reactor and placed in a 200°C oven for a hydrothermal reaction for 48 hours. After the reaction was completed, it was naturally cooled. The resulting black liquid was washed with anhydrous ethanol by centrifugation multiple times (7000r / min, 10 minutes). After washing, it was dried in a freeze dryer for 24 hours to obtain black MoS2 powder. 10.0mg of MoS2 powder was weighed and dissolved in 2mL of ultrapure water. Ultrasonic stirring was performed for 15 minutes to obtain a 5mg / mL MoS2 uniform dispersion.

[0089] Take 10μL MWCNTs uniform dispersion and drop-coat it on the surface of the screen-printed carbon electrode SPCE. After drying, the screen-printed carbon electrode modified with amino-modified multi-walled carbon nanotubes was obtained, which was recorded as MWCNTs / SPCE. Then take 10μL MoS2 and drop-coat it on the surface of MWCNTs / SPCE. After drying, the screen-printed carbon electrode modified with multi-walled carbon nanotubes / molybdenum disulfide was obtained, which was recorded as MWCNTs-MoS2 / SPCE.

[0090] Figure 4 This is a characterization diagram of MWCNTs-MoS2 material. It can be seen from the figure that the nanomaterial MWCNTs is in a regular hollow bamboo shape ( Figure 4 A); the nanomaterial MoS2 is in the form of flakes, which indicates that AuNPs are nanoflower gold nanoparticles ( Figure 4 B); Figure 4 The SEM image of C shows that there are MWCNTs tubular nanomaterials dispersed under MoS2, which indicates that MWCNTs-MoS2 was successfully prepared; XRD results ( Figure 5 ) further proves the successful preparation of MWCNTs-MoS2.

[0091] like Figure 6 As shown in the CV curve of A, at a scan rate of 0.1 V / s, the [Fe(CN)6] 3- / 4- A pair of redox peaks are observed. When the electrode surface is modified with MWCNTs (curve b) and MoS2 (curve c), respectively, the CV peak current increases significantly, indicating that both MWCNTs and MoS2 have good conductivity. Furthermore, when the MWCNTs-MoS2 composite is fixed to the electrode surface, the synergistic effect of the two accelerates electron transfer, resulting in the maximum peak current. This indicates that the MWCNTs-MoS2 composite has a high charge transfer rate and a large specific surface area that paves the way for the binding of the shortened ssDNA-MB to the electrode. The CV results demonstrate the success of each step in the sensor construction process.

[0092] In this step, EIS is used to further verify the gradual modification process of the electrode. Figure 6 As shown in Figure 2, the Ret of the modified MWCNTs (curve b) is significantly reduced compared to the bare SPCE (curve a). Furthermore, the minimum Ret value is obtained when modified with MWCNTs-MoS2 (curve c). The EIS curve at this time is nearly a straight line, indicating that MWCNTs and AuNPs have the ability to synergistically increase electron transfer. The above results obtained from EIS are very consistent with those obtained from CV, both demonstrating the successful construction of MWCNTs-MoS2 / SPCE.

[0093] S3. Preparation of MWCNTs-MoS2 Magnetic Electrochemical Biosensor Based on RPA-CRISPR / Cas12a

[0094] S31. Preparation of Target DNA:

[0095] S311. Whole genome extraction of Staphylococcus aureus / Salmonella:

[0096] The Staphylococcus aureus / Salmonella used in the experiment were stored in a -20°C refrigerator by the magnetic bead method. Before the experiment, one magnetic bead was taken for each strain and inoculated on a marked blood agar plate, and the plate was streaked and inoculated. After inoculation, it was cultured at 37°C for 12 hours, and then the growth of the colonies was observed to ensure that the colonies were uniform and free of contamination by foreign bacteria. Subsequently, three loops were taken from a single colony using an inoculation loop, inoculated into LB liquid culture medium, and cultured at 37°C for 12 hours. After the culture was completed, a turbidimeter was used to preliminarily determine the concentration. The bacterial solution obtained by the culture was gradiently diluted with physiological saline and then coated on the plate, and the colony count was performed to determine the specific concentration of the bacterial solution. According to the plate count results, Staphylococcus aureus and Salmonella were both prepared to a final concentration of 10 1 –10 7 CFU / mL of bacterial liquid was used to perform rapid DNA extraction (5 min) using Rapid Nucleic Acid Releaser (DNA Type)-II to obtain bacterial liquid DNA extract.

[0097] S312. RPA amplification of two bacterial liquid nucleic acid templates:

[0098] A partial fragment of the nuc gene, a specific gene of Staphylococcus aureus (SEQ ID NO.6), and a partial fragment of the invA gene, a specific gene of Salmonella (SEQ ID NO.7) were selected as upstream and downstream primers for RPA amplification, wherein the upstream primer for RPA amplification of Staphylococcus aureus was: 5'GCATCACAAACAGATAACGGCGTAAATAGAAG 3' (SEQ ID NO.8); the downstream primer was: 5'ACATTAATTTAACCGTATCACCATCAATCGCT 3' (SEQID NO.9).

[0099] The upstream primer for RPA amplification of Salmonella is: 5'GCGGCTGCTCGCCTTTGCTGGTTTTAGGTTTG 3' (SEQ ID NO. 10); the downstream primer is: 5'ACCCATTTGTATTGGTTGTTACGGCTATTTTG 3' (SEQ ID NO. 11).

[0100] Then, the RPA kit was used to perform an amplification reaction. 2 μL of RPA upstream primers for Staphylococcus aureus, 2 μL of RPA downstream primers for Staphylococcus aureus, and 5 μL of bacterial DNA extract were added to the system. The system was then placed in a 37°C water bath for 30 minutes. After the reaction was completed, DNA extract was added. After centrifugation at 12,000 rpm, the supernatant was the high-concentration amplification product, which was recorded as the Staphylococcus aureus target nucleic acid (Target DNA). Its nucleotide sequence is shown in SEQ ID NO.6. The RPA amplification effect of Staphylococcus aureus was verified. As can be seen from the figure, compared with the marker in lane 1, there is a more obvious band at 139 bp in lanes 2 to 5, which indicates that RPA of Staphylococcus aureus was successfully amplified ( Figure 7 A).

[0101] Similarly, a Salmonella target nucleic acid (Target DNA) can be obtained, and its nucleotide sequence is shown in SEQ ID NO. 7. The RPA amplification effect of Salmonella was verified. As can be seen from the figure, compared with the marker in lane 1, a relatively obvious band at 177 bp was found in lanes 2 to 5, which confirmed the successful amplification of Salmonella by RPA.

[0102] S32. Preparation of magnetically controlled electrochemical biosensor:

[0103] The Staphylococcus aureus target nucleic acid (Target DNA) and Salmonella target nucleic acid (Target DNA) obtained in S31 were mixed with 1 μL of 1 μM CRISPR / Cas12a, 1.5 μL of 1 μM crRNA, 3 μL of 10× NE buffer 2.1, and 21.5 μL of enzyme-free water, and then self-assembled at 37°C for 10 minutes to form a CRISPR-crRNA-Target DNA ternary complex. The crRNA assembled on CRISPR / Cas12a has single-base recognition ability. After recognizing and binding with the target DNA, it activates the cis- and trans-cleavage capabilities of CRISPR / Cas12a, with cis-cleavage of the target DNA and trans-cleavage of ssDNA.

[0104] The CRISPR-crRNA-Target DNA ternary complex system was mixed with 2 μL of 5 μM Fe3O4@Au nanoparticles and reacted at 37°C for 30 minutes. The Fe3O4@Au nanoparticles were collected to the bottom of the tube by an external magnetic field. 10 μL of the supernatant (containing the cut ssDNA fragments and the electroactive molecule MB modified at their tails) was added dropwise to a screen-printed electrode modified with MWCNTs-MoS2. The current value of MB was detected by an electrochemical workstation to obtain magnetically controlled electrochemical biosensors for detecting Staphylococcus aureus and for detecting Salmonella.

[0105] S33. Detection of magnetically controlled electrochemical biosensors:

[0106] Differential pulse voltammetry (DPV) was used to record the sensor detection signal. The pulse amplitude was 50 mV, the pulse width was 50 ms, the pulse period was 100 ms, and the voltage scanning interval was -0.5 V to -0.2 V. The detection range was 4.6 × 10 4 CFU / mL Staphylococcus aureus ( Figure 8 A) and 5.5×10 4 CFU / mL Salmonella ( Figure 8 B) The electrochemical signal generated after the target DNA is recognized has a signal intensity that is positively correlated with the target concentration. The quantitative analysis of the target DNA can be achieved based on the generated electrochemical signal. The test results are as follows: Figure 8 shown.

[0107] from Figure 8It can be seen that the current peak decreases after the introduction of the CRISPR / Cas12a system, which indicates that the RPA-CRISPR biosensor can effectively identify the target DNA of Staphylococcus aureus and Salmonella and cut the ssDNA molecules, effectively identify the collected signals and then quantitatively detect the two pathogens respectively.

[0108] The CRISPR / Cas12a cutting conditions were verified using PAGR, and the verification results were as follows: Figure 9 As shown in the figure, when comparing the marker in lane 1, when no crRNA or target DNA is added, ssDNA bands appear, as shown in lanes 3 and 4, indicating that the system does not cleave. However, when the marker in lane 1 is compared, the bands disappear, as shown in lane 2, indicating that the ssDNA is cleaved.

[0109] In summary, the CRISPR / Cas12a system has the ability to recognize and non-specifically cut target DNA, and illustrates the specificity of the primer sequence selected for RPA amplification.

[0110] Example 2: Optimization of magnetically controlled electrochemical biosensor

[0111] In order to improve the performance of the electrochemical sensor, this example optimizes the volume addition ratio of MWCNTs and MoS2, ssDNA incubation concentration, volume addition ratio of Cas12a and crRNA, and system incubation time in the preparation process of the MWCNTs-MoS2 magnetic controlled electrochemical biosensor based on RPA-CRISPR / Cas12a. The specific steps are as follows:

[0112] (1) Optimization of the volume addition ratio of MWCNTs and MoS2:

[0113] In order to improve the electron transfer rate, this step optimizes the volume addition ratio of MWCNTs and MoS2 to enhance the electrode performance and obtain the maximum response current. The optimization results are shown in Figure 2. Figure 10 As shown in Figure A. It can be seen from the figure that when the volume ratio of MWCNTs and MoS2 is greater than 1:1, the current response decreases due to the excessive MoS2 stacking on the surface of MWCNTs, which hinders the transfer of electrons on the electrode.

[0114] Therefore, the optimal volume ratio of MWCNTs and MoS2 is 1:1.

[0115] (2) Optimization of ssDNA incubation concentration:

[0116] In the biosensor, ssDNA is used as a signal molecule. Its concentration determines the signal response efficiency after specific binding with the target bacteria. This step optimizes the ssDNA concentration. The optimization results are shown in Figure 2. Figure 10 As shown in B. Figure 10 As can be seen in Figure B, when the concentration is too low, it cannot cover the Fe3O4@Au surface, resulting in a decrease in the recognition efficiency of the target bacteria and reduced detection sensitivity. In the range of 1-5μM, as the ssDNA concentration increases, the current peak gradually increases.

[0117] Therefore, 5 μM was selected as the optimal ssDNA concentration.

[0118] (3) Optimization of the volume addition ratio of Cas12a and crRNA:

[0119] Evaluate the ratio of Cas12a to crRNA to ensure the complete combination of the two, maximize the efficiency of post-activation side cutting, and avoid excessive use and cost waste. This step optimizes the ratio of Cas12a to crRNA, and the optimization results are as follows Figure 10 As shown in C. As can be seen from the figure, the best effect was achieved when the addition amounts of Cas12a and crRNA were 1 μL and 1.5 μL, respectively.

[0120] Therefore, the addition amounts of Cas12a and crRNA were selected to be 1 μL and 1.5 μL, respectively.

[0121] (4) Optimization of system incubation time:

[0122] The incubation time of the CRISPR-crRNA-target DNA ternary complex system with Fe3O4@Au nanoparticles determines whether the CRISPR / Cas12a side-cutting reaction is sufficient, which directly affects the signal response. Too short an incubation time may lead to incomplete cleavage of the target bacteria and insufficient signal response. Excessive incubation time may lead to decreased stability of the reaction system and increase operation time and cost.

[0123] In this step, the incubation time of the CRISPR-crRNA-Target DNA ternary complex system and Fe3O4@Au nanoparticles was optimized. The optimization results are shown in Figure 2. Figure 10 As shown in D. As can be seen from the figure, the electrochemical response gradually increases within 20-30 minutes and reaches the maximum value at 30 minutes. After 30 minutes, the response value remains basically unchanged.

[0124] Therefore, 30 min was selected as the optimal incubation time.

[0125] In summary, in the preparation process of MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a system, the optimal reaction conditions are: the optimal volume ratio of MWCNTs and MoS2 is 1:1, the optimal concentration of ssDNA is 5μM, the added amounts of Cas12a and crRNA are 1μL and 1.5μL respectively, and the system incubation time is 30min.

[0126] Example 3: Investigation of the Detection Ability of the Magnetically Controlled Electrochemical Biosensor for Staphylococcus aureus / Salmonella

[0127] In this example, the detection ability of the MWCNTs-MoS2 magnetically controlled electrochemical biosensor based on RPA-CRISPR / Cas12a for Staphylococcus aureus / Salmonella was investigated. The specific detection method is shown below.

[0128] (1) Drawing of the standard curve of pure culture:

[0129] Under the optimal experimental conditions of Example 2, different concentrations of Staphylococcus aureus and Salmonella Target DNA were tested to verify the performance of the electrochemical biosensor.

[0130] Taking Staphylococcus aureus as an example, the method of S33 in Example 1 was used to draw a standard curve with the bacterial concentration of Staphylococcus aureus as the horizontal axis and the DPV current peak response as the vertical axis. The results are as follows: Figure 11 As shown in A. As can be seen from the figure, the pure culture of Staphylococcus aureus is 4.6×10 1 -4.6×10 7 There is a good linear relationship between the current response value I and the concentration of pure culture of the bacterial solution within the range of CFU / mL. The linear regression equation of Staphylococcus aureus is y1=0.1638x1+0.1237, R1 2 =0.973 (where y1 represents the current response value I, x1 represents lg C S.aureus ).

[0131] Similarly, draw a standard curve of pure culture of Salmonella, such as Figure 11 As shown in B. As can be seen from the figure, the pure culture of Salmonella is 5.5×10 1 -5.5×10 7 There is a good linear relationship between the current response value I and the concentration of pure culture of the bacterial solution in the CFU / mL range. The linear regression equation of Salmonella is y2=0.1345x2+0.1434, R2 2 =0.989 (where y2 represents the current response value I, x2 represents the lg C Salmonella ).

[0132] As can be seen from the figure, this method has a detection limit as low as 2 CFU / mL for both bacterial solutions (3σ / k, where σ is the standard deviation of three consecutive blank experiments and k is the slope of the regression equation), indicating that the electrochemical biosensor has good analytical performance and has good identification and detection effects for different foodborne pathogens.

[0133] (2) Magnetic controlled electrochemical biosensor for the detection of Staphylococcus aureus / Salmonella content in milk:

[0134] To better verify the reliability of the biosensor in actual sample applications, this step examined the ability of the two magnetically controlled electrochemical biosensors prepared in Example 1 to detect the content of Staphylococcus aureus and Salmonella in dairy products. The dairy products were sterilized milk (purchased from Metro Warehouse Supermarket in Zhenjiang City, Jiangsu Province). The specific detection methods are as follows:

[0135] The obtained Staphylococcus aureus and Salmonella bacterial suspensions were inoculated into milk samples and serially diluted. After confirmation by plate spreading method, the final concentration range of Staphylococcus aureus and Salmonella in the contaminated samples was 10 1 ~10 7 CFU / mL. These contaminated samples were then subjected to DNA extraction using the whole genome extraction method for Staphylococcus aureus / Salmonella described in S311, and the target analytes were obtained by the RPA amplification technology described in S312 for RPA amplification of bacterial liquid nucleic acid templates.

[0136] Sterilized milk was used to grade dilute the pure culture of Staphylococcus aureus, and DNA was extracted and amplified by RPA using the method in S312 to obtain the test substance. Each sample was tested using the method in S33 of Example 1, and a linear regression curve was constructed by the current response value (I) and the logarithm (log) value of the target bacteria concentration. The test results are shown in FIG. Figure 11 As shown in Figure C. As can be seen from the figure, the linear regression equation of the Staphylococcus aureus milk sample is y3=0.1939x3-0.02387, R3 2 =0.977 (where y3 represents the current response value I, x3 represents the lg C S.aureus ).

[0137] Similarly, a linear regression curve of the Salmonella milk sample and the current peak I was established, as shown in Figure 11 As shown in Figure D, it can be seen that the linear regression equation of the actual Salmonella sample is y4=0.1581x4+0.06257, R4 2 =0.966 (where y4 represents the current response value I, x4 represents the lg C Salmonella ).

[0138] Combine Figure 11 CD and Figure 11 Looking at the A-B data, while the standard curve for milk testing doesn't exactly match the values ​​obtained with pure cultures, the deviation is minimal. This slight difference is likely due to the nutrient richness of milk. Therefore, despite milk being a complex food matrix, it has minimal impact on the biosensor's performance.

[0139] Example 4: Performance evaluation of magnetically controlled electrochemical biosensors

[0140] In this example, the performance of the two magnetically controlled electrochemical biosensors prepared in Example 1 was investigated. The specific steps are as follows:

[0141] (1) Investigation of the specificity of magnetically controlled electrochemical biosensors:

[0142] To verify the specificity and anti-interference performance of the constructed magnetically controlled electrochemical biosensor, this study selected six common foodborne pathogens as controls, including Staphylococcus aureus (ATCC 6538), Salmonella (ATCC 50761), Escherichia coli (ATCC 25922), Bacillus cereus (CMCC 6303), Vibrio parahaemolyticus (ATCC 17802), and Listeria monocytogenes (ATCC 54004). The nucleic acid amplification products of each bacterial species were obtained by referring to the steps for whole genome extraction of Staphylococcus aureus / Salmonella and RPA amplification of nucleic acid templates of two bacterial solutions in S311. The bacterial solution concentration of non-target bacterial species was 10 5 CFU / mL and the target bacterial concentration is 10 4 CFU / mL, that is, the concentration of non-target bacteria solution is 10 times that of target bacteria solution. The above amplified products were added to the two magnetically controlled electrochemical biosensors constructed in Example 1 for detection. The detection results are shown in Figure 2. Figure 12 shown.

[0143] from Figure 12 It can be seen that when the concentration of other bacterial solutions is 10 times that of the target bacterial solution, the current response changes by less than 5.9%, which is significantly different from the target bacterial solution (P<0.0001), proving that the system has good specificity.

[0144] (2) Reliability investigation of magnetically controlled electrochemical biosensors:

[0145] This step evaluates the stability of the magnetically controlled electrochemical biosensor by measuring the response signal of the magnetically controlled biosensor over 35 days. The specific tests are as follows:

[0146] The stability of Fe3O4@Au-ssDNA was monitored by storing it at 4°C and measuring it intermittently (every five days). The DPV test was performed under the following conditions: pulse amplitude 0.05V, pulse period 0.05s, pulse width 0.1s, and potential range from -0.6V to 0.2V. The stability was evaluated by observing the peak value of the DPV current. The test results are shown in Figure 2. Figure 13 shown.

[0147] from Figure 13 It can be seen that after 35 days, the I value of the magnetically controlled electrochemical biosensor can still maintain 95% of the initial value, with no significant difference from the initial value signal (P>0.05). This result proves the stability of the magnetically controlled electrochemical biosensor.

[0148] (3) Investigation of the anti-interference performance of magnetically controlled electrochemical biosensors:

[0149] In this step, whole milk, yogurt, a probiotic beverage, and egg white were spiked with varying concentrations of Staphylococcus aureus and detected using a magnetically controlled biosensor. The sensor's response signals were used to evaluate its anti-interference performance. The pretreatment methods for whole milk, yogurt, and the probiotic beverage were the same as those described in Example 3.

[0150] The specific tests are:

[0151] The obtained Staphylococcus aureus and Salmonella bacterial suspensions were inoculated into different dairy samples and serially diluted. After confirmation by plate spreading method, the final concentration range of Staphylococcus aureus and Salmonella in the contaminated samples was 10 1 ~10 7 CFU / mL. These contaminated samples were then subjected to DNA extraction using the whole genome extraction method for Staphylococcus aureus / Salmonella described in S311, and the target analytes were obtained by RPA amplification of the bacterial solution nucleic acid template described in S312. In addition, the protein was pretreated by centrifuging 0.5 mL of protein at 10,000 rpm for 5 minutes, mixing it with 4.5 mL of pure water, and adding 10 3 Target DNA is detected.

[0152] The test results are shown in Table 1.

[0153] Table 1. Effects of biosensors on pathogen detection in different food matrices

[0154]

[0155] *RD:Relative deviation,C S.a :C S.aureus ,C Sm:C Salmonella .

[0156] As shown in Table 1, the relative deviations of the detection results for whole milk, yogurt, probiotic beverages, and egg white compared to the previously tested milk samples were less than 4%. These findings indicate that the biosensor maintains good accuracy and stability in different food matrices, including dairy products, and confirm its potential for practical pathogen detection in different food types.

[0157] (4) Investigation of the detection performance of magnetically controlled electrochemical biosensors:

[0158] This step verifies the necessity of using the material on the electrode of the magnetically controlled biosensor by comparing the DPV current response before and after adding the MWCNTs-MoS2 material. The specific method is as follows: prepare a sensor according to the construction process of the MWCNTs-MoS2 magnetically controlled electrochemical biosensor of the RPA-CRISPR / Cas12a system in Example 3, which is recorded as the "experimental group sensor"; at the same time, while keeping the rest of the preparation steps completely consistent, only the MWCNTs-MoS2 material modification step is omitted to prepare the "control group sensor" (i.e., the existing sensor). Use two sensors to measure the same concentration (5.5×10 4 The RPA amplification products of Salmonella (CFU / mL) were detected, and the DPV current signals were recorded for comparative analysis to evaluate the role of MWCNTs-MoS2 material in signal amplification and detection sensitivity.

[0159] from Figure 14 It can be seen that the current value generated by the magnetically controlled biosensor is significantly higher than that of existing sensors. When detecting the same concentration of bacterial solution, the existing sensor generates an electrical signal of 0.4706μA, while the current value generated by the magnetically controlled electrochemical biosensor is 0.66023μA, which is 40.3% higher than the current value of the existing sensor. This shows that the magnetically controlled electrochemical biosensor has a significantly enhanced electrical signal response compared to existing sensors, indicating that its detection sensitivity is greatly improved, and it can more effectively capture and detect target DNA. At the same time, the sensor may use a better signal amplification mechanism, such as promoting the capture of target DNA, enhancing the CRISPR / Cas12a reaction, or improving the electron transfer efficiency on the electrode surface, thereby significantly improving the detection signal. In addition, due to the enhanced current signal, the sensor may have a lower detection limit, allowing it to still generate detectable signals under conditions of lower bacterial solution concentrations, thereby improving the accuracy of early detection and quantitative analysis.

[0160] In summary, the electrochemical biosensor of the present invention can improve the time efficiency and anti-interference ability of the determination of trace Staphylococcus aureus / Salmonella by 4.6×10 1 -4.6×107 CFU / mL and 5.5×10 1 -5.5×10 7 The product showed a wide linear response in the CFU / mL range, with a detection limit as low as 2 CFU / mL; it was very practical in detecting Staphylococcus aureus and Salmonella.

[0161] The embodiments described are preferred implementations of the present invention, but the present invention is not limited to the above implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention are within the scope of protection of the present invention.

Claims

1. A magnetically controlled electrochemical biosensor based on MWCNTs-MoS2 of CRISPR / Cas12a, characterized in that: The magnetically controlled electrochemical biosensor comprises: a screen-printed carbon electrode modified with amino-modified multi-walled carbon nanotubes and molybdenum disulfide, and a shear product dripped onto the surface of the screen-printed carbon electrode; The sheared product is obtained by assembling and shearing the CRISPR-crRNA-Target DNA ternary complex and the ferroferric oxide-gold-single-stranded nucleotide probe; The ferroferric oxide-gold-single-stranded nucleotide probe comprises a gold-coated ferroferric oxide composite material and a single-stranded nucleotide ssDNA fixed on its surface, which is modified with a thiol group at the 5' end and methylene blue (MB) at the 3' end; the sequence of the ssDNA is HS-SH C6-TTTTTTTTTTTTTTTTTTTT-MB; The CRISPR-crRNA-Target DNA ternary complex is obtained by combining CRISPR / Cas12a, crRNA and Target DNA; The crRNA includes one or both of the crRNA of the Salmonella target and the crRNA of the Staphylococcus aureus target; The target DNA includes one of Staphylococcus aureus target DNA and Salmonella target DNA.

2. The CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor according to claim 1, characterized in that The nucleotide sequence of the crRNA of the Staphylococcus aureus target is shown in SEQ ID NO.1; The nucleotide sequence of the crRNA of the Salmonella target is shown in SEQ ID NO.2; The nucleotide sequence of the Staphylococcus aureus Target DNA is shown in SEQ ID NO.3; The nucleotide sequence of the Salmonella Target DNA is shown in SEQ ID NO.

4.

3. The method for preparing a magnetically controlled electrochemical biosensor based on CRISPR / Cas12a of claim 1 or 2, characterized in that: The preparation method comprises: (1) Preparation of Fe3O4-Au-single-stranded nucleotide probe: Fe3O4 was dissolved in ultrapure water, and then chloroauric acid (HAuCl4) solution and iced sodium borohydride (NaBH4) solution were added thereto, and the mixture was stirred and mixed in an ice-water bath to obtain Fe3O4@Au; The Fe3O4@Au was mixed with the activated ssDNA and incubated to obtain the Fe3O4@Au-ssDNA probe after the incubation. (2) Preparation of Aminated Multi-walled Carbon Nanotube-Molybdenum Disulfide Modified Screen-Printed Carbon Electrode: The amino-modified multi-walled carbon nanotubes were ultrasonically dispersed in pure water and drop-coated on the surface of screen-printed carbon electrode (SPCE). The screen-printed carbon electrode modified with multi-walled carbon nanotubes was dried and designated as MWCNTs / SPCE. MoS2 was ultrasonically dispersed in ultrapure water to obtain a MoS2 dispersion, which was then drop-coated onto the surface of MWCNTs / SPCE to obtain a multi-walled carbon nanotube / molybdenum disulfide material-modified screen-printed carbon electrode, denoted as MWCNTs-MoS2 / SPCE. (3) Preparation of MWCNTs-MoS2 magnetically controlled electrochemical biosensor based on RPA-CRISPR / Cas12a: CRISPR / Cas12a, crRNA, 10× NE buffer 2.1, enzyme-free water, and target nucleic acid Target DNA were mixed and self-assembled to obtain a CRISPR-crRNA-Target DNA ternary complex; The CRISPR-crRNA-Target DNA ternary complex was mixed with Fe3O4@Au-ssDNA and reacted. After the reaction, the precipitate was collected by an external magnet, and the supernatant was added dropwise to the MWCNTs-MoS2 / SPCE surface to obtain the CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor.

4. The preparation method according to claim 3, characterized in that In step (1), the dosage ratio of Fe3O4, ultrapure water, chloroauric acid and iced sodium borohydride solution is 15 mg:150 mL:3 mL:0.9 mL; the concentration of the chloroauric acid solution is 6 mg / mL, the concentration of the iced sodium borohydride is 0.2 M, and the stirring time in the ice-water bath is 15 min.

5. The preparation method according to claim 3, characterized in that In step (1), the ssDNA activation step comprises: thiolating the ssDNA with Tris-HCl (10 mM, pH 6) containing EDTA, NaCl, and TCEP, and then dissolving the ssDNA in TE buffer to obtain activated ssDNA; The volume ratio of the activated ssDNA and Fe3O4@Au is 1:1; The mixed incubation conditions are: incubation at 4°C overnight.

6. The preparation method according to claim 3, characterized in that In step (2), the ratio of the amino-modified multi-walled carbon nanotube material to pure water is 1 mg:2 mL, and the drop-coating amount is 10 μL; The usage ratio of MoS2 and ultrapure water is 5 mg:1 mL, and the drop coating volume is 10 μL.

7. The preparation method according to claim 3, characterized in that In step (3), the amounts of CRISPR / Cas12a, crRNA, 10×NE buffer 2.1, enzyme-free water, and target nucleic acid Target DNA are 1 μL: 1.5 μL: 3 μL: 21.5 μL: 3 μL; wherein the concentration of CRISPR / Cas12a is 1 μM; the concentration of crRNA is 1 μM; The crRNA includes one or both of the crRNA of the Salmonella target and the crRNA of the Staphylococcus aureus target; The target DNA includes one of Staphylococcus aureus target DNA and Salmonella target DNA.

8. The preparation method according to claim 3, characterized in that In step (3), the self-assembly conditions are: self-assembly at 37° C. for 10 min; The dosage ratio of the CRISPR-crRNA-Target DNA ternary complex to Fe3O4@Au-ssDNA is 30 μL:2 μL, wherein the concentration of Fe3O4@Au-ssDNA is 5 μM; The reaction conditions include: reacting at 37° C. for 30 min.

9. Use of the CRISPR / Cas12a-based MWCNTs-MoS2 magnetically controlled electrochemical biosensor according to any one of claims 1 or 2 in detecting foodborne pathogens.

10. The use according to claim 9, characterized in that The foodborne pathogenic bacteria include foodborne pathogenic bacteria in milk; the foodborne pathogenic bacteria include one of Staphylococcus aureus and Salmonella.

Images