Gene related to body color character of paramisgurnus dabryanus, primer group of SNP (Single Nucleotide Polymorphism) marker and application of primer group

Abstract

The invention relates to a gene related to the body color character of paramisgurnus dabryanus, a primer group of an SNP marker and application of the primer group, and belongs to the technical field of molecular markers, and the nucleotide sequence of the gene is as shown in SEQ ID NO.1. The invention also provides a primer pair for detecting the body color related SNP marker herc2-105, and the nucleotide sequence of the primer pair is as shown in SEQ ID NO: 2-3; the SNP marker herc2-105 is located at the 105bp position of the nucleotide sequence of the gene, and the polymorphic form of the SNP marker herc2-105 is A / T. Wherein the AA genotype individual has a golden red body color, and the AT and TT genotype individuals have a wild body color. The molecular marker provided by the invention can be used for body color character breeding of the golden red paramisgurnus dabryanus, the genetic diversity of population offspring is effectively increased, and the breeding process of new body color variety breeding of the red paramisgurnus dabryanus is remarkably promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a primer set of genes and SNP markers related to the body color traits of large-scaled loach and an application thereof. Background Art

[0002] The golden-red large-scaled loach has both edible and ornamental value and has been very popular among fish farmers and ornamental fish enthusiasts in recent years. Its market price is relatively high, and its economic value is far higher than that of the large-scaled loach. It has broad breeding and promotion prospects and market demand. Therefore, the cultivation of new varieties of golden-red large-scaled loach can promote the development of the aquaculture industry, as well as promote scientific research, ecological sustainable development and economic benefits. It has broad application prospects and important strategic significance.

[0003] The color mutation in the golden-red large-scaled loach is a recessive homozygous mutation with a low mutation rate. During artificial breeding, heterozygous mutations remain the wild-type color (brown) and are easily eliminated. This results in a small base population. Traditional selective breeding is prone to inbreeding with each generation, posing the risk of germplasm degradation and loss of desirable traits. Maintaining high genetic diversity in the breeding population while producing seed and selecting improved varieties with a small number of parents is a key technical challenge that needs to be addressed. Summary of the Invention

[0004] The present invention aims to provide a primer set for rapidly identifying genes and single-nucleotide polymorphisms (SNPs) that characterize body color in large-scaled loach (Pseudosphagnum sphaeroides), and its application. This SNP mutation site can be applied to color selection in large-scaled loach, allowing for the design of breeding strategies based on Mendel's laws to effectively increase genetic diversity in offspring populations. Therefore, screening for molecular markers associated with body color for use in seed selection is of great significance for improving breeding efficiency, developing new strains, and enhancing biodiversity.

[0005] The present invention is achieved through the following technical solutions:

[0006] In a first aspect, the present invention provides a gene related to the body color of Paraloach maculatus, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The second aspect of the present invention provides a primer pair for detecting body color-related SNP marker herc2-105, the nucleotide sequence of the primer pair is shown in SEQ ID NO:2-3; the SNP marker herc2-105 is located at the 105th bp of the nucleotide sequence of the gene, and its polymorphic form is A / T.

[0008] Furthermore, the genotypes of the base mutation sites include AA, AT, and TT.

[0009] The third aspect of the present invention is to provide a kit for detecting the body color of Paraloach spheniscidae, which comprises the primer pair.

[0010] The fourth aspect of the present invention provides a method for detecting the body color traits of the large-scaled paraloach, which comprises the following steps: using the primer pair to perform PCR amplification on the genomic DNA of the large-scaled paraloach, detecting the genotype at the 105bp of the PCR amplification product, the body color of individuals with the genotype AA is golden red, and the body color of individuals with the genotype AT or TT is wild-type brown.

[0011] The fifth aspect of the present invention provides an application of the primer pair in the breeding of golden red large-scaled loach body color traits, and the application is to use the above primer pair to detect the genotype of the large-scaled loach reserve parent fish at the SNP marker herc2-105 base mutation site, screen out individuals with wild-type brown body color but AT genotype, raise them separately, and carry out directed breeding during the breeding period, that is, fertilize the wild-type body color AT with the mutant body color AA; fertilize the wild-type body color AT with the wild-type body color AT, select the mutant body color individuals from the offspring for cultivation, and obtain the golden red large-scaled loach.

[0012] The present invention has the following beneficial effects compared to the prior art: The present invention provides a SNP site associated with the golden-red body color trait of large-scaled loach, the SNP molecular marker being located at position 105 of the sequence shown in SEQ ID NO.1; an A / T base mutation is present at the site, which is significantly correlated with the golden-red body color trait of large-scaled loach, wherein individuals with the AA genotype have a golden-red body color, and individuals with the AT and TT genotypes have a wild-type body color. The molecular marker provided by the present invention can be used for breeding of golden-red large-scaled loach body color traits, effectively increasing the genetic diversity of population offspring, and significantly promoting the breeding process of new varieties of red large-scaled loach body color. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The three genotype sequencing peaks of the amplified products are shown in Figure A, which shows the AA genotype of the golden red loach, Figure B shows the TT genotype of the wild-type body color loach, and Figure C shows the AT genotype of the wild-type body color loach. DETAILED DESCRIPTION

[0014] The technical scheme of the present invention is further explained below by real-time examples in conjunction with the accompanying drawings, but the scope of protection of the present invention is not limited in any form by the embodiments. Unless otherwise specified, the experimental methods used in the examples are conventional methods and techniques well known to those skilled in the art, and the materials and reagents are all purchased from commercial sources.

[0015] Example 1 Identification of polymorphic sites in the herc2 gene of golden red large-scale loach

[0016] 1. Procurement of different coloration samples of large-scaled loach: 30 golden-red mutant and wild-type individuals were collected for genomic DNA extraction from the fin tissues of the fish to be tested. Genomic DNA was extracted from muscle tissue above the lateral line using the TIANGEN Animal Tissue Genomic DNA Extraction Kit. DNA integrity was assessed by electrophoresis on a 1% agarose gel. DNA quality and concentration were determined using a NanoDrop 2000 micro-spectrophotometer. Purity was considered acceptable when the A260 / A280 ratio was between 1.7 and 1.9, and concentrations above 100 ng / μL were considered acceptable. Qualified genomic DNA samples were stored at -20°C until further use.

[0017] 2. Amplify the nucleotide fragment containing the SNP site

[0018] 2.1 Primer Design: The herc2 gene DNA sequence was obtained from the whole genome sequencing results of the large-scale loach. Using the herc2 gene DNA sequence shown in SEQ ID NO: 1 as a template, primers were designed, including forward primer F: 5'-GGTGCTGAAGGACTGAGGGTA-3' (SEQ ID NO: 2) and reverse primer R: 5'-AGGACCTGGGGAAGTTTGTTT-3' (SEQ ID NO: 3).

[0019] The extensible region of the primer is 400 bp in length, and the sequence is shown in SEQ ID NO: 1, which includes a molecular marker site with an A / T mutation at position 105 bp.

[0020] 2.2 PCR Amplification: The PCR reaction system (24 μL) consisted of: 12.5 μL 2× San Taq PCR Mix, 1.0 μL forward primer (10 μmol / L), 1.0 μL reverse primer (10 μmol / L), 1.0 μL template DNA (≥100 ng / μL), and 9.5 μL ddH2O. The PCR reaction conditions were: initial denaturation at 95°C for 5 min, 35 amplification cycles (denaturation at 95°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 30 s), and a final extension at 72°C for 10 min.

[0021] 3. Detect PCR amplified fragments and obtain SNP markers: Perform first generation sequencing on the PCR amplified product in step 2.2. The genotype at the 105 bp of the PCR amplified product is the genotype of the SNP site. The sequencing peaks of the two genotypes are shown in Figure 2. Figure 1 shown.

[0022] Example 2 carries out breeding applications, designs different breeding schemes based on body color, and performs population analysis on the polymorphic sites of the herc2 gene locus in different breeding lines.

[0023] Acquisition of Different Breeding Lines: Directed mating and artificial breeding were conducted on the golden-red mutant individuals within the large-scale paraloach population. F1 generation families were constructed through reciprocal crosses between wild-type and mutant individuals. The following year, when the hybrid F1 lines matured, testcrosses between the hybrid F1 lines and the golden-red large-scale paraloach and self-fertilization experiments were conducted to obtain F2 generation families. After successful fertilization, the broodstock were cultured separately. The body color of the F1 and F2 generations is shown in Table 1.

[0024] Table 1 shows the body color of hybrid parents and their offspring

[0025]

[0026] 30 F1 hybrid individuals, 30 F2 test-cross individuals of different body colors, and 50 F2 self-cross individuals of different body colors were selected; the fins were cut off and the genomic DNA was extracted from the fin tissues of the tested fish.

[0027] The chi-square test was used to analyze the above samples (Table 2). The frequency of the above SNP loci in different body colors basically conforms to Mendel's law of segregation. It verifies that the allele A of this SNP locus is significantly positively correlated with body color mutation.

[0028] Table 2 Genotype frequencies of SNP sites in different breeding lines of P.

[0029]

[0030] Note: * indicates significant difference (P < 0.05), ** indicates extremely significant difference (P < 0.01).

[0031] During the breeding process of the golden red large-scaled loach, individuals with the AT genotype can be selected from the large-scaled loach and hybridized with the golden red large-scaled loach AA to screen for a golden red population with richer genetic diversity.

[0032] Although the present invention has been described in detail above using general descriptions and specific embodiments, this should not be construed as limiting the scope of the present invention. It should be noted that any modifications or improvements made without departing from the scope of the present invention are within the scope of protection claimed by the present invention. Gene associated with body color of Paraloach spp. (SEQ ID NO. 1):

[0033] gggtacgggcgtgtcacagagagaggcacgacccccttaccatcatggatggagccaaccggatcgtgtctgttcgttcaggtgacgcacttcacatctcaatc a tggatctttggtctggtggttgttacatacttacagtatctttatttttctttcttttaggtcgtgagtggtctgattggtccagtgagttgaggatcccaggagatgagctgaaatggaagttcaccagcgatggctctgtcaacggctgggggtggcgcttcactgtctatcccatcatgcctgctgctggtatgtcaaattatgacacagtttttcaccgataaatattttttgctgcaatgtgatattctgaaatggttgatcttcaaacaaacttccccaggtcctaaga。

Claims

1. A gene related to body color of Paraloach spp., characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A primer pair for detecting body color-related SNP marker herc2-105, characterized in that: The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3; the SNP marker herc2-105 is located at the 105th bp of the nucleotide sequence of the gene according to claim 1, and its polymorphism is A / T.

3. A kit for detecting the body color of Paraloach spp., comprising the primer pair according to claim 2.

4. A method for detecting the body color characteristics of large-scale loach, characterized in that: The method comprises the following steps: performing PCR amplification on the genomic DNA of the large-scaled loach using the primer pair described in claim 2, detecting the genotype at the 105th bp of the PCR amplification product, wherein the body color of individuals with the genotype AA is golden red, and the body color of individuals with the genotypes AT and TT is wild-type brown.

5. The use of the primer pair according to claim 2 in breeding for the body color trait of golden red large-scale loach, characterized in that: The application is to use the primer pair to detect the genotype of the SNP marker herc2-105 base mutation site of the reserve broodstock of the large-scaled paraloach, screen out individuals with wild-type brown body color but AT genotype, culture them separately, and perform targeted breeding during the breeding season, that is, fertilize the wild-type body color AT with the mutant body color AA; fertilize the wild-type body color AT with the wild-type body color AT, select the mutant body color individuals from the offspring for breeding, and obtain golden-red large-scaled paraloach.

Images