Method for improving information storage capacity of actinomyces

Abstract

The application discloses a method for improving information storage capacity of actinomycete, and belongs to the technical field of genetic engineering. The method comprises the steps of simulating acetylation mutation or simulating deacetylation mutation of DasR protein of the actinomycete; the simulating acetylation mutation is that lysine at the 78th position of the DasR protein is mutated into glutamine; and the simulating deacetylation mutation is that lysine at the 78th position of the DasR protein is mutated into arginine. Through acetylation mutation and deacetylation mutation of specific sites of the wide-range regulatory factor protein, the growth of the improved Actinomucor rubrum is determined, and the sporulation capacity of the strain is observed, so that it is confirmed that the optimization of the spore growth capacity and growth condition of the Actinomucor rubrum can be realized by using genetic engineering modification, new microbial resources are provided for preparation of an information storage carrier, and a research foundation is provided for promotion of a DNA data storage technology.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a method for improving the information storage capacity of actinomycetes. Background Technology

[0002] The amount of digital data generated in modern society is increasing rapidly. Currently used traditional information storage technologies mainly include hard drives and magnetic tapes, which are based on magnetic, optical, and solid-state devices. However, with technological advancements and the widespread adoption of information technology, the amount of data generated in daily life continues to increase. It is estimated that by 2040, the amount of data generated by human networks will reach 5000 ZB. At this point, traditional devices used for information storage will face challenges in terms of storage density, long-term cost, and durability. Therefore, developing new technologies and methods with better storage performance has become urgent.

[0003] DNA is an ancient storage medium, containing vast amounts of genetic information from billions of life forms, from microorganisms to humans. Since the 1960s, the feasibility of using DNA molecules as a storage medium has been discussed due to their potential advantages, such as high storage density, low energy consumption, long lifespan, and lack of wear and tear. In recent years, with breakthroughs in DNA synthesis and next-generation sequencing technologies, DNA data storage has become a hot topic in global data storage technology research.

[0004] *Saccharopolyspora erythraea* is a Gram-positive actinomycete. The initiation of secondary metabolic processes in actinomycetes is often associated with morphological differentiation of the fungal cell. This morphological change includes the initial differentiation of vegetative mycelia for nutritional growth. When nutrient supply is insufficient, the mycelia then differentiate to produce spores. Through spore formation, the aerial structures of the actinomycete hyphae of each species are maintained and disseminated. The genome sequence of *Saccharopolyspora erythraea* contains 8,212,805 base pairs, encoding 7,264 genes. In 2007, researchers at Cambridge University completed the sequencing of the entire genome of the wild-type strain of *Saccharopolyspora erythraea* (*S. erythraea* NRRL23338), making the molecular modification of this important industrial actinomycete more targeted.

[0005] The advantage of red sugar polysporum as an information storage chassis lies in its Gram-positive nature and its spore structure with strong resistance. Currently, most of the bacteria used for information storage chassis are Bacillus subtilis, while little is known about the Actinobacteria genus. Summary of the Invention

[0006] The purpose of this invention is to provide a method for improving the information storage capacity of actinomycetes, thereby addressing the problems existing in the prior art. This invention screens acetylation sites of broad-domain regulatory factors and performs acetylation and deacetylation mutations on specific sites. By measuring the growth of the modified *Saccharopolysporum rubrum* and observing the sporulation capacity of the strains, this invention confirms that genetic engineering can optimize the spore growth capacity and growth status of *Saccharopolysporum rubrum*. This provides a new microbial resource for preparing information storage carriers and lays a research foundation for advancing DNA data storage technology.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides a method for improving the information storage capacity of actinomycetes, the method comprising the steps of performing simulated acetylation mutation or simulated deacetylation mutation on the DasR protein of actinomycetes;

[0009] The simulated acetylation mutation is to mutate the lysine residue at position 78 of the DasR protein to glutamine;

[0010] The simulated deacetylation mutation involves mutating lysine at position 78 of the DasR protein to arginine.

[0011] Furthermore, the method includes the following steps:

[0012] Recombinant vectors containing simulated acetylation mutation sequences or simulated deacetylation mutation sequences were constructed through site-directed mutagenesis.

[0013] The recombinant vector was introduced into actinomycetes, causing the actinomycetes to express DasR protein and DasR mutant protein.

[0014] Furthermore, the simulated acetylation mutation sequence was obtained by amplification using primers as shown in SEQ ID NO. 6 and SEQ ID NO. 7;

[0015] The simulated deacetylation mutant sequence was obtained by amplification using primers shown in SEQ ID NO.4 and SEQ ID NO.5.

[0016] Furthermore, the improvement of actinomycete information storage capacity specifically refers to enhancing the sporulation capacity and morphological differentiation speed of actinomycetes.

[0017] Furthermore, the improvement of the sporulation capacity of actinomycetes specifically refers to increasing the sporulation amount of actinomycetes and shortening the sporulation cycle.

[0018] Optionally, the actinomycetes include red sugar polysporum.

[0019] The present invention also provides actinomycetes constructed using the above method.

[0020] The present invention also provides the application of the above-mentioned actinomycetes in the preparation of information storage carriers.

[0021] The present invention discloses the following technical effects:

[0022] This invention reveals that *Saccharopolysporum rubrum* is a Gram-positive bacterium with excellent resistance to extreme conditions, and its spore structure gives it a natural advantage as an information storage platform. This invention screens acetylation sites of broad-domain regulatory factors and performs acetylation and deacetylation mutations on specific sites. By measuring the growth of the modified *Saccharopolysporum rubrum* and observing the sporulation capacity of the strains, this invention confirms that genetic engineering can optimize the spore growth capacity and growth status of *Saccharopolysporum rubrum*. Specifically, the deacetylation-simulated modified strains significantly enhance the sporulation capacity and differentiation rate of *Saccharopolysporum rubrum*. The method of this invention provides a new microbial resource for the preparation of information storage carriers and lays a research foundation for the advancement of DNA data storage technology. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 The results are for the colony-forming units of *Saccharomyces rubrum* and *Bacillus subtilis*; where A represents the environmental conditions at pH=8; B represents the environmental conditions at pH=8.5; C represents the environmental conditions at pH=9; and D represents the environmental conditions at pH=9.5.

[0025] Figure 2 The results show the determination of DasR acetylation sites; where A represents in vitro AcP-dependent acetylation and B represents in vitro enzyme-catalyzed acetylation.

[0026] Figure 3 Schematic diagram of mass spectrometry identification of acetylation site K78;

[0027] Figure 4 Mass spectrometry identification results of different acetylation sites in the DasR protein;

[0028] Figure 5 Sequence alignment of DasR protein in different actinomycetes;

[0029] Figure 6The results of acetylation determination in *Saccharopolysporum rubrum* are shown; where A is the EMSA diagram showing the effect of K78 site acetylation on DasR binding disA activity; and B is the cross-linking diagram showing that K78 site acetylation weakens DasR dimerization.

[0030] Figure 7 This section describes the sporulation of *Rhodotorula rubra* var. *rubra*. A represents the observation of *Rhodotorula rubra* OdasR on an R2YE plate. K78Q and OdasR K78R Phenotypic characteristics; B represents field emission electron microscopy observation of *Rhodotorula glycosporidis* OdasR. K78Q and OdasR K78R The phenotype. Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0036] Previous research in this invention revealed a strong correlation between the stress resistance of a storage medium and its information storage capacity. Previous experimental studies have suggested that *Bacillus subtilis* is an excellent information storage medium, exhibiting strong resistance to acidic, alkaline, and oxidative conditions, primarily due to its ability to produce spores. Spores possess strong resistance to heat, chemical agents, and ultraviolet radiation. This invention, using *Saccharomyces rubrum* as an example, explored its superior stress resistance under alkaline conditions and screened for metabolic engineering-related modification targets that can enhance the sporulation capacity of *Saccharomyces rubrum*. This demonstrates that genetic engineering strategies utilizing metabolic regulation to enhance cellular sporulation capacity can help achieve the goal of using actinomycete chassis as an information storage medium.

[0037] The research process and ideas of this invention are as follows:

[0038] First, this invention determined the OD values ​​of *Saccharomyces rubrum* and *Bacillus subtilis* under different pH conditions through phenotypic experiments. 600 The study found that *Saccharopolysporum rubrum* exhibited better stress resistance than *Bacillus subtilis* under alkaline conditions (pH 9.5), suggesting that *Saccharopolysporum rubrum* is a suitable information storage platform in an alkaline environment. Subsequently, by overexpressing the broad-domain regulatory factor protein DasR in *Saccharopolysporum rubrum* and performing simulated acetylation and deacetylation mutations at the K78 amino acid site, it was found that in vivo overexpression of simulated acetylated DasR... K78Q Modified strains and DasR with simulated deacetylation mutations K78R Compared to the wild type, it promotes sporulation and accelerates morphological differentiation, mimicking the deacetylation mutation of DasR. K78R The strain exhibits stronger sporulation capacity and faster morphological differentiation. Furthermore, this invention performed mass spectrometry analysis on different acetylation sites of the DasR protein, revealing that only acetylation at the K78 site was detectable in vivo.

[0039] Example 1

[0040] 1. Culture of *Saccharomyces rubrum*

[0041] Take 50 μL of the preserved *Saccharomyces erythraea* (NRRL2338) bacterial suspension and inoculate it into a 5 mL TSB liquid test tube. Pre-added glass beads are added to the test tube. Incubate at 30°C and 220 rpm for 48 hours. Take 500 μL of the cultured suspension from the test tube and inoculate it into 50 mL of TSB liquid medium. Pre-added glass beads are added to the shake flask. Incubate at 30°C and 220 rpm for 48 hours. Finally, take 0.5–1 mL of the above seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of TSB medium to allow the initial OD to reach the target value. 600 The concentration was 0.05, and the culture was carried out in a shaker at 30°C and 220 rpm.

[0042] 2. Culture of Bacillus subtilis

[0043] Take 50 μL of preserved Bacillus subtilis subsp. subtilis 168 bacterial culture and inoculate it into a 5 mL LB liquid test tube. Incubate at 37°C and 220 rpm for 12 hours until OD (Organic Depth). 600 The ratio is approximately 0.6–0.8. Take 500 μL of the cultured bacterial solution and inoculate it into 50 mL of LB liquid medium. Incubate at 37°C and 220 rpm on a shaker.

[0044] 3. Comparison of colony-forming units

[0045] After Bacillus subtilis and Polysporus rubrum were inoculated into liquid culture media under different pH conditions, OD was performed on Bacillus subtilis every 0.5–1.5 hours. 600 The OD values ​​of *Saccharomyces rubrum* were measured every 12 hours. 600 The measurements were then based on the OD values ​​of Bacillus subtilis and Glycopolysporum rubrum. 600 Convert the colony-forming units (CFU) to CFU using the formula.

[0046] The results are as follows Figure 1 As shown, *Saccharopolysporum rubrum* exhibits stronger growth ability and resilience than *Bacillus subtilis* under alkaline conditions at different pH levels. Specifically, at pH 9.5, the growth of *Bacillus subtilis* is significantly inhibited, while the growth of *Saccharopolysporum rubrum* remains unaffected. These results indicate that, compared to *Bacillus subtilis*, *Saccharopolysporum rubrum* has a better ability to adapt to alkaline environments and can survive for extended periods at higher pH levels.

[0047] 4. Construction of overexpression plasmids

[0048] 4.1 Obtaining the DasR gene: After finding the sequence of the desired gene SACE_0435 in the NCBI database, primers were designed using snapgene and homologous recombination fragments were inserted. The target gene was amplified by PCR using S. erythraea NRRL2338 genomic DNA as a template. The PCR reaction system consisted of: 25 μL buffer, 1 μL dNTP, 2 μL upstream primer, 2 μL downstream primer, 1 μL template, 1 μL high-fidelity DNA polymerase, and 18 μL ddH2O. The PCR program was: 95℃ pre-denaturation for 10 minutes, 95℃ denaturation for 15 seconds, 56℃ annealing for 15 seconds, and 72℃ extension for 30 seconds / 1000 bp. This denaturation-extension process was repeated 34 times. After the cycles, the extension was performed at 72℃ for 8 minutes, and finally, the temperature was lowered to 12℃. After agarose gel electrophoresis, the PCR product was compared with the marker. If the size was correct, the product was purified and recovered using a gel extraction kit to obtain the target fragment DasR.

[0049] The primer sequences are as follows:

[0050] dasR-F(5'-3'): AGCAAATGGGTCGCGGATCCCTCGAAACATCGGTGCCAAG (SEQ ID NO. 1);

[0051] dasR-R(5'-3'):CGAGTGCGGCCGCAAGCTTGGGCGGGCGGGTGAGG (SEQ ID NO. 2).

[0052] The nucleotide sequence of the DasR gene is shown in SEQ ID NO.3:

[0053] .

[0054] 4.2 Site-directed mutagenesis experiment: The rapid point mutagenesis kit produced by Beijing TransGen Biotech Co., Ltd. was used for the site-directed mutagenesis experiment. The required steps include:

[0055] (1) Primer design:

[0056] K78R-F: cgcgtccagggcaGgggcaccttcgc (SEQ ID NO. 4);

[0057] K78R-R: gccctggacgcgcagcagcc (SEQ ID NO.5);

[0058] K78Q-F: cgcgtccagggcCagggcaccttcgc (SEQ ID NO. 6);

[0059] K78Q-R: gccctggacgcgcagcagcc (SEQ ID NO. 7).

[0060] (2) PCR amplification:

[0061] Using the primers in (1) and the DasR gene as a template, PCR amplification was performed. The PCR system was prepared according to the following formula: SControl Plasmid 1-5 ng, 5×TransStart FastPfu buffer 10 μL, SControl Primers 1 μL, 5×TransStart FastPfu DNAPolymerase 1 μL, 10 mM dNTPs 1 μL, and ddH2O to a final volume of 50 μL. After mixing the above formula, PCR amplification was performed according to the above PCR amplification program. 1 μL of LMT enzyme was added to the PCR product and mixed well. The mixture was then incubated at 37°C for 1 h, and the target fragment DasR was recovered. K78Q and DasR K78R ;

[0062] (3) Obtaining the pIB-139 plasmid backbone:

[0063] PCR amplification was performed using pIB-139 vector as a template to obtain the target gene. The primer sequences were as follows:

[0064] pIB139-F (5'-3'): gacagcaaatgggtcgcggatccgaattc (SEQ ID NO. 8);

[0065] pIB139-R(5'-3'): gctcgagtgcggccgcaagctt (SEQ ID NO. 9).

[0066] The PCR reaction mixture consisted of 25 μL buffer, 1 μL dNTPs, 2 μL upstream primer, 2 μL downstream primer, 1 μL template, 1 μL high-fidelity DNA polymerase, and 18 μL ddH2O. The PCR procedure was the same as above. After agarose gel electrophoresis, the PCR products were compared with the marker to obtain the plasmid backbone pIB139.

[0067] The obtained plasmid backbone pIB139 was coupled with the target fragments DasR and DasR, respectively. K78Q 、DasR K78R Ligation was performed using a multi-fragment homologous recombinase. The recombination reaction conditions were as follows: 6 μL of homologous recombinase, 4 μL of the target fragment, and 2 μL of enzyme digestion plasmid were mixed and incubated at 50°C for 30 min. After incubation on ice for 5 min, the entire mixture was added to DH5α competent cells and gently mixed. After incubation on ice for 30 min, the mixture was heat-shocked at 42°C for 90 s, incubated on ice for 3 min, and then 750 μL of LB medium was added. The cells were then activated at 37°C and 220 rpm for 45 min. The activated bacterial culture was spread on LB agar plates containing 50 μg / mL apramycin and incubated overnight at 37°C. Single clones were picked and sequenced. After alignment with the designed sequence, the single clones with correct sequencing were retained to obtain the contents of pIB139-PermE-his-DasR-his and pIB139-PermE-his-DasR. K78Q -his and pIB139-PermE-his-DasR K78R Bacterial culture containing the -his plasmid.

[0068] (4) Obtaining the pET28a plasmid backbone:

[0069] PCR amplification was performed using pIB-139 vector as a template to obtain the target gene. The primer sequences were as follows:

[0070] pET28a-F: CATCATCATCATCATCACTGATGAG (SEQ ID NO. 10);

[0071] pET28a-R: CATATGGCTGCCGCGGCAC (SEQ ID NO. 11).

[0072] The PCR reaction mixture consisted of 25 μL buffer, 1 μL dNTPs, 2 μL upstream primer, 2 μL downstream primer, 1 μL template, 1 μL high-fidelity DNA polymerase, and 18 μL ddH2O. The PCR procedure was the same as above. After agarose gel electrophoresis, the PCR products were compared with the marker to obtain the plasmid backbone pET28a.

[0073] The obtained plasmid backbone pET28a was coupled with the target fragments DasR and DasR, respectively. K78Q 、DasR K78RLigation was performed using a multi-fragment homologous recombinase. The recombination reaction conditions were as follows: 6 μL of homologous recombinase, 4 μL of the target fragment, and 2 μL of enzyme digestion plasmid were mixed and incubated at 50°C for 30 min. After incubation on ice for 5 min, the entire mixture was added to DH5α competent cells and gently mixed. After incubation on ice for 30 min, the mixture was heat-shocked at 42°C for 90 s, incubated on ice for 3 min, and then 750 μL of LB medium was added. The cells were then activated at 37°C and 220 rpm for 45 min using a shaker. The activated bacterial culture was spread on LB agar plates containing 50 μg / mL kanamycin and incubated overnight at 37°C. Single clones were picked and sequenced. After alignment with the designed sequence, the single clones with correct sequencing were retained to obtain the contents of E. coli DH5α-pET28a-his-DasR-his and E. coli DH5α-pET28a-his-DasR. K78Q -his and E.coliDH5α-pET28a-his-DasR K78R The bacterial culture containing the -his plasmid was used to extract successfully transformed positive plasmids using a plasmid miniprep kit (TransGen Biotech), yielding pET28a-his-DasR-his and pET28a-his-DasR. K78Q -his and pET28a-his-DasR K78R The -his plasmid was extracted and 1 μL of the plasmid was transformed into E. coli BL21 competent cells using the same method described above, yielding E. coli BL21-pET28a-his-DasR-his and E. coli BL21-pET28a-his-DasR plasmids. K78Q -his and E.coli BL21-pET28a-his-DasR K78R -his strain.

[0074] 5. Overexpression plasmid was transferred into *Saccharopolysporum rubrum*.

[0075] Add 50 μL of DH5α Escherichia coli bacterial culture containing the overexpression plasmid to a 5 mL LB liquid medium test tube and incubate at 37 °C and 220 rpm for 24 hours. The cultured bacterial culture is then used to extract and purify the plasmid using a plasmid extraction kit.

[0076] 50 μL of pIB139-PermE-his-DasR-his and pIB139-PermE-his-DasR were placed on ice. K78Q -his and pIB139-PermE-his-DasR K78RThe -his plasmid was added to 50 μL of *Gynostemma pentaphyllum* protoplasts, followed by 200 μL of PEG-T. The mixture was gently mixed and then spread onto antibiotic-free R3M agar plates. The plates were incubated at 30°C for 24 hours. Then, 1 mL of 125 μg / mL apramycin solution was evenly spread onto the plates, and the plates were incubated at 30°C for 3-5 days. After incubation, the single colonies that grew on the plates were spread onto antibiotic-free R3M agar plates pre-spread with 1 mL of 125 μg / mL apramycin solution. The plates were incubated at 30°C for 2-3 days. The grown cells were picked and added to 5 mL of TSB liquid medium containing 50 μg / mL apramycin. The plates were incubated at 30°C and 220 rpm for 48 hours. The normally growing bacterial culture was sequenced using M13F / R primers. After alignment with the designed sequence, the correctly sequenced bacterial culture was retained to obtain the transformant strain OdasR containing the overexpression plasmid. K78R and OdasR K78Q .

[0077] M13F (5'-3'): GTGCTGCAAGGCGATTAAGTT (SEQ ID NO. 12);

[0078] M13R(5'-3'): TTATGCTTCCGGCTCGTATGT (SEQ ID NO. 13).

[0079] 6. Protein induction and purification

[0080] (1) Escherichia coli culture: Take 50 μL of the stored BL21-pET28a-his-DasR-his, BL21-pET28a-his-DasR K78Q -his and BL21-pET28a-his-DasR K78R -his bacterial suspension was inoculated into 5mL LB liquid test tubes and incubated at 37℃ and 220rpm for 8–12 hours until OD. 600 Approximately 0.6–0.8, take another 50 μL of bacterial culture and add it to 5 mL of LB liquid medium. Incubate at 37°C and 220 rpm for 8–12 hours until OD reaches 0.6–0.8. 600 The bacterial culture was approximately 0.6–0.8. The cultured bacterial solution in the test tube was inoculated into 100 mL of LB liquid medium and incubated at 37°C and 220 rpm for 2 hours until the OD value reached 0.6–0.8. 600 The concentration was approximately 0.6. Add 100 μL of IPTG solution with a concentration of 96 mg / mL and incubate at 20 °C and 220 rpm for 12-14 hours.

[0081] (2) Cell collection and disruption: 100 mL of BL21-pET28a-his-DasR-his, BL21-pET28a-his-DasR, which had been cultured for 12 hours were collected and disrupted. K78Q -his and BL21-pET28a-his-DasR K78R -His bacterial culture was collected in 50 mL centrifuge tubes and washed with PBS. It was then redissolved in 40 mL of PBS solution and disrupted using a 45% power cell disruptor at a frequency of 3 seconds on and 5 seconds off for approximately 20 minutes until the solution was relatively clear. 50 μL of the disrupted solution was taken as the total protein solution and centrifuged at 8000 rpm for 10 minutes. 50 μL of the disrupted solution was taken as the supernatant.

[0082] (3) Nickel column affinity purification

[0083] a. The supernatant obtained after crushing and centrifugation was filtered using a 0.45 μm aqueous filter membrane;

[0084] b. Wash the NiNTABeads column with 20-30 mL of imidazole-10;

[0085] c. Add the filtered supernatant into the column, and let it pass through the column automatically by gravity;

[0086] d. After all the supernatant has passed through the column, add 20-30 mL of imidazole-20 to the column to wash away non-specifically bound substances;

[0087] e. After washing, use 3-5 mL of imidazole-250 to elute the target protein and save the eluent;

[0088] f. Clean the column with 20 mL of 0.5 M sodium hydroxide. After cleaning, add 20-30 mL of imidazole-10 to clean the column again. Reserve some imidazole-10 for column preservation and store in a 4°C refrigerator for later use.

[0089] g. Use SDS-PAGE to verify the size of the two samples reserved in the previous steps and the final effluent.

[0090] (4) Protein preservation and quantification

[0091] a. The purified protein solution was subjected to ultrafiltration membrane ultrafiltration to remove NaCl and imidazole, and the protein preservation liquid was replaced with the buffer solution required for the experiment.

[0092] b. Use the BCA method to determine the concentration of protein after ultrafiltration;

[0093] c. Add an appropriate amount of glycerol to the protein solution that is not to be used immediately, and freeze it in a freezer at -80°C. If the protein cannot be stored for a long time, it needs to be used immediately.

[0094] 7. Performance Validation Methods for Transformant Strains

[0095] 7.1 Electrogel Retention Assay (EMSA)

[0096] (1) Probe design: Using the genome of S. erythraea NRRL2338 (wild-type WT) as a template, EMSA probe primers were designed and biotin was added to the 5' end. The probe primer sequences are shown in Table 1.

[0097] Table 1 Probe Primer Sequences

[0098]

[0099] (2) Combination reaction:

[0100] Set up the EMSA binding reaction according to Table 2:

[0101] Table 2 EMSA binding reaction

[0102]

[0103] Add the reagents in the order described above, mix well before adding the probe, and let stand at room temperature for 10 minutes to eliminate any possible non-specific binding reactions. Finally, add the probe, mix well, and incubate at 18°C ​​for 30 minutes.

[0104] (3) Pre-electrophoresis: This operation is generally performed before the binding reaction. 1 L of 0.5×TBE electrophoresis buffer is prepared using 5×TBE as the stock solution. To avoid disrupting the binding reaction, pre-electrophoresis, subsequent electrophoresis, and membrane transfer operations must be performed in a low-temperature environment. Adjust the voltage to 160V for 70 min of pre-electrophoresis. The comb needs to be removed during pre-electrophoresis.

[0105] (4) Electrophoresis: After incubation, add 1 μL of 10×EMSA loading buffer (colorless) to each sample, mix well, and load immediately. Set the voltage to 100V and run for another 30 minutes until the blue buffer line appears on the gel. If the probe design sequence is less than 100bp, electrophoresis can be stopped when the buffer line reaches the bottom. Ensure the electrophoresis is performed at a low temperature, and replace the ice pack every 20 minutes. If the temperature continues to rise, the voltage needs to be reduced appropriately.

[0106] (5) Transfer: After electrophoresis, scrape off the non-denaturing gel and immerse it in transfer buffer (0.5×TBE buffer). Prepare two sheets of filter paper and immerse them in the transfer buffer. Simultaneously, cut an appropriate size NC membrane and immerse it in the transfer buffer as well. Lay out the EMSA sandwich plate and place the moistened black sponge, filter paper, NC membrane, EMSA gel, filter paper, and black sponge in sequence on the transparent side, ensuring no air bubbles are left between each pair, as this will affect the transfer effect. When placing the membrane into the transfer tank, try not to touch the middle of the sandwich plate; carefully place it in while holding the sides. Perform low-temperature transfer at a constant current of 380mA for approximately 45 minutes, changing the ice pack every 20 minutes.

[0107] (6) Crosslinking: Near the end of the transfer, prepare a plastic wrap to cover the petri dish, and simultaneously dissolve the blocking and washing solutions (5×) in a 40°C water bath. After the transfer is complete, carefully remove the NC membrane with tweezers and attach it to the plastic wrap. Immediately perform UV crosslinking using a UV-light crosslinker with a wavelength of 254 nm and a wavelength of 120 mJ / cm². 2 Crosslinking for 90 seconds.

[0108] (7) Blocking and antibody incubation: Add 20 mL of blocking solution to a petri dish, then quickly place the cross-linked NC membrane into the petri dish and block on a horizontal shaker at low speed at room temperature for 30 min. Discard the blocking solution, add another 20 mL of new blocking solution to the petri dish, add 2 μL of Streptavidin-HRP Conjugate to the blocking solution, and incubate the antibody on a horizontal shaker at low speed at room temperature for 35 min.

[0109] (8) Washing: Take a clean beaker, add 12 mL of washing solution (5×) and 48 mL of ddH2O, mix well to prepare 60 mL of 1× washing solution. Discard the blocking solution, add 20 mL of washing solution, and wash slowly on a horizontal shaker for 10 min. Replace the washing solution and repeat the washing process twice.

[0110] (9) Imaging: Remove the NC membrane from the washing solution and keep it moist. Mix equal volumes of P-ECLA and P-ECLB working solutions (ECLA) to prepare the chemiluminescence solution. Dispense the chemiluminescence solution evenly onto the membrane and take a picture using an imager. Adjust the exposure time as needed. If the detected protein signal is very high, the NC membrane with the working solution can be placed on a low-speed shaker and shaken for 1-2 minutes to equalize the working solution and avoid excessive local consumption of reactants, which could affect the linear range of the detection signal.

[0111] 7.2 Acetylation reaction

[0112] Set up different acetylation reactions according to Tables 3 and 4:

[0113] Table 3 AcP-catalyzed acetylation reactions

[0114]

[0115] Table 4 Enzyme-catalyzed acetylation reactions

[0116]

[0117] All reagents must be kept on ice to avoid degradation caused by repeated freeze-thaw cycles. A control group must be included in the experiment. After the reaction is complete, quench the reaction by adding 20 μL of 6×Protein Loading Buffer to a 100 μL volume for subsequent Western blot validation.

[0118] 7.3 Western Blot

[0119] (1) Take 20 μL of each sample that underwent acetylation reaction for different times, add 5 μL of 5× Protein Loading Buffer, vortex and mix well, place in a PCR instrument and denature at 99℃ for 10 min. Position the protein gel plate with the shorter end facing inwards and clamp it tightly with a clip. Add electrophoresis buffer to the protein gel clip and place it on a clean table for 2 min to check for leaks. If leakage is found, readjust the clip position. After leak testing, add samples one by one, spotting Protein Markers at both ends, with a sample volume of 5 μL. Add samples sequentially, with a sample volume of 20 μL, preparing two sets of identical samples. After sample addition, ensure that black electrodes are applied to black electrodes and red electrodes to red electrodes. If reversed, sample backflow will occur, causing sample loss. The voltage program is 80V for the upper stacking gel for 30 min, and 120V for the lower separating gel. Stop when the buffer line reaches approximately 1 / 7 of the bottom of the gel. After electrophoresis, remove the gel and cut off the colored upper gel. Select one group, gently scrape off the lower gel with a scraper and place it in an incubation box. Add Coomassie Brilliant Blue staining solution and stain for about 30 minutes. After staining, recover the staining solution, add tap water, heat in a microwave oven on medium heat for 2-3 minutes, wash and decolorize, and preliminarily check the protein purification effect.

[0120] (2) After completing SDS-PAGE, scrape the protein gel from another set of samples and immerse it in the transfer buffer. Simultaneously, prepare two sheets of filter paper and immerse them in the transfer buffer. Cut a PVDF membrane to the appropriate size and immerse it in methanol for 5 minutes to fully activate it. Lay out a sandwich plate and place the moistened black sponge, filter paper, PVDF membrane, protein gel, filter paper, and black sponge in sequence on the transparent side. When placing it into the transfer tank, try not to touch the middle of the sandwich plate; carefully place it by holding the sides. Transfer the membrane at a constant current of 380mA for approximately 30 minutes at a low temperature. Ensure the electrodes are aligned (black to black) and the current flows from the negative electrode to the positive electrode; otherwise, the transfer will be reversed. If the Protein Marker is on the PVDF membrane after transfer, the transfer can be considered successful.

[0121] (3) Blocking: After the transfer is complete, carefully remove the membrane and place it in an incubation box. Add 10 mL of blocking solution containing 5% BSA and block for 2 hours to remove non-specific adsorption. BSA powder should be stored in a refrigerator at 4°C.

[0122] (4) Antibody incubation: After blocking, discard half of the blocking solution. Add 2 μL of primary antibody directly to the incubation chamber containing approximately 5 mL of blocking solution. Gently shake on a low-speed horizontal shaker for 10 min to ensure complete dilution of the primary antibody. Then incubate overnight at 4°C. The next day, recover the primary antibody and wash three times with 10 mL of TBST at room temperature for 10 min each time. At the end of the third wash, add the corresponding secondary antibody and incubate at room temperature for 1 h. After incubation, wash three times with 10 mL of TBST at room temperature for 10 min each time.

[0123] (5) Development: Remove the PVDF membrane from the TBST washing solution and place it on a plate, keeping the PVDF membrane moist. Mix equal volumes of P-ECLA and P-ECL B working solutions (Yamei) to prepare the chemiluminescence solution. Drop the chemiluminescence solution evenly onto the membrane, take a picture using an imager, and adjust the exposure time as needed.

[0124] 7.4 Mass spectrometry analysis of acetyl sites

[0125] (1) Add 30 μL of SDT buffer solution (4% SDS, 100 mM DTT, 150 mM Tris-HCl, pH 8.0) to 20 μg of protein, and then dissolve it at 90 °C for 5 min.

[0126] (2) Use 200 μL UA buffer solution (8M Urea, 150 mM Tris-HCl, pH 8.0) for repeated ultrafiltration to remove residual cleaning agent, DTT and other low molecular weight components.

[0127] (3) Add 100 μL of 0.05 M iodoacetamide to the UA buffer solution to block the reduced cysteine ​​residues. Incubate the sample in the dark for 20 min.

[0128] (4) After cleaning the filter three times with 100 μL UA buffer solution, clean it twice with 100 μL 25 mM NH4HCO3.

[0129] (5) The protein was resuspended in 40 μL of 25 mM NH4HCO3 containing 2 μg trypsin and digested at 37 °C.

[0130] (6) The trypsin-digested protein was subjected to solid-phase extraction, and the acetylation sites of the protein were analyzed by 1 mL C-MS / MS using a mass spectrometer (Thermo Finnigan, San Jose, CA). Prior to mass spectrometry, the peptides were analyzed by HPLC. A quartz glass column (0.15 mm OD; 150 mm ID) was used, sealed with an Agilent peptide sealing ring (Zorbax 300SB-C18). The mobile phase A for HPLC was 0.1% (v / v) formic acid aqueous solution, and mobile phase B was 0.1% (v / v) formic acid acetonitrile (84% v / v) solution, with a flow rate of 1 mL / min. The elution from 4% (v / v) B to 50% (v / v) B required at least 50 min; the elution from 50% (v / v) B to 100% B required at least 4 min; and the elution was maintained at 100% (v / v) B for at least 6 min. The peptides eluted by HPLC were then analyzed by subsequent MS / MS.

[0131] (7) MS / MS mass spectrometry analysis was performed using the Mascot search engine (Matrix Science, London, UK; version 2.2) to search the Saccharopolyspora_NRRL23338 database. Protein identification settings: peptide mass tolerance = 20 ppm; MS / MS tolerance = 0.1 Da; enzyme = trypsin; uncut = 2; fixed modification: urea methyl (C); variable modification: oxidation (M), acetylation (K, N-terminus); decoy database mode = reverse. The error rate (FDR) of all obtained data did not exceed 1%, with a confidence level of 99%.

[0132] 7.5 Crosslinking Experiment

[0133] DSS, also known as bis(succinimide) octanoate, is a type of membrane-permeable crosslinking agent soluble in the organic solvent DMSO. Its mechanism of action is as follows: DSS has an amine-reactive N-hydroxysuccinimide (NHS) ester at the end of each carbon atom spacer arm. Under pH 7-9 conditions, the NHS ester reacts with primary amines to form stable amide bonds. The side chains of protein lysine (K) residues contain several primary amines, which can then serve as targets for crosslinking with the NHS ester.

[0134] (1) Sample preparation: The target protein was ultrafiltered into the cross-linking buffer. The cross-linking buffer system consisted of 20 mM (pH 8.0) dihydroxyethylglycine, 150 mM NaCl, 10 mM MgCl2, 0.2% N-octylglucoside and 8% glycerol.

[0135] (2) The cross-linking system is shown in Table 5.

[0136] Table 5 Crosslinking System

[0137]

[0138] Western blot verification: After the reaction was completed, 10 μL of 6× Protein Loading Buffer was added for quenching, followed by Western blot and development verification.

[0139] 7.6 Field Emission Scanning Electron Microscope

[0140] (1) In the clean bench, take out a portion of the cultured bacterial solution and spread it evenly on the R2YE plate. After it dries, insert the sterilized mica sheet (10mm×10mm) obliquely into the plate, seal the plate, and invert it in a 30℃ incubator for culture.

[0141] (2) After culturing on a plate for 144 hours, remove it and carefully take out the mica sheet with sterilized tweezers, with the side covered with bacteria facing up.

[0142] (3) Add an appropriate amount of electron microscopy sample fixative (Solebo) to the mica sheet, ensuring that the bacteria on its surface are completely covered, and place it in a 4°C refrigerator for 1 hour of static incubation.

[0143] (4) After fixation, carefully aspirate the fixative, cover its surface with a small amount of ultrapure water to wash away the fixative and residual culture medium, and then carefully aspirate the water after washing. Repeat 2-3 times.

[0144] (5) After washing, add 10% ethanol to the mica sheet, let it stand at 4°C for 15 minutes, then carefully remove the ethanol. Then repeat this operation with 30%, 50%, 70%, 90% and 100% ethanol respectively. This step is to dehydrate the sample in a gradient.

[0145] (6) After dehydration, add 100% ethanol to cover the mica sheet, and place the sample face up in a freeze dryer for freeze drying.

[0146] (7) Fix the sample on the stage. Use conductive adhesive to cover the sterile areas. Use a surface ion sputtering instrument to spray platinum onto the sample surface. After spraying, place it in a field emission scanning electron microscope and select an appropriate field of view and magnification for imaging.

[0147] 8. Performance verification results of transformant strains

[0148] 8.1 DasR K78 acetylation is AcP-mediated.

[0149] Western blotting results showed that AcP-dependent acetylation of DasR was time-dependent, with the acetylation level gradually increasing with increasing reaction time. Figure 2 AcuA does not have the ability to acetylate DasR. Figure 2 (B). Under in vitro reaction conditions, AcP can acetylate the K21, K78, K84, and K86 sites of DasR, but in vivo, only K78 acetylation of DasR is detected. Figure 3 Comparing the structure of DasR reveals that the K78 site is located within the N-terminal HTH domain, which is responsible for binding to DNA. Figure 4 To investigate whether the K78 site is conserved in actinomycetes, homology analysis was performed on it with DasR from other actinomycetes. The results showed that the key acetylation site K78 is highly conserved. Figure 5 In summary, acetylation at the DasRK78 site is mediated by AcP, and this site is highly conserved within actinomycetes.

[0150] 8.2K78 acetylation affects the binding of DasR to DNA.

[0151] Mutating K78 to Q resulted in DasR losing its ability to bind to the disA probe, while the protein mutated to K78R showed similar results to WT. This indicates that acetylation at the K78 site inhibits the binding of DasR to DNA, while deacetylation has little effect on the binding of DasR to DNA. Figure 6 The chemical cross-linking experiments further demonstrated that acetylation at the K78 site significantly affected the formation of the DasR dimer. Figure 6 (B).

[0152] 8.3 Modification of the DasR acetylation site can enhance the sporulation capacity of *Saccharomyces rubrum*.

[0153] To further understand the relationship between DasR acetylation-regulated c-di-AMP levels and the sporulation capacity of *Saccharopolysporum rubrum*, the differentiation process of *Saccharopolysporum rubrum* was observed using R2YE plate observation and field emission electron microscopy. The results showed that, compared with OdasR... K78R In comparison, OdasR K78Q The differentiation rate was significantly slowed down, indicating that K78 acetylation inhibits the sporulation process of *Saccharomyces rubrum*. Figure 7 Field emission electron microscopy experiments further confirmed this result (A). Figure 7 Based on this acetylation mechanism, mutating the K78 site of DasR to arginine can effectively increase the differentiation rate of actinomycetes and enhance their stress resistance.

[0154] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for improving the information storage capacity of Actinomyces elevatus, characterized by, The method comprises a step of performing a simulated deacetylation mutation on a DasR protein of an actinomycete; The simulated deacetylation mutation is a mutation of lysine at position 78 of the DasR protein into arginine; The method comprises the following steps: constructing a recombinant vector containing a simulated deacetylation mutation sequence through site-directed mutagenesis; transducing the recombinant vector into the actinomycete to make the actinomycete express the DasR protein and the DasR mutant protein; The simulated deacetylation mutation sequence is obtained by amplification using primers shown as SEQ ID NO. 4 and SEQ ID NO. 5, with a DasR gene shown as SEQ ID NO. 3 as a template; The actinomycete is S. erythraea NRRL2338; The improvement of the information storage capacity of the actinomycete specifically refers to improvement of sporulation capacity and morphological differentiation speed of the actinomycete.

2. The method of claim 1, wherein, The improvement of the sporulation capacity of the actinomycete specifically refers to improvement of sporulation amount and shortening of sporulation cycle of the actinomycete.

3. An actinomycete constructed by the method of claim 1 or 2.

4. Use of the actinomyces of claim 3 for the preparation of an information storage carrier, characterized in that The capacity of the information storage carrier specifically refers to improvement of sporulation capacity and morphological differentiation speed of the actinomycete.

Images