Construction method and application of Newcastle disease virus efficient recombinant reverse genetic system based on CPER technology

Abstract

The invention belongs to the technical field of virus reverse heredity, and particularly relates to a construction method and application of a Newcastle disease virus efficient recombinant reverse heredity system based on a CPER technology. The construction method comprises the following steps: carrying out CPER assembly on the Newcastle disease by using a linker fragment for coding Pol-I, preparing an NP / P / L helper plasmid, verifying a recombinant virus after co-transfecting cells, and the like. By using the reverse genetic system prepared by the invention, the need for molecular cloning of bacteria can be omitted, so that various recombinant viruses with mutated and / or inserted exogenous genes can be designed and generated in a short time. The recombinant Newcastle disease virus prepared by the method lays a good foundation for development of related novel Newcastle disease vaccines. Meanwhile, the reverse genetic system can generate more viruses and overcome the problem of low transfection efficiency, so that the reverse genetic system has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of viral reverse genetics, and specifically relates to a method for constructing a high-efficiency recombination reverse genetics system for Newcastle disease virus using the circular polymerase extension reaction (CPER), and realizing rapid assembly of infectious clones of the Newcastle disease virus full genome. The present invention also relates to the application of the system in vaccine development, viral gene function research and antiviral drug screening. Background Art

[0002] Newcastle disease (ND), also known as Asian fowl plague and more commonly as fowl plague, is a highly contagious disease caused by the Newcastle disease virus (NDV). ND spreads rapidly and has a high mortality rate. Once it occurs, it causes severe losses and poses a significant threat to the poultry industry.

[0003] NDV belongs to the Paramyxoviridae family, Paramyxovirinae subfamily, and Avulavirus genus. NDV has an envelope with radially arranged fibrous projections on its outer layer. These projections stimulate the host to produce antibodies that can inhibit the virus from agglutinating red blood cells, as well as virus-neutralizing antibodies. NDV's nucleic acid is non-segmented, single-stranded, negative-strand RNA. The NDV genome contains six genes, arranged in sequence: NP, P, M, F, HN, and L. These genes encode the nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin-neuraminidase (HN), and large molecular protein (L).

[0004] The NP protein is encoded by 489 amino acids. Its N-terminus binds to the viral genome, forming the viral nucleocapsid and protecting it from degradation by host cell RNases. The C-terminus (carboxyl terminus) binds to the P protein and, together with two other internal proteins, P and L, form a ribonucleoprotein complex (RNP), enabling genome replication and transcription. The P protein, composed of 395 amino acids, forms a unique tetrameric structure with the L protein to form the PL complex. This complex possesses RNA-dependent RNA polymerase activity, synthesizing positive-strand RNA from negative-strand RNA as a template, furthering viral genome replication. The M protein, composed of 364 amino acids, is located between the viral envelope and the nucleocapsid. It binds to both envelope glycoproteins and nucleocapsid proteins, supporting the interior of the envelope. The M protein interacts with the host cell membrane and is a crucial step in viral budding. The F protein is a type I glycosylated protein located on the surface of the viral particle. Initially present as the inactive F0 form, the F protein fuses with the host cell membrane, facilitating viral entry into the host cell. After entering cells, it is cleaved by host cell proteases into two fusion-competent subunits, F1 and F2. These subunits represent the amino and carboxyl termini of F0, mediating fusion between the virus and the cell membrane. Amino acids 112 to 117 of the F protein are known as the F protein cleavage site. The characteristics of this site determine the virulence of NDV. Highly virulent strains, characterized by a high concentration of basic amino acids in the cleavage site (e.g., 112R / KRQK / RR-F117), are cleaved by proteases in various organs and tissues of various hosts, causing systemic symptoms. Low-virulent strains, on the other hand, have a high concentration of neutral amino acids in the F0 cleavage site (e.g., 112G / EK / RQG / ER-L117), resulting in cleavage only in the respiratory and intestinal tracts, causing localized symptoms. The HN protein is a type II glycosylated protein on the surface of viral particles. It possesses both hemagglutination (HA) and neuraminidase (NA) activities. During viral invasion, it recognizes sialic acid receptors, attaches to the cell surface, and promotes F protein-cell fusion. The L protein is the largest structural protein encoded by the NDV genome, consisting of 2204 amino acids. Besides binding to the P protein at its N-terminus (amino terminus) to exert polymerase activity, it also participates in the synthesis and modification of mRNA, including 5'-end capping, methylation, and polyA polymerase activities.

[0005] During NDV replication, the F protein is synthesized as its precursor, F0. Only when F0 is cleaved into F1 and F2 does the progeny virus become infectious. This cleavage is mediated by proteases in the host cell. NDV strains are classified into two categories: Class I and Class II based on the sequence of the F gene, specific enzyme cleavage patterns, and variations in amino acid residues in the variable region of the F protein. Class I represents attenuated strains; Class II can be further divided into nine genotypes: genotypes I through IV represent early genotypes, and genotypes V through IX represent late genotypes.

[0006] NDV is widely distributed and can infect almost all birds in the world. NDV generally invades the respiratory and digestive tracts of susceptible animals to reproduce, spreads throughout the body through the blood system, damages the blood vessel walls in the blood vessels, causes varying degrees of bleeding and necrosis, and causes severe digestive system disorders and respiratory symptoms such as difficulty breathing. After infection with virulent NDV, it will destroy the lymphatic tissue, thymus, spleen and bursa of Fabricius throughout the body, leading to severe immunosuppression. Infected animals show different clinical symptoms due to the virulence of the NDV strain and host factors. NDV infection in chickens is generally divided into three pathogenic types: (1) Lentogenic symptoms caused by infection with low-toxic or non-toxic strains, which are usually asymptomatic or only manifest as mild respiratory symptoms; (2) Mesogenic symptoms caused by moderately toxic strains, which manifest as lethality in young birds and decreased egg production in adult chickens; (3) Velogenic symptoms caused by infection with virulent strains, which cause acute death in susceptible chickens.

[0007] With the development of Newcastle disease vaccines, the outbreak of Newcastle disease has been reduced, but it has not been completely and effectively controlled and still poses a serious threat to the breeding industry.

[0008] To differentiate the virulence of Newcastle disease virus, the World Organisation for Animal Health (WOAH) defines reverse genetics of RNA viruses as: based on the in vivo transcription and replication characteristics of RNA viruses, the viral genomic RNA is transcribed into easily manipulated cDNA. This artificially modified genomic DNA, with the ability to efficiently express foreign genes, is then used to simulate the process of viral invasion in vitro. With the help of a promoter, the mRNA is transcribed into mRNA, which serves as a template for synthesizing the virus's structural proteins. These proteins are then assembled into infectious, complete virions within the cell, achieving the "resurrection" of the virus. This process is therefore also known as virus rescue. Because this technique studies viral genome structure and function by manipulating the viral genome, contrary to the principles of classical Mendelian genetics, it is called reverse genetics.

[0009] To establish NDV reverse genetic manipulation technology, it is first necessary to construct a full-genome cDNA clone and a helper plasmid, respectively, and then perform viral particle rescue and identification of the biological characteristics of the rescued virus. Among them, the cloning of full-length genome fragments is a key link in reverse genetic manipulation technology. Because the NDV viral genome is long, segmented amplification is adopted and then spliced in vitro through adjacent fragment restriction sites, and appropriate base sequences in the non-coding region of the genome are selected for mutation to facilitate genetic identification of the rescued progeny recombinant virus. In addition, a hammerhead ribozyme (HamRz) sequence with self-cleavage function and a partial coding sequence of the hepatitis D ribozyme (HdvRz) are added to the 5' and 3' ends of the genome, so that after the full-length cDNA is transcribed, an accurate terminal sequence is formed under the cleavage activity of the two ribozymes. When NDV is used as a vector vaccine to express exogenous genes, in order to ensure that the exogenous genes are recognized by the NDV RNA-dependent RNA polymerase, gene transcription start signals (GS: 3'-UGCCCAUCU / CU-5') and gene transcription end signals (GE: 3'-AAU / CUUUUUU-5') are introduced at both ends of the exogenous gene sequence.

[0010] As a negative-strand RNA virus, NDV genomic RNA or the RNA transcribed from its cDNA cannot be directly used as a template for transcription and replication. In order to carry out normal replication and packaging of virions, the nucleocapsid protein NP, phosphoprotein P, and large polymerase protein L are pre-packaged to form a ribonucleoprotein complex (RNP). Therefore, establishing an NDV reverse genetic operating system requires constructing a cDNA molecular clone containing the full genome of the virus, and constructing a helper plasmid containing the coding sequences of NP protein, P protein, and L protein, which are co-transfected into eukaryotic cells to initiate viral replication and translation, and finally assemble progeny virus particles with the genomic RNA.

[0011] Since the emergence of RNA virus reverse genetics for decades, Newcastle disease virus reverse genetics has been widely used to study the relationship between viral genome structure and function and vaccine development. In particular, as a viral vector vaccine, it has many natural advantages: (1) The NDV genome structure is simple and easy to operate; (2) The chicken embryo inoculation yield is high; most NDV attenuated strains have high replication efficiency in chicken embryos and can be used for large-scale vaccine production; (3) Stable expression of exogenous genes, and continuous passage of recombinant NDV in chicken embryos does not affect the expression of exogenous genes; (4) High safety, NDV replication site is the cytoplasm, and there is no Producing DNA intermediates, the viral genome cannot integrate with the host genome in the cell nucleus; (5) It can induce local mucosal immunity and systemic immune response through nasal inoculation; (6) Multiple administration methods, NDV vector vaccine can be administered through spray, drinking water and intramuscular injection, etc., to meet the needs of industrial production; (7) NDV has a high degree of host restriction and generally naturally infects poultry. Moreover, since there are no antibodies against NDV in mammals (including humans), it can produce better immune effects; (8) Genetic stability, NDV has only one serotype, and the possibility of recombination between strains is very small.

[0012] Reverse genetics systems for RNA viruses are based on the expression of viral RNA from full-length cDNA clones that have been incorporated into plasmids, bacterial artificial chromosomes, or yeast artificial chromosomes. The addition of a phage-derived RNA promoter, such as T7 or SP6, upstream of the viral 5' untranslated region (UTR) sequence can drive in vitro transcription of viral RNA after providing the corresponding RNA polymerase. Alternatively, the incorporation of a eukaryotic expression promoter instead of a phage promoter allows host RNA polymerase II to generate viral RNA from transfected DNA. Although these reverse genetics methods have been widely used, the construction and propagation of full-length infectious cDNA clones can be challenging. For example, cDNA clones are unstable when amplified in bacteria and / or yeast, which makes downstream experiments difficult.

[0013] The circular polymerase extension reaction (CPER) method was initially developed for molecular cloning. Because the CPER method avoids the molecular cloning of full-length cDNA clones and their amplification in recipient bacterial and / or yeast hosts, RNA viruses are divided into two categories based on whether their translation is cap-dependent or cap-independent. The latter mechanism is driven by specific RNA elements, called internal ribosome entry sites (IRESs), found in the 5'UTR of viral RNA. IRES-dependent translation requires neither the cap nor some or all of the host factors required for cap-dependent translation. Viral IRESs are divided into four categories (classes I-IV) based on their requirement for host factors and the secondary structure they propose.

[0014] With the help of reverse genetics, the CPER method can be used to perform targeted mutations on the coding sequences of the NDV genome to understand the role and mechanism of the coding genes in the viral life cycle, and then use them as drug treatment targets. Summary of the Invention

[0015] The purpose of this application is to provide a method for constructing a Newcastle disease virus high-efficiency recombination reverse genetics system based on CPER technology. The present invention also uses the Newcastle disease virus high-efficiency recombination reverse genetics system to co-transfect host cells and rescue recombinant Newcastle disease virus NDV from the supernatant of transfected host cells.

[0016] The recombinant Newcastle disease virus prepared by the method of the present invention lays a good foundation for the development of related new Newcastle disease vaccines.

[0017] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0018] A method for constructing a Newcastle disease virus high-efficiency recombination reverse genetics system based on CPER technology comprises the following steps:

[0019] (1) Preparation of Newcastle disease reverse genetics master plasmid

[0020] 1) Extracting NDV viral RNA from the allantoic fluid of chicken embryos infected with NDV and reverse-transcribing it into cDNA;

[0021] 2) Design primers to divide the full-length viral genome into five cDNA fragments, named F1, F2, F3, F4, and F5. Use gene-specific primers and high-fidelity DNA polymerase to amplify the five cDNA fragments covering the entire viral genome. Design 20-40 bp homology arms at both ends of each fragment to ensure accurate splicing during CPER extension. Connect the five cDNA fragments to obtain a linker.

[0022] 3) Synthesize a sequence encoding the Pol-I terminator, spacer, and Pol-I promoter to amplify the linker fragment from step 2); perform CPER assembly using the Pol-I encoding linker fragment, and name the product pCI-NA-1; verify the amplification results by PCR;

[0023] (2) Preparation of Newcastle disease reverse genetics helper plasmid

[0024] 4) NDV viral RNA was extracted from the allantoic fluid of chicken embryos infected with NDV, reverse transcribed into cDNA, and the NDV virus encoding nucleocapsid protein (NP), phosphoprotein (P), and macromolecular protein (L) fragments were amplified;

[0025] 5) The fragments encoding nucleocapsid protein (NP), phosphoprotein (P), and macromolecular protein (L) were ligated into the pCI plasmid to form recombinant plasmids pCI-NP, pCI-P, and pCI-L, respectively;

[0026] 6) Transform the recombinant plasmid into competent E. coli cells, screen positive colonies using a selective medium containing specific antibiotics, and extract the plasmid using an endotoxin removal method for verification, thereby completing the preparation of the helper plasmids pCI-NP, pCI-P, and pCI-L;

[0027] (3) Acquisition of reverse genetics system

[0028] The CPER product (pCI-NA-1) obtained in step 3) and the products (pCI-NP, pCI-P, pCI-L) obtained in step 6) are co-transfected into host cells in a certain ratio to obtain a Newcastle disease virus NDV high-efficiency recombinant reverse genetics system.

[0029] Furthermore, in step 2), the primer sequences are as follows:

[0030] F1-F:TCTGTTTGGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTCACCAAACAGAGAATCTGTGA

[0031] F1-R:CCCGTATTTTTTCTTAGTTTAAACATTTTCTAATGCTGCTGGATT

[0032] F2-F:GTTTAAACTaagaaaaAATACGGGTAGAATCAAAGTGCCCCG

[0033] F2-R:GACTTGTGTCACTACTTTCGGGACAAGTGCGGAG

[0034] F3-F:AGTAGTGACACAAGTCGGTTCTGTGATAGAAGAGCT

[0035] F3-R:CCATCTTTGGTGCGCACATCTGGCTCCTGACTGCTC

[0036] F4-F:GATGTGCGCACCAAAGATGGTAGACTTCGATATGAT

[0037] F4-R:GCCTACTGCATTCAACCTTGAGTGAATGATGGGG

[0038] F5-F: GTTGAATGCAGTAGGCCTAATTAACCATGACGGG

[0039] F5-R: CGAGGAGGTGGAGATGCCATGCCGACCCACCAAACAGAGATTTGGTGAATG。

[0040] Furthermore, in step 3), when performing CPER assembly, the sequences of promoter CMV and Pol (shown as SEQ ID NO.1 and SEQ ID NO.2) are synthesized as follows:

[0041] Pol link:

[0042] ttttttcccccccaacttcggaggtcgaccagtactccgggcgacactttgttttttttttttcccccgatgctggaggtcgaccagatgtccgTCGACAGATCTTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATCGGGCCGGCCCCCTGCGTGTGGCACGGGCGGCCGGGAGGGCGTCCCCGGCCCGGCGCTGCTCCCGCGTGTGTCCTGGGGTTGACCAGAGGGCCCCGGGCGCTCCGTGTGTGGCTGCGATGGTGGCGTTTTTGGGGACAGGTGTCCGTGTCGCGCGTCGCCTGGGCCGGCGGCGTGGTCGGTGACGCGACCTCCCGGCCCCGGGGGAGGTATATCTTTCGCTCCGAGTCGGCATTTTGGGCCGCCGGGTTATT

[0043] CMV link:

[0044] TAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACA AGTTTCGACAGATCTTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATGTGATGCGGTTTTGGCAGTA CACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT.

[0045] Further, in step 4), when amplifying the fragments encoding the nucleocapsid protein (NP), the phosphoprotein (P), and the macromolecular protein (L) of the NDV virus, the primers used include XbaI and NotI restriction sites, and the primers used are:

[0046] NP-F:TCTAGAGCCACCATGGATGTCGTCTGTCTTTGACGAA

[0047] NP-R:GCGGCCGCTCAGTATCCCCAATCAGT

[0048] PF:TCTAGAGCCACCATGGCCACTTTTACAGATGCA

[0049] PR:GCGGCCGCTCAACCATTCAGCGCAAG

[0050] L1-F:TCTAGAGCCACCATGGATGGCGGGCTCCGGT

[0051] L1-R:ATTGTCCCTGTATGCACCCCGGAT

[0052] L2-F: ATCCGGGGTGCATACAGAGGACAATGAGGCGG

[0053] L2-R: GCGGCCGCTTAAGAGTCATTATTACTG.

[0054] Furthermore, in step 5), when the fragments encoding the nucleocapsid protein (NP), the phosphoprotein (P), and the macromolecular protein (L) are respectively connected to the pCI plasmid, the pCI vector is first double-digested with XbaI and NotI, and then connected to form the recombinant plasmids pCI-NP, pCI-P, and pCI-L.

[0055] Furthermore, in step 6), the culture medium is selected to be LB culture medium containing ampicillin.

[0056] Furthermore, in step (iii), during transfection, the mass ratio of the CPER product pCI-NA-1 of step 3) and the products (pCI-NP, pCI-P, pCI-L) of step 6) is 4:(1-2):(1-2):(1-2).

[0057] Furthermore, based on a general inventive concept, the present invention also provides a Newcastle disease virus NDV efficient recombination reverse genetics system constructed using the above method.

[0058] Furthermore, based on a general inventive concept, the present invention also provides the application of the Newcastle disease virus NDV efficient recombination reverse genetics system in reverse genetics rescue of Newcastle disease virus.

[0059] Furthermore, based on a general inventive concept, the present invention also provides a method for reverse genetic rescue of Newcastle disease virus using the Newcastle disease virus NDV efficient recombinant reverse genetics system, comprising the following steps:

[0060] (1) The host cells are passaged and washed, and then cultured in serum-free and antibiotic-free DMEM cell culture medium at a temperature of 35 to 37° C. for at least 30 minutes (preferably 30 minutes to 1 hour);

[0061] (2) Adding a transfection reagent to the cells cultured in step (1), and simultaneously co-transfecting the host cells with the CPER product (pCI-NA-1) obtained in step 3) and the products (pCI-NP, pCI-P, pCI-L) obtained in step 6) in the aforementioned method for constructing a high-efficiency recombination reverse genetic system of Newcastle disease virus based on CPER technology. After transfection, discard the original cell culture medium, culture the cells with DMEM cell culture medium containing chicken embryo allantoic fluid and FBS for a certain period of time, collect the cell culture medium, filter to obtain the supernatant, and rescue the recombinant Newcastle disease virus NDV from the supernatant.

[0062] Specifically, the host cell is a human embryonic kidney cell line.

[0063] Specifically, in step (2), during transfection, the mass ratio of the CPER product pCI-NA-1 of step 3) and the products (pCI-NP, pCI-P, pCI-L) of step 6) is 4:(1~2):(1~2):(1~2).

[0064] Specifically, the total transfection time in step (2) is 2 to 4 hours.

[0065] Specifically, after transfection in step (2), the original cell culture medium is discarded, and the cells are cultured for 2 to 8 days using DMEM cell culture medium containing 5% chicken embryo allantoic fluid and 2% FBS. The cell culture medium is collected and filtered to obtain the supernatant, and the recombinant Newcastle disease virus NDV is rescued from the supernatant.

[0066] Furthermore, based on a general inventive concept, the present invention also provides applications of the Newcastle disease virus NDV efficient recombinant reverse genetics system in vaccine development, viral gene function research, and antiviral drug screening.

[0067] The main purpose of this application is to improve the assembly strategy of Newcastle disease virus reverse genetics and increase its construction speed so that it can play a role when rapid virus characterization is required.

[0068] The present invention first uses CPER technology to assemble Newcastle disease virus and pol I to obtain a reverse genetics master plasmid, which is then co-transfected with a helper plasmid into 293T cells. Next, the viral particles produced by the 293T cells are identified to determine their differences from wild-type strains.

[0069] In general, the main technical advantages of the present invention are reflected in the following aspects:

[0070] (1) Improved efficiency: The present invention utilizes the CPER method to eliminate the need for molecular cloning of bacteria, thereby enabling the design and generation of various recombinant viruses with mutations and / or insertion of exogenous genes in a short period of time.

[0071] (2) Compatibility expansion: supports the insertion of exogenous genes (such as fluorescent markers, antigen epitopes) to facilitate the construction of recombinant vaccine vectors.

[0072] (3) More economical: eliminating the need for conventional vectors and competent cell transformation processes.

[0073] The construction method described in the present invention includes the steps of assembling Newcastle disease virus CPER using a linker fragment encoding Pol-I, preparing NP / P / L helper plasmids, and verifying the recombinant virus after co-transfection into cells. The reverse genetics system prepared by the present invention eliminates the need for molecular cloning of bacteria, allowing the design and generation of various recombinant viruses with mutations and / or inserted exogenous genes in a short period of time. This reverse genetics system can produce more viruses and overcome the problem of low transfection efficiency.

[0074] In summary, the present invention utilizes the circular polymerase extension reaction (CPER) to construct a highly efficient Newcastle disease virus recombination reverse genetics system and realizes a method for rapidly assembling infectious clones of the entire Newcastle disease virus genome. The prepared chimeric Newcastle disease virus-like particles, based on a protein-level modification strategy, can avoid the defects of unstable gene-level transfection, and the chimeric protein can be accurately quantified. At the same time, the chimeric Newcastle disease virus-like particles can effectively enhance the immune response, and thus have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 To map the construction of recombinant NDV;

[0076] Figure 2 This is an electrophoretogram of the recombinant NDV PCR verification; lane 3 is the DL2000plus DNA molecular weight standard, lane 1 is the PCR result of F2 (2284 bp), lane 2 is the PCR result of F5 (2272 bp), lane 4 is the PCR result of F1 (3324 bp), lane 5 is the PCR result of F3 (4025 bp), and lane 6 is the PCR result of F4 (3448 bp);

[0077] Figure 3 To measure the viral RNA level results;

[0078] Figure 4 This is the luciferase test result;

[0079] Figure 5 The results of the hemagglutination test;

[0080] Figure 6 Kinetics of recombinant viruses in chicken embryos. DETAILED DESCRIPTION

[0081] The following examples will further illustrate the present invention with reference to the accompanying drawings. This embodiment is implemented based on the technical solution of the present invention and provides detailed implementation methods and processes, but the protection scope of the present invention is not limited to the following examples.

[0082] The experimental methods in the following examples where specific conditions are not specified are generally based on conventional conditions, and the raw materials and reagents used are all conventional commercially available products unless otherwise specified. The operations are not specifically described in the following examples, and the operations can be performed with reference to the existing technology and relevant product specifications, and will not be repeated here.

[0083] The room temperature in the following examples refers to 25±5°C.

[0084] Biological materials, experimental reagents, culture media and experimental equipment:

[0085] Biomaterials:

[0086] pCI plasmid, human embryonic kidney cell line 293T cells, and Escherichia coli DH5α competent cells were all products of Thermo.

[0087] Experimental reagents:

[0088] 1. Taq polymerase, purchased from Beijing Quanshijin Company;

[0089] 2. Lipofectamine transfection reagent, a product of Roche;

[0090] 3. Plasmid extraction kit and DNA gel recovery kit were purchased from PolyMei Company;

[0091] 4. DMEM is a product of Thermo Fisher Scientific.

[0092] 5. Culture medium: LB solid medium: 10.0 g tryptone, 5.0 g yeast extract, 10.0 g NaCl, 18.0 g agar powder, add deionized water to 1.0 L; pH 7.0-7.2, sterilize at 121°C for 20 min.

[0093] LB liquid medium: 10.0 g of tryptone, 5.0 g of yeast extract, 10.0 g of NaCl, add deionized water to 1.0 L; pH 7.0-7.2, sterilize at 121°C for 20 min.

[0094] Experimental equipment:

[0095] 1. The ultrapure water used in the experiment was prepared by an ultrapure water generator (Christ Spetron Line);

[0096] 2. Low-temperature desktop high-speed centrifuge, product of ICE Company of the United States;

[0097] 3. PCR instrument, product of Thermo Fisher Scientific;

[0098] 4. UV gel imager, a product of Alpha Innotech Corporation;

[0099] Example 1

[0100] Example 1 provides a method for constructing a Newcastle disease virus efficient recombination reverse genetics system based on CPER technology, the specific steps are as follows:

[0101] (1) Preparation of Newcastle disease reverse genetics master plasmid, the specific steps are:

[0102] 1) NDV viral RNA was extracted from the allantoic fluid of chicken embryos infected with the NDV NA-1 strain (GenBank: DQ659677.1) and reverse transcribed into cDNA (reference: Liu Yuliang. Generation of infectious ZJI strain of goose-derived Newcastle disease virus from cDNA cloning [D]. Yangzhou University, 2005);

[0103] 2) Design primers to divide the full length of the viral genome into five cDNA fragments, named F1, F2, F3, F4, and F5 (e.g. Figure 1 ), and using gene-specific primers and high-fidelity DNA polymerase (Taq polymerase) to amplify five cDNA fragments covering the entire viral genome. 20-40 bp homology arms were designed at both ends of each fragment to ensure accurate splicing during CPER extension. The five cDNA fragments were connected to obtain a linker;

[0104] Specifically, the primer sequences are as follows:

[0105] F1-F:TCTGTTTGGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTCACCAAACAGAGAATCTGTGA

[0106] F1-R:CCCGTATTTTTTCTTAGTTTAAACATTTTCTAATGCTGCTGGATT

[0107] F2-F:GTTTAAACTaagaaaaAATACGGGTAGAATCAAAGTGCCCCG

[0108] F2-R:GACTTGTGTCACTACTTTCGGGACAAGTGCGGAG

[0109] F3-F:AGTAGTGACACAAGTCGGTTCTGTGATAGAAGAGCT

[0110] F3-R:CCATCTTTGGTGCGCACATCTGGCTCCTGACTGCTC

[0111] F4-F:GATGTGCGCACCAAAGATGGTAGACTTCGATATGAT

[0112] F4-R:GCCTACTGCATTCAACCTTGAGTGAATGATGGGG

[0113] F5-F:GTTGAATGCAGTAGGCCTAATTAACCATGACGGG

[0114] F5-R:CGAGGAGGTGGAGATGCCATGCCGACCCACCAAACAGAGATTTGGTGAATG

[0115] 3) Synthesize a sequence encoding the Pol-I terminator, spacer, and Pol-I promoter to amplify the linker fragment in step 2); use the linker fragment encoding Pol-I to perform CPER assembly (specific reference: Tamura T, YamamotoH, Ogino S, et al. A rapid and versatile reverse genetics approach forgenerating recombinant positive-strand RNA viruses that use IRES-mediated translation. [J]. Journal of virology, 2024, Vol. 98 (3): e0163823), and the product is named pCI-NA-1; synthesize the sequences of the promoter CMV and Pol (as shown in SEQ ID NO. 1 and SEQ ID NO. 2), as follows:

[0116] Pol link:

[0117] ttttttcccccccaacttcggaggtcgaccagtactccgggcgacactttgttttttttttttcccccgatgctggaggtcgaccagatgtccgTCGACAGATCTTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATCGGGCCGGCCCCCTGCGTGTGGCACGGGCGGCCGGGAGGGCGTCCCCGGCCCGGCGCTGCTCCCGCGTGTGTCCTGGGGTTGACCAGAGGGCCCCGGGCGCTCCGTGTGTGGCTGCGATGGTGGCGTTTTTGGGGACAGGTGTCCGTGTCGCGCGTCGCCTGGGCCGGCGGCGTGGTCGGTGACGCGACCTCCCGGCCCCGGGGGAGGTATATCTTTCGCTCCGAGTCGGCATTTTGGGCCGCCGGGTTATT

[0118] CMV link:

[0119] TAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTTCGACAGATCTTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATATGTACATTTATATTG GCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATAAGCAGAGCT

[0120] The amplified results were verified by PCR. Figure 2 As shown, the agarose nucleic acid electrophoresis bands were correct and the five full-length fragments of NA-1 were amplified successfully.

[0121] (2) Preparation of Newcastle disease reverse genetics helper plasmid, the specific steps are:

[0122] 4) NDV viral RNA was extracted from the allantoic fluid of chicken embryos infected with the NDV NA-1 strain (GenBank: DQ659677.1) and reverse transcribed into cDNA (reference: Liu Yuliang. Generation of infectious ZJI strain of goose-derived Newcastle disease virus from cDNA cloning [D]. Yangzhou University, 2005). NP, P, and L fragments were amplified using gene-specific primers with added XbaI and NotI restriction sites and a high-fidelity enzyme.

[0123] The specific primers used are as follows:

[0124] NP-F:TCTAGAGCCACCATGGATGTCGTCTGTCTTTGACGAA

[0125] NP-R:GCGGCCGCTCAGTATCCCCAATCAGT

[0126] PF:TCTAGAGCCACCATGGCCACTTTTACAGATGCA

[0127] PR:GCGGCCGCTCAACCATTCAGCGCAAG

[0128] L1-F:TCTAGAGCCACCATGGATGGCGGGCTCCGGT

[0129] L1-R:ATTGTCCCTGTATGCACCCCGGAT

[0130] L2-F: ATCCGGGGTGCATACAGAGGACAATGAGGCGG

[0131] L2-R: GCGGCCGCTTAAGAGTCATTATTACTG

[0132] 5) The pCI vector was double-digested with XbaI and NotI, and NP, P, and L were ligated into the pCI vector to form recombinant plasmids pCI-NP, pCI-P, and pCI-L, respectively.

[0133] 6) The recombinant plasmid was transformed into Escherichia coli DH5α competent cells, positive colonies were screened using LB selection medium containing specific antibiotics (final concentration of ampicillin 100 μg / ml), and the plasmid was extracted using an endotoxin-free method (specifically, extraction was performed according to the instructions of the Polymerase Multicolor Endotoxin-Free Plasmid Miniprep Kit, Catalog No.: MF007).

[0134] Example 2

[0135] Example 2 provides a method for reverse genetic rescue of Newcastle disease virus using the Newcastle disease virus efficient recombination reverse genetics system based on CPER technology described in Example 1. The specific steps are as follows:

[0136] Reverse genetics of Newcastle disease

[0137] (1) 293T cells were passaged into six-well cell culture plates. When the cells grew to a density of about 70%, the cells were washed with serum-free and antibiotic-free DMEM cell culture medium, and then cultured with serum-free and antibiotic-free DMEM cell culture medium at 37°C for 30 min-1 h.

[0138] (2) 100 μL of liposome transfection reagent incubated completely at room temperature was directly added to the cells cultured for 30 min in step (1), and at the same time, the CPER product pCI-NA-1 obtained in step 3) of Example 1 and the three auxiliary plasmids pCI-NP, pCI-P and pCI-L obtained in step 6) of Example 1 were transfected into 293T cells at a mass ratio of 4:2:1:1, that is, the transfection amount per well was 5 μg, 2.5 μg, 1.25 μg and 1.25 μg, respectively (the CPER main plasmid product can also produce recombinant NDV carrying the HiBiT luciferase gene); specifically, the recombinant wild-type (NDV-WT) or reporter-type (NDV-HiBiT) virus assembly generated in the CPER product was used to transfect 293T cells (wherein the wild-type (NDV-WT) was the control group), the six-well cell culture plate was gently shaken, and the plate was placed in a cell culture incubator. After 4 h of transfection, the cell culture medium was aspirated and the plate was washed with 5% chicken embryo allantoic fluid and 2% Cultured in DMEM cell culture medium containing FBS;

[0139] Observe cell changes every day. Around the 5th day of culture, collect the cell culture medium, filter it through a 0.22μm filter, and collect the virus particles produced by the transfected cells from the supernatant; infect 293T cells with two recombinant viruses containing CMV and Pol at an MOI of 0.1; then measure the viral RNA level, luciferase and hemagglutination experiments, and the replication kinetics of recombinant chicken embryos (specific reference: Wang Ruinan. Construction and preliminary application of the Newcastle disease virus double plasmid rescue system [D]. Jilin Agricultural University, 2023); and inoculate SPF chicken embryos for virus propagation.

[0140] Specifically, the virus propagation operation is as follows:

[0141] ① Select 9-11 day old SPF chicken embryos, illuminate them with a strong flashlight, draw out the air chamber, mark the inoculation point on the opposite side of the embryo, avoiding the large blood vessels, and make another punch mark in the air chamber above the inoculation point.

[0142] ② Thaw the NDV NA-1 virus solution stored at -80°C on ice, and dilute the NDV virus solution to 10-fold and 100-fold, respectively.

[0143] ③In the clean bench, disinfect the surface of the eggs with 75% alcohol cotton, then wipe the surface of the eggs with iodine, and then deiodine them with 75% alcohol cotton. Use a hole puncher to first punch an opening in the air chamber, and then punch an opening at the inoculation point.

[0144] ④ Insert a 1ml syringe vertically into the inoculation point and inject 200μl of NDV virus liquid into the allantoic cavity. Use candles to seal the air chamber punch point and the inoculation point in turn, and place it in a 37℃ incubator for culture. Discard chicken embryos that died within 24 hours, and collect the chicken embryo allantoic fluid 72 hours after inoculation.

[0145] ⑤ When collecting the virus, use tweezers to break the air chamber, pick up the fragments, push the edges apart, pierce the chorion, and absorb the allantoic fluid on the opposite side of the chicken embryo into a centrifuge tube, and centrifuge at 2000g for 10 minutes.

[0146] Specifically, the steps of the hemagglutination inhibition test are as follows:

[0147] ① Take a 96-well hemagglutination plate, add 25μl PBS to each well, add 25μl virus solution to the first well, mix gently, and pipette 25μl of the mixture from the first well into the second well, and so on, until you reach the 11th well, pipette 25μl of liquid and discard it. Leave the last well untreated.

[0148] ② Add 25 μl of 1% red blood cell suspension to each well, mix gently, incubate at room temperature for 30 minutes, and observe the red blood cell agglutination.

[0149] Experimental results

[0150] from Figure 3 It can be concluded that the RNA replication levels of recombinant NDV and wild-type NDV are similar, indicating that recombinant NDV can replicate in cells.

[0151] from Figure 4 It can be concluded that the recombinant NDV has higher luciferase activity, while the wild-type NDV has no luciferase activity, indicating that the recombinant NDV can carry and express the luciferase gene.

[0152] from Figure 5 It can be concluded that the result of the recombinant NDV hemagglutination inhibition test was a titer of 6, and the recombinant NA-1 virus with hemagglutination activity was successfully rescued.

[0153] from Figure 6 It can be concluded that although the growth rate of recombinant NDV is slightly lower than that of wild strain, the final virus titer can still grow to 10 9 , with growth characteristics similar to those of the wild strain.

[0154] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0155] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0156] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for constructing a high-efficiency recombination reverse genetics system for Newcastle disease virus based on CPER technology, characterized in that: The following steps are involved: (1) Preparation of Newcastle disease reverse genetics master plasmid 1) Extracting NDV viral RNA from the allantoic fluid of chicken embryos infected with NDV and reverse-transcribing it into cDNA; 2) Design primers to divide the full-length viral genome into five cDNA fragments, named F1, F2, F3, F4, and F5. Use gene-specific primers and high-fidelity DNA polymerase to amplify the five cDNA fragments covering the entire viral genome. Design 20-40 bp homology arms at both ends of each fragment. Connect the five cDNA fragments to obtain a linker. 3) Synthesize a sequence encoding the Pol-I terminator, spacer, and Pol-I promoter to amplify the linker fragment from step 2); perform CPER assembly using the Pol-I encoding linker fragment, and name the product pCI-NA-1; verify the amplification results by PCR; (2) Preparation of Newcastle disease reverse genetics helper plasmid 4) Extracting NDV viral RNA from the allantoic fluid of chicken embryos infected with NDV, reverse-transcribing it into cDNA, and amplifying the NDV virus nucleocapsid protein NP, phosphoprotein P, and macromolecular protein L fragments; 5) The fragments encoding nucleocapsid protein NP, phosphoprotein P, and macromolecular protein L were ligated into the pCI plasmid to form recombinant plasmids pCI-NP, pCI-P, and pCI-L, respectively; 6) Transform the recombinant plasmid into competent E. coli cells, screen positive colonies using a selective medium containing specific antibiotics, and extract the plasmid using an endotoxin removal method for verification, thereby completing the preparation of the helper plasmids pCI-NP, pCI-P, and pCI-L; (3) Acquisition of reverse genetics system The CPER product pCI-NA-1 obtained in step 3) and the products pCI-NP, pCI-P, and pCI-L obtained in step 6) are co-transfected into host cells in a certain ratio to obtain a Newcastle disease virus NDV high-efficiency recombinant reverse genetics system.

2. The construction method according to claim 1, wherein In step 2), the primer sequences are as follows: F1-F:TCTGTTTGGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTCACCAAACAGAGAATCTGTGA F1-R:CCCGTATTTTTTCTTAGTTTAAACATTTTCTAATGCTGCTGGATT F2-F:GTTTAAACTaagaaaaAATACGGGTAGAATCAAAGTGCCCCG F2-R:GACTTGTGTCACTACTTTCGGGACAAGTGCGGAG F3-F:AGTAGTGACACAAGTCGGTTCTGTGATAGAAGAGCT F3-R:CCATCTTTGGTGCGCACATCTGGCTCCTGACTGCTC F4-F:GATGTGCGCACCAAAGATGGTAGACTTCGATATGAT F4-R:GCCTACTGCATTCAACCTTGAGTGAATGATGGGG F5-F:GTTGAATGCAGTAGGCCTAATTAACCATGACGGG F5-R:CGAGGAGGTGGAGATGCCATGCCGACCCACCAAACAGAGATTTGGTGAATG.

3. The construction method according to claim 1, wherein In step 3), when CPER is assembled, the sequences of CMV and Pol are synthesized as shown in SEQ ID NO.1 and SEQ ID NO.

2.

4. The construction method according to claim 1, wherein In step 4), when amplifying the fragments encoding the nucleocapsid protein NP, the phosphoprotein P, and the macromolecular protein L of the NDV virus, the primers used include XbaI and NotI restriction sites.

5. A Newcastle disease virus (NDV) efficient recombinant reverse genetics system constructed using the method described in any one of claims 1 to 4.

6. The application of reverse genetics in rescuing Newcastle disease virus (NDV) according to claim 5 using the Newcastle disease virus (NDV) efficient recombinant reverse genetics system.

7. A method for rescuing Newcastle disease virus (NDV) by reverse genetics using the Newcastle disease virus (NDV) efficient recombinant reverse genetics system according to claim 5, comprising the steps of: (1) Passaging the host cells, washing the passaged host cells, and then culturing the host cells in DMEM cell culture medium without serum and antibiotics at a temperature of 35-37°C for at least 30 minutes; (2) The transfection reagent is directly added to the cells cultured in step (1), and the CPER product pCI-NA-1 obtained in step 3) and the products pCI-NP, pCI-P, and pCI-L obtained in step 6) are co-transfected into the host cells in the method for constructing a high-efficiency recombination reverse genetic system of Newcastle disease virus based on CPER technology according to claim 1. After transfection, the original cell culture medium is discarded, and the cells are cultured for a certain period of time with DMEM cell culture medium containing chicken embryo allantoic fluid and FBS, the cell culture medium is collected, and the supernatant is filtered to obtain the recombinant Newcastle disease virus NDV.

8. The method according to claim 7, wherein The host cells are human embryonic kidney cells.

9. The method according to claim 7, wherein In step (2), during transfection, the mass ratio of the CPER product pCI-NA-1 of step 3) and the products pCI-NP, pCI-P, and pCI-L of step 6) is 4:(1-2):(1-2):(1-2).

10. The method according to claim 7, wherein: The transfection time in step (2) is 2 to 4 hours.

Images