SNP (Single Nucleotide Polymorphism) molecular marker for identifying reed roots and application of SNP molecular marker
By analyzing the genome sequences of reed roots, bamboo roots, mangrogens and southern roots, SNP molecular markers were developed, and PCR amplification and sequencing were used for nucleotide sequence polymorphisms, solving the problem of identification of reed roots and other root medicinal materials, and achieving efficient and accurate identification of reed roots.
Patent Information
- Application Number
- CN202510660979.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-08-15
AI Technical Summary
The existing technology is difficult to efficiently distinguish reed roots from reed roots, magnolia roots and southern roots, resulting in confusion of the source of medicinal materials. Traditional identification methods have limitations for non-professional personnel.
By analyzing the genomic sequences of reed roots, reed roots, mangrogens and southern roots, SNP molecular markers were developed, and using the polymorphisms of sites 36, 80, 140, and 222 of the nucleotide sequence, primer pairs were designed for PCR amplification and sequencing to achieve efficient identification of reed roots.
It achieves efficient and accurate identification of reed roots, overcomes the limitations of traditional identification methods, is suitable for non-professional personnel, and has a wide range of applications.
Smart Images
Figure CN120485415A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological detection, and particularly relates to a SNP molecular marker for identifying reed roots and an application thereof. Background Art
[0002] Reed root is a plant of the genus Phragmites in the Poaceae family. P. communis The root of Trin. is sweet and cold in nature, and can treat fever, thirst, stomach heat, vomiting, choking, nausea, etc., and can also detoxify pufferfish poison. A. donax L.) root, cold in nature, can treat fever, fever, bone steaming, hot flashes, gonorrhea, urinary incontinence, and toothache caused by wind and fire. M. sinensis Anderss.) has the function of promoting blood circulation and curing dryness in women. M. lutarioriparius The roots of Phragmites australis L. have no medicinal records. Phragmites australis, Phragmites suspensa, Miscanthus sinensis, and Phragmites australis have similar growth habits and prefer to grow on riverbanks, ponds, swamps, and wetlands. Their similar plant morphologies make it easy to misidentify the plants and confuse the source of the medicinal materials when harvesting Phragmites australis roots (Li Juan, Wang Zhi, Liu Tas, et al. Identification of Phragmites australis and its confounding products [J]. Chinese Journal of Traditional Chinese Medicine, 2017, 42(17): 3320-3325). Phragmites australis roots and Phragmites australis roots are often mistaken for the same species in clinical practice. Therefore, how to distinguish between Phragmites australis roots and Phragmites australis roots has become a research hotspot.
[0003] At present, traditional Chinese medicine identification mainly uses morphology and anatomy to identify the above four materials, which has limitations for non-professionals and is prone to problems such as unclear identification.
[0004] In view of this, it is necessary to develop SNP molecular markers for identifying reed roots, which can accurately and quickly distinguish the above four species and is not limited by the experience of drug harvesters and clinical users. Summary of the Invention
[0005] The present invention aims to provide a SNP molecular marker for identifying reed roots and its application, so as to solve the problem in the prior art that reed roots cannot be effectively distinguished from Phragmites australis roots, Miscanthus sinensis roots and Amur sedge roots.
[0006] In a first aspect, the present invention provides a SNP molecular marker for identifying reed roots, the SNP molecular marker comprising a nucleotide sequence as shown in SEQ ID NO.1, wherein the polymorphism at position 36 of the nucleotide sequence is A or G, the polymorphism at position 80 is A or G, the polymorphism at position 140 is T or G, and the polymorphism at position 222 is G or A.
[0007] In the present invention, the inventors compared and analyzed the genome sequences of reed roots, Phragmites australis roots, Miscanthus sinensis roots and Dioscorea strychnifolia roots to obtain SNP molecular markers that can efficiently distinguish reed roots from Phragmites australis roots, Miscanthus sinensis roots and Dioscorea strychnifolia roots, and further achieved efficient identification of reed roots through the genotypes of different SNP sites in the above-mentioned SNP molecular markers.
[0008] In some embodiments, if the polymorphism at position 36 of the SNP molecular marker is A, the polymorphism at position 80 is A, the polymorphism at position 140 is T, and the polymorphism at position 222 is G, then the plant is reed root.
[0009] In a second aspect, the present invention provides the use of a substance for detecting the above-mentioned SNP molecular marker in the identification of reed roots.
[0010] In some embodiments, the substance comprises a gene chip.
[0011] In a third aspect, the present invention provides a primer pair for detecting the above-mentioned SNP molecular marker, the primer pair comprising a forward primer having a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.6.
[0012] In a fourth aspect, the present invention provides a kit for identifying reed roots, comprising the above primer pair.
[0013] In a fifth aspect, the present invention provides the use of the above-mentioned SNP molecular markers, the above-mentioned primer pairs, and the above-mentioned kit in the identification of reed roots.
[0014] In a sixth aspect, the present invention provides a method for identifying reed roots, comprising the following steps: extracting DNA from a sample to be tested; using the DNA of the sample to be tested as a template, performing a PCR amplification reaction using the above-mentioned primer pairs to obtain an amplified product; sequencing the amplified product to obtain sequence information of the sample to be tested; and determining the genotype of the sample to be tested based on the sequence information of the sample to be tested.
[0015] In some embodiments, the sequencing method comprises Sanger sequencing.
[0016] In some embodiments, determining the genotype of the sample to be tested specifically includes: if the 36th polymorphism of the sample to be tested is A, the 80th polymorphism is A, the 140th polymorphism is T, and the 222nd polymorphism is G, then the sample to be tested is reed root.
[0017] The beneficial effects of the present invention are as follows: different from the prior art, the present invention obtains SNP molecular markers that can efficiently distinguish reed roots from reed roots, reed roots, awn roots and southern reed roots by comparing and analyzing the genome sequences of reed roots, reed roots, awn roots and southern reed roots, and further realizes efficient identification of reed roots through the genotypes of different SNP sites in the above-mentioned SNP molecular markers; the SNP molecular markers have good application prospects in the identification of reed roots. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The agarose gel electrophoresis results of the amplified products of the root samples of Phragmites australis, Phragmites australis, Miscanthus sinensis, and Dioscorea scabra in Example 2 of the present invention are shown. Lane M is DL2000 DNA Maker, and from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lanes 1-6 are Phragmites australis_Wuhan City, Phragmites australis_Jingzhou City, Phragmites australis_Xiantao City, Phragmites australis, Miscanthus sinensis, and Dioscorea scabra samples, respectively. Figure 2 These are the sequencing results of the amplified products of the root samples of Phragmites australis, ... Miscanthus sinensis, and Rhizoma Dioscoreae in Example 2 of the present invention. DETAILED DESCRIPTION
[0019] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0020] Experimental procedures in the examples, where specific conditions are not specified, were generally performed in accordance with conventional methods in molecular biology, including but not limited to those described in M.R. Green's Molecular Cloning: A Laboratory Manual and Robert F. Weaver's Molecular Biology, or according to the recommendations of kit and instrument manufacturers. Unless otherwise specified, reagents and biological materials used in the examples were commercially available.
[0021] At present, the existing technology has the problem that reed roots cannot be effectively distinguished from Phragmites australis roots, Miscanthus sinensis roots, and Achyranthes bidentata roots.
[0022] In order to solve the problem in the prior art that reed roots cannot be efficiently distinguished from Phragmites australis roots, Miscanthus sinensis roots and Rhizoma Dioscoreae roots, the present invention provides a SNP molecular marker for identifying reed roots and its application.
[0023] In a first aspect, the present invention provides a SNP molecular marker for identifying reed roots, the SNP molecular marker comprising a nucleotide sequence as shown in SEQ ID NO.1, wherein the polymorphism at position 36 of the nucleotide sequence is A or G, the polymorphism at position 80 is A or G, the polymorphism at position 140 is T or G, and the polymorphism at position 222 is G or A.
[0024] In the technical solution provided by the present invention, the inventors compared and analyzed the genome sequences of reed roots, Phragmites australis roots, Miscanthus sinensis roots and Dioscorea strychnifolia roots to obtain SNP molecular markers that can efficiently distinguish reed roots from Phragmites australis roots, Miscanthus sinensis roots and Dioscorea strychnifolia roots, and further achieved efficient identification of reed roots through the genotypes of different SNP sites in the above-mentioned SNP molecular markers.
[0025] Furthermore, in some embodiments, the polymorphism at position 36 of the SNP molecular marker is A, the polymorphism at position 80 is A, the polymorphism at position 140 is T, and the polymorphism at position 222 is G, then it is reed root.
[0026] In the present invention, when the polymorphisms of the 36th, 80th, 140th and 222nd positions of the SNP molecular marker are A, A, T and G respectively, it is identified as reed root. The SNP molecular marker has the advantage of high accuracy.
[0027] In a second aspect, the present invention provides the use of a substance for detecting the above-mentioned SNP molecular marker in the identification of reed roots.
[0028] Further, in some embodiments, the substance comprises a gene chip.
[0029] It is understood that the substance can be routinely selected according to actual use needs, as long as it can efficiently detect the above-mentioned SNP molecular markers. In the present invention, the substance preferably includes a gene chip.
[0030] In a third aspect, the present invention provides a primer pair for detecting the above-mentioned SNP molecular marker, the primer pair comprising a forward primer having a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.6.
[0031] It is understood that a primer pair for detecting the above-mentioned SNP molecular marker can be designed based on the sequence and using conventional primer design software, as long as the SNP molecular marker sequence can be amplified. In the present invention, the primer pair preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO. 5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO. 6.
[0032] In a fourth aspect, the present invention provides a kit for identifying reed roots, comprising the above primer pair.
[0033] In a fifth aspect, the present invention provides the use of the above-mentioned SNP molecular markers, the above-mentioned primer pairs, and the above-mentioned kit in the identification of reed roots.
[0034] In a sixth aspect, the present invention provides a method for identifying reed roots, comprising the following steps: extracting DNA from a sample to be tested; using the DNA of the sample to be tested as a template, performing a PCR amplification reaction using the above-mentioned primer pairs to obtain an amplified product; sequencing the amplified product to obtain sequence information of the sample to be tested; and determining the genotype of the sample to be tested based on the sequence information of the sample to be tested.
[0035] The method for identifying reed roots provided by the invention is simple and efficient, uses cheap and easily available raw materials, and is suitable for efficient and rapid identification of reed roots.
[0036] Furthermore, in some embodiments, the sequencing method comprises Sanger sequencing.
[0037] It is understood that the sequencing method can be routinely selected according to actual use needs, as long as the correct sequence can be obtained. In the present invention, the sequencing method preferably includes Sanger sequencing.
[0038] Furthermore, in some embodiments, determining the genotype of the sample to be tested specifically includes: if the 36th polymorphism of the sample to be tested is A, the 80th polymorphism is A, the 140th polymorphism is T, and the 222nd polymorphism is G, then it is reed root.
[0039] In the present invention, when the polymorphisms of the 36th, 80th, 140th and 222nd positions of the SNP molecular marker are A, A, T and G respectively, it is identified as reed root. The SNP molecular marker has the advantage of high accuracy.
[0040] Some specific embodiments are listed below. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.
[0041] Example 1 Screening of SNP Molecular Markers for Identifying Reed Roots By comparing and analyzing the genome sequences of Phragmites australis roots, Phragmites australis roots, Miscanthus sinensis roots, and Dioscorea chinensis roots, the SNP molecular marker sequence was obtained. The SNP molecular marker sequence of Phragmites australis roots is as follows: TTCCACCCATGCAATAGAAAGCGAATGAGAAAAGAAGGGTTATTTTCCCTTAAAAGATAGGCTTTGAAATAGGAATCATAGAATAATGCTGAATTCAAATGTTTATTTCTTTTTTTCTAGTATAAGAAAAATTAATCGAATGAAATTCATGGATTTACCACGACCTCGGTTGTGACCCCATAGATAAAAATGCAAAATTTCTATCTTCGAGACCGTTGAAAAAGGGCATTGAACGAGAAAGA (SEQ ID NO.1); The SNP molecular marker sequence of Phragmites australis root is as follows: TTCCACCCATGCAATAGAAAGCGAATGAGAAAAGAGGGGTTATTTTCCCTTAAAAGATAGGCTTTTAAATAGGAATCATGGAATAATGCGGAATTCAAATGTTTATTTCTTTTATTTCTATAGTATAAGAAAAATGAATCGAATGAAATTCATGCATTTACCATGACCTCGGTTGTGACCCCATAGATAAAAATGCAAAATTTGTATCTTCGAGACCATTGAAAAAGGGCATTGAACGAGAAAGA (SEQ ID NO.2); The SNP molecular marker sequence of Mangosteen is as follows: TTCCACCCATGCAATAGAGAGCGAATGAGAAAAGAGGGGTTTTCCCTTAAAAAATAGGCTTTGAAATAGAAATCATGGAATAATGCTGAATTCAAATGTTTATTTCTTTTATTTCTTTTCTATAGTATAAGAAAAATGAATTAAATGAAATTCGTGGATTTAGCACGACCTTGGTTGTGACCCCATAGATAAAAATGGAAAATTTCTATCTTCGAGACGACTGAAAAAGGGCATTGAACGAGAAAGA (SEQ ID NO.3); The SNP molecular marker sequence of Minami Ogigen is as follows: TTCCACCCATGCAATAGAGAGCGAATGATAAAAGAGGGGTTTTCCCTTAAAAAATAGGCTTTGAAATAGAAATCATGGAATAATGCTGAATTCAAATGTTTATTTCTTTTATTTCTTTTCTATAGTATAAGAAAAATGAATTAAATGAAATTCGTGGATTTAGCACGACCTTGGTTGTGACCCCATAGATAAAAATGGAAAATTTCTATCTTCGAGACGACTGAAAAAGGGCATTGAACGAGAAAGA (SEQ ID NO.4).
[0042] Based on the above SNP molecular marker sequences, SNP sites for efficiently distinguishing reed roots from Phragmites australis roots, Miscanthus sinensis roots, and Rhizoma Dioscoreae roots were obtained. The specific SNP site information is shown in Table 1 below.
[0043] Table 1 SNP site information
[0044] Therefore, efficient identification of reed roots can be achieved based on the genotypes of SNP sites at different positions in the SNP molecular marker sequence.
[0045] Furthermore, with respect to the above-mentioned SNP molecular marker sequence, the present invention provides a primer pair for detecting the above-mentioned SNP molecular marker, the primer pair comprising a forward primer Lw-F and a reverse primer Lw-R, the nucleotide sequences of which are shown below: Lw-F: 5′-TTCCACCCATGCAATA-3′ (SEQ ID NO.5); Lw-R: 5′-TCTTTCTCGTTCAATGCCCT-3′ (SEQ ID NO. 6).
[0046] Example 2 Validation of SNP Molecular Markers for Identifying Phragmites australis Roots Root samples of Phragmites australis, Arundo donax, Miscanthus sinensis, and Miscanthus sinensis were collected from Hubei Province. The samples and collection locations are shown in Table 2. The samples were soaked in liquid nitrogen in the laboratory and then ground into a powder using a Jingxin fully automatic sample rapid grinder (JXFSTPRP-24L). DNA was then extracted using the Tiangen Plant Genomic DNA Extraction Kit.
[0047] Table 2 Experimental samples
[0048] The DNA samples were amplified using a 15-μL PCR amplification system consisting of 7.5 μL of Tiangen Biochemical Technology Co., Ltd. 2× Taq PCR Mix, 0.8 μL of Lw-F, 0.8 μL of Lw-R, 1 μL of DNA (approximately 20 ng), and 4.9 μL of ddH₂O. PCR reactions were performed using an Ependorf Mastercycler X50s PCR instrument with a 94°C initial denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 60°C for 40 s, and extension at 72°C for 1 min, followed by extension at 72°C for 3 min. The reactions were then stored at 4°C.
[0049] After the reaction, 3 μL of amplified product was taken and mixed with 2 μL of 6× DNA loading buffer from Tiangen Biochemical Technology Co., Ltd., and electrophoresed on a 1.5% agarose gel. The results were detected using the Bio-Red gel imaging system (GelDoc go). Figure 1 shown.
[0050] from Figure 1 It can be seen that the corresponding bands can be amplified in the above sample DNA, and the results show that the primer pair has good specificity.
[0051] The PCR products amplified above were sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. Figure 2 shown.
[0052] from Figure 2 It can be seen that, with the amplified sequence of reed root as a reference, the genotypes of reed root at sites 36, 80, 140, and 222 are A, A, T, and G, respectively, while those of Phragmites australis root, Miscanthus sinensis root, and Rhizoma Dioscoreae are G, G, G, and A, respectively. Therefore, the reed roots can be efficiently distinguished based on the genotypes of the above-mentioned different SNP sites.
[0053] Furthermore, to verify the consistency of the amplified fragments of the above primer pairs in reed roots, the amplified fragments were compared with the Nucleotide collection (nr / nt) database of the National Center for Biotechnology Information of the United States by blastn. The results are shown in Table 3 below.
[0054] Table 3 Information of the first 20 sequences in the Blastn comparison results
[0055] As can be seen from Table 3, the amplified sequence is 100% consistent with the published sequence of Phragmites australis, and is different from other plants. The results further show that the above primers have high reliability in identifying Phragmites australis by amplifying sequences.
[0056] In summary, the present invention obtains SNP molecular markers that can efficiently distinguish reed roots from reed roots, reed roots, awn roots and southern reed roots by comparing and analyzing the genome sequences of reed roots, reed roots, awn roots and southern reed roots, and further realizes efficient identification of reed roots through the genotypes of different SNP sites in the above-mentioned SNP molecular markers.
[0057] The above-described embodiments merely illustrate the implementation methods of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make various modifications and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. A SNP molecular marker for identifying reed roots, characterized in that: The SNP molecular marker includes a nucleotide sequence as shown in SEQ ID NO. 1, wherein the polymorphism at position 36 is A or G, the polymorphism at position 80 is A or G, the polymorphism at position 140 is T or G, and the polymorphism at position 222 is G or A.
2. The SNP molecular marker for identifying reed roots according to claim 1, characterized in that If the 36th polymorphism of the SNP molecular marker is A, the 80th polymorphism is A, the 140th polymorphism is T, and the 222nd polymorphism is G, then it is reed root.
3. Use of a substance for detecting the SNP molecular marker according to claim 1 or 2 in identifying reed roots.
4. The use according to claim 3, characterized in that The substance includes a gene chip.
5. A primer pair for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The primer pair includes a forward primer whose nucleotide sequence is shown as SEQ ID NO.5 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.
6.
6. A kit for identifying reed roots, characterized in that: Comprising the primer pair according to claim 5.
7. Use of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 5, and the kit according to claim 6 in identifying reed roots.
8. A method for identifying reed roots, characterized in that: The steps include: Extracting DNA from the sample to be tested; Using the DNA of the sample to be tested as a template, performing a PCR amplification reaction using the primer pair of claim 4 to obtain an amplified product; Sequencing the amplified product to obtain sequence information of the sample to be tested; The genotype of the sample to be tested is determined according to the sequence information of the sample to be tested.
9. The method according to claim 8, characterized in that The sequencing method includes Sanger sequencing.
10. The method according to claim 8, characterized in that Determining the genotype of the sample to be tested specifically includes: if the 36th polymorphism of the sample to be tested is A, the 80th polymorphism is A, the 140th polymorphism is T, and the 222nd polymorphism is G, then the sample to be tested is reed root.