Application of Serpin type serine protease inhibitor SPI-1-siRNA in treatment of two-type echinococcosis

Abstract

The invention discloses an application of a Serpin type serine protease inhibitor SPI-1-siRNA (small interfering Ribonucleic Acid) in treating two types of echinococcosis. The invention belongs to the technical field of biology, and particularly relates to application of a Serpin type serine protease inhibitor SPI-1-siRNA to treatment of two types of echinococcosis. The invention provides siRNA which can be used for preparing products for treating and preventing cystic echinococcosis and alveolar echinococcosis. And preparing a product for treating or / and preventing diseases caused by the infection of the cystic hydatid and the vesicular hydatid, and / or the infection of the cystic hydatid and the vesicular hydatid. The sequence of the siRNA is a double-stranded RNA consisting of two single-stranded RNAs as shown in SEQ ID No. 1 and SEQ ID No. 2 in a sequence table.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of Serpin-type serine protease inhibitor SPI-1-siRNA in treating two types of echinococcosis. Background Art

[0002] Echinococcosis is a serious zoonotic parasitic disease caused by the larvae of the tapeworm Echinococcus parasitizing humans and certain animals. More than 95% of hydatid cases are caused by Echinococcus granulosus ( Echinococcus granulosus , Eg ) caused by cystic echinococcosis (CE). Another serious hazard is caused by Echinococcus multilocularis ( Echinococcus multilocularis , Em Alveolar echinococcosis (AE), caused by infection with Echinococcus larvae, is a fatal parasitic disease worldwide. AE is a serious disease, almost always originating in the liver and often referred to as "worm cancer." Echinococcus can survive in the human body for 53 years and in the small intestine of its final host for 3-5 years, suggesting that Echinococcus has a strong resistance to protease digestion.

[0003] One of the most notable characteristics of Echinococcus is that adult worms develop in the intestines, where pepsin, trypsin, and chymotrypsin are present, and larvae develop in the multi-protein environment of the liver. Serine protease inhibitors (SPIs), inhibitors of serine proteases (SPs), play a key role in regulating various physiological processes in the body. SPIs are classified as serpins based on their substrate specificity. These inhibitors are known to play roles in hemostasis, inflammation, immune regulation, and defense mechanisms. SPIs play a key role in parasite immunity in the following ways: parasites secrete SPIs to inhibit host protease activity, thereby avoiding digestion and suppressing the host immune response, thereby achieving immune evasion. SPIs can also modulate inflammatory responses by inhibiting host protease activity. For example, SPIs from certain parasites can inhibit host kallikrein, reducing the release of inflammatory mediators and thus reducing the host's inflammatory response. Notably, SPIs can also protect the parasite from damage by its own proteases, inhibiting their own proteases and preventing them from degrading the parasite's own tissues.

[0004] Small interfering RNA (siRNA) is a short, double-stranded RNA molecule of 21 to 25 nucleotides in length. It possesses high specificity and gene silencing capabilities, specifically degrading target mRNAs and thereby inhibiting the expression of specific genes. This unique mechanism holds great potential for treating a variety of diseases, including infectious diseases, hematologic malignancies, cardiovascular diseases, and neurodegenerative disorders. However, research on using siRNA to specifically disrupt specific genes and thereby influence the growth and development of insects is currently limited. Summary of the Invention

[0005] The main problem to be solved by the present invention is how to prevent or treat cystic echinococcosis and alveolar echinococcosis.

[0006] In order to solve the above problems, the present invention provides the application of the following substances: 1. Inhibition SPI-1 Application of gene-expressed substances in the preparation of products for preventing cystic echinococcosis and alveolar echinococcosis.

[0007] 2. Inhibition SPI-1 Application of gene-expressed substances in the preparation of products for treating cystic echinococcosis and alveolar echinococcosis infections or / and preventing diseases caused by cystic echinococcosis and alveolar echinococcosis infections.

[0008] 3. Use of substances that inhibit the activity of SPI-1 protein in the preparation of products for preventing cystic echinococcosis and alveolar echinococcosis.

[0009] 4. Use of substances that inhibit the activity of SPI-1 protein in the preparation of products for treating cystic echinococcosis and alveolar echinococcosis infections or / and preventing diseases caused by cystic echinococcosis and alveolar echinococcosis infections.

[0010] 5. Use of substances that reduce the content of SPI-1 protein in the preparation of products for preventing cystic echinococcosis and alveolar echinococcosis.

[0011] 6. Use of a substance that reduces the SPI-1 protein content in the preparation of a product for treating cystic echinococcosis and alveolar echinococcosis infection or / and preventing diseases caused by cystic echinococcosis and alveolar echinococcosis infection.

[0012] In the above applications, the inhibition SPI-1 The substance that promotes gene expression, inhibits SPI-1 protein activity, or reduces SPI-1 protein content may be any of the following biological materials: 1) Double-stranded RNA molecules, modifications thereof, or pharmaceutically acceptable salts thereof; B1) producing a DNA molecule of the double-stranded RNA molecule described in 1); B2) an expression cassette containing the DNA molecule described in B1); B3) a recombinant vector containing the DNA molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the DNA molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) a recombinant microorganism containing the recombinant vector described in B4); B9) a transgenic animal cell line containing the DNA molecule described in B1); B10) a transgenic animal cell line containing the expression cassette described in B2); B11) a transgenic animal cell line containing the recombinant vector described in B3); B12) A transgenic animal cell line containing the recombinant vector described in B4); B13) A transgenic plant cell line containing the DNA molecule described in B1).

[0013] In the above applications, the product may be a drug or a vaccine.

[0014] The medicine provided by the present invention for treating cystic echinococcosis and alveolar echinococcosis infection or / and preventing diseases caused by cystic echinococcosis and alveolar echinococcosis infection contains the double-stranded RNA molecule, its modified product, or its pharmaceutically acceptable salt.

[0015] The product may be an inhibitor, and the inhibitor may be an inhibitor of SPI-1 protein.

[0016] In the above applications, the inhibition SPI-1 The substance that regulates gene expression or inhibits SPI-1 protein activity may be siRNA.

[0017] Furthermore, the sequence of the siRNA may be a double-stranded RNA consisting of two single-stranded RNAs shown as SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing.

[0018] The chemical modification product of the double-stranded RNA molecule is a substance obtained by chemically modifying the double-stranded RNA molecule. The chemical modification may include one or a combination of ribose modification, base modification, and phosphate backbone modification.

[0019] The dosage form of the above inhibitors or drugs can be tablets, capsules, dripping pills, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, buccal tablets, suppositories or lyophilized powder injections.

[0020] In the above applications, the inhibitor or product can be applied to mammals, such as humans.

[0021] In the present invention, the treatment of cystic echinococcosis and alveolar echinococcosis infection is manifested as any of the following: 1) Inhibit the growth and development of Echinococcus granulosus vesicles, or inhibit the growth and development of Echinococcus multilocularis; 2) Inhibit the growth of lesions caused by Echinococcus granulosus or Echinococcus multilocularis; 3) reduce the number and / or size of lesions caused by Echinococcus granulosus or Echinococcus multilocularis; 4) Reduce the pathological changes and inflammatory responses caused by Echinococcus granulosus or Echinococcus multilocularis. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 After siRNA was transfected into protoscoleces, Cy3-labeled siRNA was observed under confocal microscopy 3 hours after electroporation. Localization in the protoscolecus. The upper left image shows Echinococcus granulosus cultured under an optical microscope; the upper right image shows Echinococcus multilocularis cultured under an optical microscope; the lower left image shows Echinococcus granulosus transfected under an inverted fluorescence microscope; and the lower right image shows Echinococcus multilocularis transfected under an inverted fluorescence microscope.

[0023] Figure 2 The effect of siRNA transfection for 3 days on the expression of SPI-1 in Echinococcus granulosus protoscolecus and the activity of Echinococcus granulosus protoscolecus. siRNA transfection for 3 days can reduce SPI-1 mRNA expression, of which siRNA-726 had the best down-regulation effect. UT: untreated group; NC: negative control group.

[0024] Figure 3 siRNA-specific knockdown SPI-1 Protein expression levels after expression. A represents the results of the in vitro transfection model group with Echinococcus granulosus; B represents the results of the in vitro transfection model group with Echinococcus multilocularis. UT: untreated group.

[0025] Figure 4 Figures 2 and 3 show changes in body weight, liver weight, spleen weight, and kidney weight in mice infected with siRNA. A and B represent the EgPSCs-infected mouse model group; C and D represent the EmPSCs-infected mouse model group. UT: untreated group.

[0026] Figure 5 For siRNA infection Eg Pathological changes in mouse liver after PSCs treatment. A shows the pathological histology of mouse liver; B and C show the number and size of cysts. UT: untreated group.

[0027] Figure 6 For siRNA infection Em Pathological changes in mouse liver after PSCs treatment. A shows the pathological histology of mouse liver; B and C show the number and area of lesions. UT: untreated group.

[0028] Figure 7 For siRNA transfection Eg Changes of liver fibrosis in mice after PSCs treatment. UT: untreated group.

[0029] Figure 8 For siRNA transfection Em Changes of liver fibrosis in mice after PSCs treatment. UT: untreated group.

[0030] Figure 9 Figure 2 shows the changes of Treg cells in the liver of mice infected with siRNA. A is the EgPSCs mouse infection model group, B is Em PSCs mouse infection model group. UT: untreated group. DETAILED DESCRIPTION

[0031] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0032] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0033] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0034] The reagents used in flow cytometry detection in the following examples are as follows: APC anti-mouse CD4: Biolegend, catalog number 100412; APC / Cy7 anti-mouse CD3: Biolegend, catalog number 100222; FITC anti-mouse Percp cy5.5 NK1.1: Biolegend, catalog number 108706; Alexa Fluor 647 anti-mouse Foxp3: Biolegend, Cat. No. 126408.

[0035] The livers of the sick sheep in the following examples were obtained from a slaughterhouse and were found to be infected with Echinococcus granulosus ( Echinococcus granulosus, Eg ), and Echinococcus granulosus was isolated.

[0036] The gerbils infected with hydatids in the following examples and the gerbils preserved in this laboratory have been recorded in: Wu, C., et al. Genetic variation of mitochondrial genes among Echinococcus multilocularis isolates collected in western China . Parasit Vectors, 2017. 10(1): p. 265.), among which, gerbils were identified to be infected with Echinococcus multilocularis ( Echinococcus multilocularis,Em ), and Echinococcus multilocularis was isolated.

[0037] The experimental data in the following examples were processed using Excel software, and the data were subjected to variance analysis and multiple comparisons using the one-way analysis of variance program in GraphPad Prism software.

[0038] Example 1 、 Effects of siRNA transfection into PSCs in vitro on gene expression 1. SPI-1 Preparation of gene interfering RNA For Echinococcus granulosus ( Echinococcus granulosus , Eg )of SPI-1 Two siRNAs were designed based on the gene (Genbank number: XM_024492374.1, updated on April 4, 2018). The specific sequences are as follows: SPI-1-438: Sense: 5'-GGUUCUGGCUAAUGCUGUUTT-3', antisense: 5′-AACAGCAUUAGCCAGAACCTT-3′; SPI-1-726: Sense: 5'-GCUGACGUCGGAUCAGUAUTT-3' (SEQ ID No. 1), Antisense: 5′-AUACUGAUCCGACGUCAGCTT-3′ (SEQ ID No. 2).

[0039] A Cy3 fluorescently labeled siRNA (siRNA-Cy3, used as a control) was designed to determine transfection efficiency in Echinococcus protoscoleces (PSCs). A SIR-Ribo™ siRNA, which does not specifically target any human, mouse, rat, or Echinococcus gene, was used as a negative control (NC).

[0040] siRNA-Cy3: Sense: 5′-UUCUCCGAACGUGUCACGUTT-3′; Antisense: 5′-ACGUGACACGUUCGGAGAATT-3′.

[0041] SIR-RiboTM siRNA: Sense: 5'-UUCUCCGAACGUGUCACGUTT-3', Antisense: 5′-ACGUGACACGUUCGGAGAATT-3′.

[0042] 2. siRNA transfection of PSCs Echinococcus granulosus ( Echinococcus granulosus , Eg ) of PSCs (denoted as Eg PSCs) were isolated from the liver of sick sheep at Hualing Slaughterhouse in Urumqi, Xinjiang. Echinococcus multilocularis , Em ) of PSCs (denoted as Em PSCs were obtained from the long-term conserved gerbils in our laboratory.

[0043] PSCs were washed three times with electroporation buffer (150 mM sucrose, 27 mM Na2HPO4, adjusted to pH 7.5), and then 2000 Eg PSCs or EmPSCs and siRNA were added to electroporation buffer, with siRNA-Cy3 serving as a control. The final siRNA concentration was 5 μM. Electroporation was performed using a square wave protocol with a pulse duration of 125 V, 20 ms, and 1 pulse. After transfection, the cells were incubated at 37°C for 10 minutes. 1 mL of culture medium was added, and the transfected PSCs were transferred to a 24-well plate and incubated in a 37°C, 5% CO2 incubator. The siRNA-Cy3-transfected group was cultured for 3 hours and then observed under an inverted fluorescence microscope. The remaining experimental groups were cultured for 3 hours and 3 days after transfection to obtain PSCs from the two worms transfected with each siRNA. Morphological changes in the PSCs were observed under a light microscope. The remaining samples were collected, rinsed three times with PBS, and stored in cryovials at -80°C. Untransfected PSCs served as the control group (UT).

[0044] The results showed that after the three specific siRNAs designed for SPI-1 were transferred into PSCs, the localization of siRNA-Cy3 in PSCs was observed using an inverted fluorescence microscope 3 hours after transfer, and the transfection efficiency was about 70% to 80%. Figure 1 Methylene blue staining of untransfected PSCs revealed a natural mortality rate of approximately 5-10%. Electroporation had no significant effect on PSC survival. Compared with the UT group, the SIR-RiboTM siRNA-transfected NC group, SPI-1-438, and SPI-1-726 groups had no significant effect on PSC survival.

[0045] 3. Real-time quantitative polymerase chain reaction (qRT-PCR) After step 2 is completed, the total RNA of the siRNA-transfected PSCs is extracted and transcribed into cDNA. The cDNA is diluted 1:5 and 2 μL is taken for qRT-PCR to detect SPI-1 The expression level of genes eif3 As an internal reference gene. The primers used are as follows: SPI-1 Gene: Upstream primer F1: 5′- CGTGCCGACTTCTCAGGTAT -3′; Downstream primer R1: 5′- CCCGTCTTGGTAACAATGAA-3′; eif3 Gene: Upstream primer F2: 5′-GTTACATCCCTCCGACCTTG-3′; Downstream primer R2: 5′-AAGCAGCCTCCTCTTGAGTG-3′.

[0046] All qRT-PCR systems were performed with pre-denaturation at 95°C for 30 seconds for 1 cycle; PCR amplification and quantification at 95°C for 5 seconds and 60°C for 30 seconds for 40 cycles; and melting curve analysis at 60-95°C for 5 seconds for 1 cycle. Cycle threshold (Ct) values were normalized to those of eif3 and compared with 2 -△△CT Methods Analysis was performed and each relative value was normalized to that of the untreated PSC sample.

[0047] qRT-PCR results showed that after 3 days of SPI-1-siRNA interference, the expression level of SPI-1 mRNA was significantly reduced. SPI-1-726 knocked down the expression of SPI-1 by 50%, with the best knockdown effect (P<0.001). Figure 2 ).

[0048] Example 2: Detection of the effect of siRNA transfection in PSCs To detect the effect of siRNA transfection on PSCs development and whether it can inhibit its growth ability in mice.

[0049] 1. Determination of target gene protein expression after siRNA transfection into PSCs Total protein from transfected PSCs was extracted using RAPI lysis buffer and protease inhibitors (PMSF). Protein concentration was determined using the BSA method, and Western blotting was used to assess protein expression after specific knockdown of SPI-1. The primary antibody against SPI-1 was used at a concentration of 1:600, and the secondary antibody against goat anti-mouse IgG HRP was used at a concentration of 1:2000. After completion of the reaction, color was developed using 4-chloro-1-naphthol.

[0050] target gene SPI-1 Western blotting analysis after transfection showed that in Echinococcus granulosus, SPI-1-specific transfection of SPI-1-438 (0.67±0.025) and SPI-1-726 (0.52±0.015) could specifically knock down SPI-1 expression, with the SPI-1-726 fragment having the best knockdown efficiency (P<0.001). Figure 3 Middle A).

[0051] In Echinococcus multilocularis SPI-1 Specific transfection of SPI-1-438 (0.67±0.068), SPI-1-726 (0.42±0.050) was able to specifically knock down SPI-1 The SPI-1-726 fragment had the best knockdown efficiency (P<0.001). This indicates that siRNA transfection technology is suitable for knockdown of target genes in Echinococcus cysts ( Figure 3 Middle B).

[0052] 2. SPI-1-726 can effectively reduce the size of Echinococcus granulosus ( E. granulosus ) and Echinococcus multilocularis ( E. mulilocularis ) Infected lesions Twenty-four C57 / 6J mice, 6-8 weeks old (20 ± 2 g), were obtained from a Vital River SPF facility. The mice were randomly divided into three groups, each consisting of eight mice: a PSCs-untreated group (UT group) and SPI-1 siRNA-treated groups (SPI-1-348 group and SPI-1-726 group).

[0053] First, different groups of siRNA were introduced into the Eg PSCs / Em PSCs were transfected with siRNA at a dose of 5 μM per 2000 PSCs. After successful transfection, a mouse model was established by intraportal injection of 2000 PSCs per mouse. The UT group received untreated PSCs, the SPI-1-438 group received SPI-1-438-treated PSCs, and the SPI-1-726 group received SPI-1-726-treated PSCs.

[0054] Mice were dissected and whole blood was collected into EP tubes containing sodium heparin. The tubes were mixed by inversion and then refrigerated at 4°C. A total of 50 μL of whole blood was collected from each mouse for routine blood count analysis in different groups. This routine blood count included red blood cells (RBCs), white blood cells (WBCs), lymphocytes (Lym), monocytes (Mon), neutrophilic granulocytes (Neu), eosinophils (Eos), and basophils (Bas).

[0055] The results of routine blood tests showed that the difference between the two groups was within the normal range and there was no statistical significance ( Figure 4 B and D).

[0056] The body weight and organ weight of mice were measured. The results showed that after siRNA interference with PSCs, the body weight and organ weight of mice in the siRNA specific knockdown group (SPI-1-726) did not change significantly compared with the UT group ( Figure 4 (A and C) The behavior and appearance of mice in each group were normal during the experiment.

[0057] Liver infection lesions were dissected and recorded. Retained tissue was subjected to hematoxylin and eosin staining. Following fixation with 4% paraformaldehyde, dehydration, and embedding, 4 μm tissue sections were prepared. Mouse liver tissue sections were preheated in a 60°C oven for ≥30 min. After deparaffinization with environmentally friendly dewaxing solutions I and II for 15 min each, sections were hydrated in anhydrous ethanol, 95% ethanol, 80% ethanol, and 75% ethanol for 15 s each, and rinsed once with distilled water. Nuclei were stained with hematoxylin for 50 s, followed by three rinses with distilled water until the water was colorless. Sections were placed in saline-ethanol for 2 s, followed by PBS for 5 min to return to blue. Sections were stained with eosin solution for 1-2 min to stain the cytoplasm, followed by three rinses with distilled water until the water was colorless. After 15 s each in 75% ethanol, 80% ethanol, 95% ethanol, and anhydrous ethanol, and 2 min each in environmentally friendly dewaxing solution I / II, the sections were naturally dried and neutral resin was added dropwise. The tissue was covered with a coverslip of corresponding size.

[0058] The in vivo intervention effects of siRNA and the histopathological results are as follows: 1) 3 months after infection, Eg The liver lesions of mice in the PSCs infection (UT) group gradually increased in size. Each infected mouse had a varying number of cysts in the liver lesions, which were filled with cystic fluid and distributed in different liver lobes. The number of cysts in the UT, SPI-1-348, and SPI-1-726 groups was 3.67±1.58, 0.22±0.67, and 0.22±0.53, respectively. The measured long diameters of the cysts were 2.08±0.51, 0.5±0.58, and 0.33±0.82 mm, respectively. Both the number of cysts and the diameter of the cysts in the SPI-1-348 and SPI-1-726 groups were significantly lower than those in the UT group ( Figure 5 AC).

[0059] 2) 3 months after infection, Em The liver lesions in mice infected with PSCs (UT) gradually enlarged and took on a honeycomb-like appearance, ranging in diameter from 1 to 7 mm. Each infected mouse contained multiple lesions distributed across different liver lobes. The number of lesions in the UT, SPI-1-348, and SPI-1-726 groups was 6.7 ± 3.59, 1.28 ± 0.49, and 2.5 ± 1.00, respectively. The surface areas of the lesions were 15.72 ± 14.66 mm, 8.11 ± 4.48 mm, and 4.13 ± 3.40 mm, respectively. 2 , both the number and area of lesions in the SPI-1-438 and SPI-1-726 groups were significantly lower than those in the UT group ( Figure 6 AC).

[0060] The above results show that after treatment with SPI-1-726, Egand Em The lesions were significantly reduced compared with the PSCs infection (UT) group. SPI-1 siRNA of the gene can significantly reduce the occurrence and development of lesions.

[0061] 3. SPI-1-726 can effectively reduce the cystic cysticercus granulosus ( E. granulosus ) and Echinococcus multilocularis ( E. mulilocularis ) Fibrosis of the lesion Mouse liver tissue sections were baked, dewaxed, and dehydrated (using the same procedures as for HE staining). Masson staining was performed. Staining solution A was added dropwise to the tissue, incubated in a humidified chamber for 5 minutes, and then the excess stain was rinsed off with running water. The sections were then differentiated in hydrochloric acid-ethanol for 1 second. After wiping off excess water, staining solution B was added dropwise to the tissue. The sections were incubated in a humidified chamber for 5 minutes, and then the excess stain was rinsed off with running water. Following staining, the sections were dehydrated, transparentized, and mounted (using the same procedures as for HE staining). Images were then collected for analysis.

[0062] Mouse liver tissue sections were baked, dewaxed, and dehydrated (using the same procedures as for HE staining). Then, picrosirius red staining was performed. Iron hematoxylin staining solution was added dropwise to the tissue, incubated in a humidified chamber for 5 minutes, and then excess stain was rinsed off with running water. The sections were then washed with tap water for 5 minutes to return to blue, and then rinsed three times with distilled water for 5-10 seconds each. After adding picrosirius red staining solution, the sections were incubated in a humidified chamber for 5 minutes, and excess stain was rinsed off with running water. After staining, the sections were dehydrated, transparentized, and mounted (using the same procedures as for HE staining). Images were then collected for analysis.

[0063] Specific knockdown of PSCs using siRNA interference technology SPI-1 After siRNA knockdown, analysis of mouse liver tissue using picrosirius red and Masson staining revealed that the area of collagen fibers stained with picrosirius red and Masson staining was significantly reduced, and the degree of fibrosis in the SPI-1-726 group was less than that in the SPI-1-438 group. This suggests that the SPI-1 identified in this study is a key gene required for the growth and development of PSCs, capable of attenuating the degree of fibrosis caused by Echinococcus infection and significantly inhibiting the formation of lesions in vivo ( Figure 7 、 Figure 8 ).

[0064] 4. Detection of lymphocyte surface molecule expression by flow cytometry The liver tissue was placed in a culture dish with a 200-mesh nylon mesh placed in advance. After thorough grinding, it was filtered through a mesh into a 15 mL centrifuge tube. The liver tissue homogenate suspension was centrifuged at 2000 rpm for 5 minutes to collect the cell pellet. The liver cell pellet was centrifuged using a 40% Percoll gradient to remove fat tissue and then added with 1× red blood cell lysis buffer to isolate lymphocytes. 1×106 Mononuclear cell suspension was blocked in PBS buffer (containing 0.2% bovine serum albumin, PBSA) and incubated with anti-CD16 / CD32 at 4°C for 20 min. Antibodies targeting surface markers of Treg cells (CD3, CD4, NK1.1, CD25) were added and incubated at 4°C in the dark for 30 min. After washing with PBSA, Treg cells were perforated with permeabilization buffer and then labeled with Foxp3 antibody for intramembrane labeling. After washing with PBSA, the cells were transferred to flow tubes and analyzed by flow cytometry.

[0065] The results are as follows: After siRNA interference, EgPSCs and Em The Treg cells in PSCs-infected mice increased significantly, especially in the SPI-1-726 group (p<0.05) ( Figure 9 (A and B in Figure 1). This suggests that SPI-1-siRNA can regulate immune balance, inhibit excessive immune responses, and reduce the damage caused by Echinococcus to the host.

[0066] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Inhibition SPI-1 Application of gene-expressed substances in the preparation of products for preventing cystic echinococcosis and alveolar echinococcosis.

2. Inhibition SPI-1 Application of gene-expressed substances in the preparation of products for treating cystic echinococcosis and alveolar echinococcosis infections or / and preventing diseases caused by cystic echinococcosis and alveolar echinococcosis infections.

3. Use of substances that inhibit the activity of SPI-1 protein in the preparation of products for preventing cystic echinococcosis and alveolar echinococcosis.

4. Use of a substance that inhibits the activity of SPI-1 protein in the preparation of a product for treating cystic echinococcosis and alveolar echinococcosis infection or / and preventing diseases caused by cystic echinococcosis and alveolar echinococcosis infection.

5. Use of substances that reduce the content of SPI-1 protein in the preparation of products for preventing cystic echinococcosis and alveolar echinococcosis.

6. Use of a substance that reduces the content of SPI-1 protein in the preparation of a product for treating cystic echinococcosis and alveolar echinococcosis infection or / and preventing diseases caused by cystic echinococcosis and alveolar echinococcosis infection.

7. The use according to any one of claims 1 to 6, characterized in that The inhibition SPI-1 The substance that promotes gene expression, inhibits SPI-1 protein activity, or reduces SPI-1 protein content is any of the following biological materials: 1) Double-stranded RNA molecules, modifications thereof, or pharmaceutically acceptable salts thereof; B1) producing a DNA molecule of the double-stranded RNA molecule described in 1); B2) an expression cassette containing the DNA molecule described in B1); B3) a recombinant vector containing the DNA molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the DNA molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) a recombinant microorganism containing the recombinant vector described in B4); B9) a transgenic animal cell line containing the DNA molecule described in B1); B10) a transgenic animal cell line containing the expression cassette described in B2); B11) a transgenic animal cell line containing the recombinant vector described in B3); B12) A transgenic animal cell line containing the recombinant vector described in B4); B13) A transgenic plant cell line containing the DNA molecule described in B1).

8. The use according to any one of claims 1 to 7, characterized in that The inhibition SPI-1 The substance that regulates gene expression or inhibits SPI-1 protein activity is siRNA.

9. The use according to claim 8, characterized in that The sequence of the siRNA is a double-stranded RNA composed of two single-stranded RNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list.

10. The use according to any one of claims 1, 3 or 5, characterized in that The treatment of cystic echinococcosis and alveolar echinococcosis infection is manifested by any of the following: 1) Inhibit the proliferative cells of Echinococcus granulosus vesicles and prevent the growth and development of vesicles, or inhibit the growth and development of Echinococcus multilocularis; 2) Inhibit the growth of lesions caused by Echinococcus granulosus or Echinococcus multilocularis; 3) reduce the number and / or size of lesions caused by Echinococcus granulosus or Echinococcus multilocularis; 4) Reduce the pathological changes and inflammatory responses caused by Echinococcus granulosus or Echinococcus multilocularis.

Images