Method for constructing bacterial mutant library and application thereof

Abstract

The invention relates to the technical field of biology, and provides a method for constructing a bacterial mutant library and application thereof, and the method comprises the following steps: (1) based on a mutation site of a target protein, carrying out splitting treatment on coding nucleic acid of the target protein, and constructing a saturated mutation site fragment for coding the target protein; (2) constructing a first vector which contains an expression signal marker and an SUMO-FutC enzyme fragment and does not contain an IIS type restriction enzyme digestion site; (3) connecting the saturated mutation site fragment with a first vector to obtain a saturated mutation vector library; and (4) transferring the vectors in the saturated mutation vector library into bacteria to obtain the bacterial mutant library. The bacterial mutant library can be combined with a microfluidic technology to screen key functional sites and corresponding strains of a target protein, for example, a target strain with high yield of 2 '-fucosyllactose can be efficiently obtained, the yield of the target strain is 4.7-7.6 times that of a wild strain, meanwhile, the time, instrument and reagent cost is saved, and the operation requirement is low.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, the present invention relates to a method for constructing a bacterial mutant library and an application thereof. Background Art

[0002] With the rapid development of biotechnology, the application of enzymes and cell factories in many industries, such as food, chemical industry, environment, and energy, is increasing, injecting new impetus into the sustainable development of industry and energy. However, the performance of enzymes and cells in their natural state often cannot meet complex industrial needs. Therefore, targeted modification is needed to improve their activity, stereoselectivity, stability, substrate specificity, and the production efficiency of cell factories. Targeted modification is a laboratory technique that simulates natural evolution. For a specific enzyme protein, a DNA library with mutations at specific base sites is constructed through mismatch PCR, artificial synthesis, etc. to express proteins with amino acid changes at specific sites, and experiments are designed to screen for positive strains. Currently, a variety of methods for constructing mutant libraries have been developed and widely used, but sensitive and reliable ultra-high-throughput screening methods remain the main bottleneck for achieving efficient evolution of enzymes and cell factories. Currently, traditional screening methods for mutant libraries: agar plate screening and microplate screening are the two most widely used screening techniques.

[0003] The agar plate method is a common and widely used method for screening mutant libraries. It is simple to use and suitable for large-scale initial screening. The agar plate method can be divided into phenotypic activity screening and phenotypic growth selection. Phenotypic activity screening uses the hydrolysis zone, color zone, or fluorescent product produced around the colony to screen for enzyme activity or target product. Phenotypic growth selection, on the other hand, screens cells based on their growth in a selective medium, based on their resistance to antibiotics or other harmful substances or complementation of nutrient deficiencies.

[0004] Microplate screening quantitatively analyzes substrates or target products by measuring changes in absorbance or fluorescence caused by the substrate or target product in a microplate. First, a large number of mutations are artificially introduced through various methods to construct a mutant library of the target protein gene or whole-cell genome. Then, suitable screening methods are used to rapidly identify mutants that meet the requirements from this library. Finally, the mutants are recovered and identified, and the dominant mutants are selected as the starting point for the next round of evolution. This iterative cycle rapidly improves enzyme performance or cell factory production efficiency.

[0005] Currently, these two methods for screening positive strains in mutant libraries require manual selection of positive clones and have low throughput. Therefore, further development of methods that can meet the requirements of large-scale high-throughput screening is still needed. Summary of the Invention

[0006] The present invention aims to solve one of the technical problems in the related art at least to a certain extent.

[0007] In a first aspect, the present invention provides a method for constructing a bacterial mutant library. According to an embodiment of the present invention, the method comprises: (1) splitting the encoding nucleic acid based on the mutation site of the target protein to construct a saturated mutation site fragment encoding the target protein; (2) constructing a first vector comprising an expression signal marker, a SUMO-FutC enzyme fragment, and no type IIS restriction enzyme cleavage site; (3) connecting the saturated mutation site fragment with the first vector to obtain a saturated mutation vector library; (4) transferring the vectors in the saturated mutation vector library into the bacteria to obtain the bacterial mutant library, wherein the target protein comprises a fucosyltransferase.

[0008] According to an embodiment of the present invention, the above method for constructing a bacterial mutant library may further include at least one of the following additional technical features: According to an embodiment of the present invention, the fucosyltransferase has an amino acid sequence shown in SEQ ID NO: 1 or 2.

[0009] According to an embodiment of the present invention, the mutation site is an effective functional site obtained after preliminary detection. The effective functional site refers to a site in a region of a protein responsible for a specific biological function. Exemplarily, the site includes the active site of a protein, i.e., a site in a protein functional domain, or other protein or small molecule binding site.

[0010] According to an embodiment of the present invention, the number of mutation sites is 2 to 10.

[0011] According to an embodiment of the present invention, the mutation sites include at least one of positions 150, 176, 177, 188, 215, 218, 274, 275 and 276.

[0012] According to an embodiment of the present invention, the mutation site is at least one of positions 150 and 188 of the amino acid sequence shown in SEQ ID NO: 1, and / or the mutation site of the fucosyltransferase is at least one of positions 176, 177, 215, 218, 274, 275 and 276 of the amino acid sequence shown in SEQ ID NO: 2.

[0013] According to an embodiment of the present invention, after the splitting process, the length of the nucleic acid fragment encoding the target protein is less than 1500 bp.

[0014] According to a preferred embodiment of the present invention, the length of the nucleic acid fragment encoding the target protein after the splitting process is 100-1500 bp, preferably 100-600 bp, preferably 120-500 bp, and more preferably 300-500 bp.

[0015] Those skilled in the art will appreciate that the present invention splits the DNA sequence encoding the target protein, and after splitting, each fragment is less than 1500 bp, which is convenient for DNA synthesis and PCR reaction. The present invention finds that the synthesis difficulty and cost of this length are relatively low, and the PCR reaction is fast and the error rate is low. According to an embodiment of the present invention, the mutation sites are close to each other, and in the same part, the cost of DNA synthesis is low. When the mutation sites are distributed far apart, the cost of DNA synthesis is high. Therefore, the mutation sites are introduced by means of synthetic DNA primers. At this time, the window that can be covered on each primer is 20~100 bp, so as to simultaneously include one or several mutations in the region. Therefore, the splitting process is based on the following method: (1) Overall principles of splitting: Place the mutation sites on both sides of the split fragment so that the split sites can be covered by primer synthesis; the split fragment should not be too large, preferably less than 1500 bp, so that the split DNA fragments can be easily obtained by PCR reaction; several mutation sites that are closely spaced, such as within 100 bp, can be covered by the same primer and regarded as a group of mutation sites; design primers at the 5' and 3' ends of the split fragment to introduce mutations and BsaI sites for fragment connection.

[0016] (2) When the total length of the fragment is less than 1500 bp, the mutation site is used as the splitting point, and the mutation site region is covered with primers, as shown in Example 2.

[0017] (3) If the distance between two or two groups of adjacent mutation sites is greater than 100 bp and less than 1500 bp, the sequence between them can be regarded as a split part (including primer sequence) and obtained by one PCR reaction; the forward and reverse primers are used to cover the two or two groups of mutation sites respectively.

[0018] (4) When the distance between two or two groups of adjacent mutation sites is greater than 1500 bp, the sequences between them can be considered as multiple split parts (including primer sequences), each part is 1000-1500 bp, and the length of each part is relatively uniform. Primers are designed based on the first and last sequences of each part, and the two or two groups of mutation sites are located in the forward primer coverage area of the first part of the region and the reverse primer coverage area of the last part of the region, respectively.

[0019] (5) When there are many mutation sites (greater than 5) and they are concentrated (within 500 bp), directly splitting each fragment will result in a small size, which will affect the efficiency of post-PCR purification and recovery. Therefore, in this case, the region where the mutation sites are concentrated is split into separate parts, and DNA fragments containing the mutation sites are synthesized from commercial companies (such as Qingke Bio and GenScript Bio). See Example 3.

[0020] According to an embodiment of the present invention, after the splitting process, the mutation sites of the target protein are located at both ends of the target protein encoding nucleic acid fragment.

[0021] According to an embodiment of the present invention, when the distance between two or two groups of mutation sites of the target protein is greater than 1500 bp, the sequence between the two or two groups of mutation sites is split into two or more nucleic acid fragments of similar length and less than 1500 bp, and / or When the distance between two or two groups of mutation sites of the target protein is no more than 1500 bp, the sequence between the two or two groups of mutation sites is set as a nucleic acid fragment, or split into two or more nucleic acid fragments of similar length.

[0022] According to an embodiment of the present invention, when any distance between multiple or multiple groups of mutation sites of the target protein is no more than 500 bp, a continuous sequence containing all the mutation sites is taken as a nucleic acid fragment and a saturated mutation site fragment is constructed by commercial synthesis.

[0023] According to an embodiment of the present invention, after the splitting process, the length of the nucleic acid fragment encoding the target protein is less than 1500 bp.

[0024] According to an embodiment of the present invention, when constructing the saturation mutation site fragment encoding the target protein, a BsaI site is introduced at the end of the nucleic acid fragment after the splitting process.

[0025] According to a preferred embodiment of the present invention, a BsaI site is introduced at the 5' end of the nucleic acid fragments after the splitting process.

[0026] According to an embodiment of the present invention, the connection in step (3) includes connection through the BsaI site.

[0027] According to an embodiment of the present invention, the connection in step (3) is performed through a golden-gate method.

[0028] Each of these fragments can be amplified by PCR (see Tables 2 and 3 for reaction systems and procedures, respectively), resulting in products less than 1500 bp in length. The PCR products are then linked via the introduced BsaI site using a golden-gate reaction (see Tables 7 and 8 for reaction systems and procedures), enabling simultaneous assembly of the DNA sequence corresponding to the target protein and simultaneous integration into the vector, yielding a target protein plasmid suitable for expression and screening.

[0029] The primers can be synthesized by Qingke Bio or other primer companies. Mutant protein sites can be synthesized using the NNK method (N represents A, T, G, and C, and K represents G and C) to represent 32 codons encoding 20 amino acids, ensuring coverage at the mutation site. Alternatively, a completely random method can be used, where each base is randomly assigned to one of A, T, C, and G, to traverse the same amino acid but with different codons. This method may introduce stop codons. In the examples of this patent, the second, completely random method is used for primer and DNA synthesis.

[0030] To ensure the efficiency of fragment connection, the number of the split fragments should be 7 or less. That is, this method has a good effect on the construction of mutation libraries of target proteins with DNA sequence lengths less than 10,000 bp.

[0031] According to an embodiment of the present invention, the signal marker includes at least one of a fluorescent marker and a resistance marker.

[0032] According to an embodiment of the present invention, the signal marker includes green fluorescent protein.

[0033] According to an embodiment of the present invention, the bacteria include Escherichia coli.

[0034] According to an embodiment of the present invention, the first vector is selected from one of the following: pETDuet, pICH41308 and pGGAselect.

[0035] According to an embodiment of the present invention, in the ligation reaction system, the mass ratio of the saturation mutation fragment to the first vector is 1:1 to 4:1.

[0036] In a second aspect of the present invention, the present invention provides a bacterial mutant library. According to an embodiment of the present invention, the bacterial mutant library is obtained by the method for constructing a bacterial mutant library described in the first aspect.

[0037] In a third aspect, the present invention provides a method for high-throughput screening of high-yielding 2'-fucosyllactose strains. According to an embodiment of the present invention, the method comprises: (1) encapsulating strains in a mutant library to form droplets, and subjecting the droplets to a first culture; and (2) subjecting the droplets after the first culture to microfluidic screening to obtain target strains; wherein the mutant library carries a saturated mutant fragment of a fucosyltransferase.

[0038] 2'-fucosyllactose (2'-FL) is the most abundant oligosaccharide in human milk. α-1,2-Fucosyltransferase is a key enzyme in its synthesis. Improving the activity of α-1,2-Fucosyltransferase can effectively increase 2'-FU production. This experiment targeted α-1,2-FU as the target protein. A mutant library was generated and screened to identify a strain with enhanced enzyme catalytic efficiency. This strain simultaneously produces high levels of 2'-FU in the presence of GDP-Fuc and D-lactose. Therefore, by measuring the 2'-FU content, strains with both enhanced enzyme catalytic efficiency and high 2'-FU production can be identified.

[0039] According to an embodiment of the present invention, the method for high-throughput screening of high-yielding 2'-fucosyllactose strains may further include at least one of the following additional technical features: According to an embodiment of the present invention, before encapsulation and droplet formation, the strains in the mutant library are pre-screened for resistance. This method involves first applying heat-shock or electroporation products to plates containing the corresponding resistance and growing them overnight for a round of screening. Green fluorescent single colonies are then scraped from the corresponding resistance plates and used to prepare microfluidic injection samples, isolate, and collect the colonies. This procedure further improves the success rate of screening and sorting, achieving a 100% positive rate.

[0040] According to an embodiment of the present invention, the droplet contains at least one of the following culture media: LB liquid culture medium, 2216E, Gao's No. 1, and potato culture medium.

[0041] According to an embodiment of the present invention, the first culture is performed at a temperature of 35° C. to 38° C. for 10 to 15 hours, preferably 12 hours.

[0042] According to an embodiment of the present invention, the microfluidic screening obtains the target strain by screening signals, and the screening signals include at least one selected from the following: fluorescence, absorbance, mass spectrometry, turbidity, chemiluminescence and Raman spectroscopy.

[0043] According to an embodiment of the present invention, before performing the microfluidic screening, a screening threshold is preset, and droplets whose screening signals reach the screening threshold are collected.

[0044] According to an embodiment of the present invention, the threshold value includes at least one of the following: a fluorescence intensity of 1300-2000 a.u., and an OD value not less than 3.5.

[0045] According to an embodiment of the present invention, the strain encapsulated in the collected droplets is subjected to a first fermentation culture, 2'-fucosyllactose in the culture broth of the first fermentation culture is separated and extracted, and the content of 2'-fucosyllactose is detected.

[0046] According to an embodiment of the present invention, the first fermentation culture is carried out at a temperature of 35° C. to 38° C. for 10 to 24 hours.

[0047] In a fourth aspect of the present invention, a high-yield 2'-fucosyllactose strain is provided. According to an embodiment of the present invention, the strain is obtained by screening using the method described in the third aspect.

[0048] In the fifth aspect of the present invention, the present invention proposes the use of the strain obtained by screening using the method described in the third aspect or the strain described in the fourth aspect in the production of 2'-fucosyllactose.

[0049] In a sixth aspect, the present invention provides a method for producing 2'-fucosyllactose. According to an embodiment of the present invention, the method comprises: (1) subjecting the strain obtained by screening using the method described in the third aspect or the strain described in the fourth aspect to a second fermentation culture; and (2) isolating and extracting 2'-fucosyllactose from the second fermentation culture.

[0050] In the seventh aspect of the present invention, the present invention proposes the use of the strain described in the fourth aspect in the preparation of food, beverages, health products, cosmetics, feed or additives that help to resist oxidation and / or help to regulate intestinal flora.

[0051] In the eighth aspect of the present invention, the present invention proposes the use of the strain described in the fourth aspect in the preparation of drugs for inhibiting pathogens and / or anti-inflammatory drugs.

[0052] Compared with the prior art, the technical solution of the present invention has at least the following beneficial effects: (1) The present invention simultaneously constructs a mutation library for multiple mutation sites (for example, 2 or 7) by cloning and using BsaI sites and Golden-gate connections. The vector used carries a sumo-tag label (to improve the solubility of the enzyme and increase the expression success rate), has a highly fluorescent GFP label (to facilitate the screening of positive clones), and deletes redundant BsaI sites (to directly construct multiple mutation sites). The mutation library construction vector and technical solution used have the ability to quickly construct multiple mutation sites and facilitate positive clone screening.

[0053] (2) The positive clone screening method of the present invention replaces the manual selection of single clones, which can save a lot of labor costs, time costs and reagent costs. Since the droplet system is at the microliter level, compared with the traditional manual method at the milliliter level, a lot of reagent costs are saved. According to calculations, the screening cost of a single bacterium at the microliter level is reduced by 10 times or more compared with the screening cost at the milliliter level, making it easier to build the screening technology platform.

[0054] (3) The equipment of the present invention has a high degree of automation. It only needs to dilute the mutant library samples before it can be put on the machine for automated screening. It is more operable, reduces errors in the human operation process, avoids repetitive experiments, and does not require high professional microbial operation skills. During the screening process, there is no need to consider factors such as color, well bottom, function, and material. When using microfluidic screening to collect positive droplets, it is only necessary to place the collection well plate in place in advance. The microfluidic device will automatically identify the position of the collection well plate and move the well plate to a specific position through a robotic arm to collect droplets. After the collection is completed, subsequent operations can be carried out.

[0055] (4) The 2-fucosyllactose production of the target strain obtained by screening using the method of the present invention is 4.7 to 7.6 times that of the wild-type strain, and the production is significantly improved.

[0056] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which: Figure 1 Shown is a map of the recombinant vector pETDuet-FutC26695-mgfp of an embodiment of the present invention; Figure 2 The figure shows the detection result of the effect of the mutation of FutC26695 on the 2'-FL yield in the embodiment of the present invention; Figure 3The diagram shows the recombinant vector pETDuet-FucT6002-mgfp according to an embodiment of the present invention. DETAILED DESCRIPTION

[0058] The following describes embodiments of the present invention in detail, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, and are not to be construed as limiting the present invention.

[0059] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0060] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0061] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0062] Unless otherwise specified, the terms or expressions used in this document have the following meanings.

[0063] As used herein, the term "recombinant microorganism" refers to a microorganism that has been genetically modified or engineered to alter the sequence or expression of an endogenous nucleic acid, or to express an exogenous nucleic acid (which may be contained in a vector or integrated into the genome of the microorganism). "Altered" refers to upregulation or downregulation of gene expression, or the level of RNA molecules or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or the activity of one or more polypeptides or polypeptide subunits, such that the expression, level, or activity is greater or less than that observed in the absence of the alteration.

[0064] As used herein, the term "exogenous" refers to a substance that is not originally present in the starting strain, or a substance that differs from the corresponding substance in the starting strain, such as a nucleic acid that is not present in the starting strain, or a nucleic acid that contains a mutation compared to the corresponding gene sequence in the starting strain. According to embodiments of the present invention, "exogenous nucleic acid" includes nucleic acid derived from the same species as the starting strain, as well as heterologous nucleic acid (i.e., nucleic acid derived from a different species than the starting strain).

[0065] As used herein, the term "nucleic acid" is used interchangeably with the term "polynucleotide" and refers to an organic polymer composed of two or more monomers (including nucleotides, nucleosides, or their analogs), including but not limited to single-stranded or double-stranded, sense or antisense deoxyribonucleic acid (DNA) of any length, and sense or antisense ribonucleic acid (RNA), including siRNA. The term "nucleotide" refers to any of a variety of compounds composed of ribose or deoxyribose sugars bound to a purine or pyrimidine base and to a phosphate group, and are the basic structural units of nucleic acids. The term "nucleoside" refers to a compound composed of a purine or pyrimidine base combined with deoxyribose or ribose sugars (such as guanosine or adenosine), and is present in nucleic acids.

[0066] It should be understood that the meaning of "nucleic acid" described herein includes "gene", and the nucleic acid described herein also includes "vector" or "plasmid".

[0067] The term "gene" as used herein refers to a polynucleotide encoding a specific amino acid sequence, which contains all or part of one or more proteins or enzymes, and may include regulatory (non-transcribed) DNA sequences, such as promoter sequences, which determine, for example, under what conditions the gene is expressed. The transcribed region of a gene may include an untranslated region (including introns, 5'-untranslated region (UTR) and 3'UTR) and a coding sequence.

[0068] As used herein, the term "expression" refers to the transcription and / or translation of a coding gene segment or gene. Typically, the resulting product is mRNA or protein. However, expression products may also include functional RNA, such as antisense nucleic acids, tRNA, snRNA, rRNA, RNAi, siRNA, ribozymes, and the like. Expression may be global, local, or transient, for example, confined to a specific cell type, tissue, organ, or time period.

[0069] The term "saturation mutagenesis" as used in this article refers to the systematic replacement of specific amino acid residues in a gene sequence by introducing all possible amino acid substitutions at a specific amino acid site, so that it can encode all possible amino acids (usually 19 non-wild-type amino acids), thereby studying the effect of this site on protein function.

[0070] The term "insertion into the corresponding site" used in this article refers to the additional introduction of other exogenous nucleic acids at the site of the original gene, so that the exogenous nucleic acid can be integrated into the genome of the microorganism and thus exert its function.

[0071] As used herein, the term "golden gate" refers to a molecular cloning technique based on type IIS restriction enzymes and T4 ligase, used to efficiently assemble multiple DNA fragments. A "Golden Gate vector" is a specially designed vector used in Golden Gate cloning. This technique leverages the properties of type IIS restriction enzymes (such as BsaI) to efficiently assemble multiple DNA fragments in the same reaction. The Golden Gate vector's design enables seamless ligation with target DNA fragments at specific restriction sites, enabling efficient cloning.

[0072] For ease of understanding, the present invention is summarized here. The mutant library construction method mainly includes the following steps: Split the target protein sequence. If there are multiple mutation sites (greater than 5) concentrated in a specific region (within 500 bp), directly synthesize the target protein sequence and then perform golden-gate ligation with other regions (obtained by PCR) that do not contain mutation sites. This generates a mutation library, as described in Example 3.

[0073] For cases where most mutation sites are not particularly concentrated, a specific splitting strategy is employed, using primers to cover the mutation sites instead of full DNA synthesis. This strategy offers a short synthesis cycle (24 hours vs. 30 working days) and low costs (primer synthesis costs 0.6 yuan / bp for sequences 20-100 bp; for DNA sequences greater than 1500 bp, the cost per base is 0.8-1 yuan / bp. Synthesis of the mutation library is difficult, and the price increases with length and difficulty). Furthermore, by leveraging the seamless cloning and rapid assembly capabilities of Golden-Gate, efficient, rapid, and low-cost mutation library construction is achieved, as shown in Example 2.

[0074] Those skilled in the art will appreciate that the present invention splits the DNA sequence encoding the target protein, and after splitting, each fragment is less than 1500 bp, which is convenient for DNA synthesis and PCR reaction. The present invention finds that the synthesis difficulty and cost of this length are relatively low, and the PCR reaction is fast and the error rate is low. According to an embodiment of the present invention, the mutation sites are close to each other, and in the same part, the cost of DNA synthesis is low. When the mutation sites are distributed far apart, the cost of DNA synthesis is high. Therefore, the mutation sites are introduced by means of synthetic DNA primers. At this time, the window that can be covered on each primer is 20~100 bp, so as to simultaneously include one or several mutations in the region. Therefore, the splitting process is based on the following method: (1) Overall principles of splitting: Place the mutation sites on both sides of the split fragment so that the split sites can be covered by primer synthesis; the split fragment should not be too large, preferably less than 1500 bp, so that the split DNA fragments can be easily obtained by PCR reaction; several mutation sites that are closely spaced, such as within 100 bp, can be covered by the same primer and regarded as a group of mutation sites; design primers at the 5' and 3' ends of the split fragment to introduce mutations and BsaI sites for fragment connection.

[0075] (2) When the total length of the fragment is less than 1500 bp, the mutation site is used as the splitting point, and the mutation site region is covered with primers, as shown in Example 2.

[0076] (3) If the distance between two or two groups of adjacent mutation sites is greater than 100 bp and less than 1500 bp, the sequence between them can be regarded as a split part (including primer sequence) and obtained by one PCR reaction; the forward and reverse primers are used to cover the two or two groups of mutation sites respectively.

[0077] (4) When the distance between two or two groups of adjacent mutation sites is greater than 1500 bp, the sequences between them can be considered as multiple split parts (including primer sequences), each part is 1000-1500 bp, and the length of each part is relatively uniform. Primers are designed based on the first and last sequences of each part, and the two or two groups of mutation sites are located in the forward primer coverage area of the first part of the region and the reverse primer coverage area of the last part of the region, respectively.

[0078] (5) When there are many mutation sites (greater than 5) and they are concentrated (within 500 bp), directly splitting each fragment will result in a small size, which will affect the efficiency of post-PCR purification and recovery. Therefore, in this case, the region where the mutation sites are concentrated is split into separate parts, and DNA fragments containing the mutation sites are synthesized from commercial companies (such as Qingke Bio and GenScript Bio). See Example 3.

[0079] Each of these fragments can be amplified by PCR (see Tables 2 and 3 for reaction systems and procedures, respectively), resulting in products less than 1500 bp in length. The PCR products are then linked via the introduced BsaI site using a golden-gate reaction (see Tables 7 and 8 for reaction systems and procedures), enabling simultaneous assembly of the DNA sequence corresponding to the target protein and simultaneous integration into the vector, yielding a target protein plasmid suitable for expression and screening.

[0080] The primers can be synthesized by Qingke Bio or other primer companies. Mutant protein sites can be synthesized using the NNK method (N represents A, T, G, and C, and K represents G and C) to represent 32 codons encoding 20 amino acids, ensuring coverage at the mutation site. Alternatively, a completely random method can be used, where each base is randomly assigned to one of A, T, C, and G, to traverse the same amino acid but with different codons. This method may introduce stop codons. In the examples of this patent, the second, completely random method is used for primer and DNA synthesis.

[0081] To ensure the efficiency of fragment connection, the number of the split fragments should be 7 or less. That is, this method has a good effect on the construction of mutation libraries of target proteins with DNA sequence lengths less than 10,000 bp.

[0082] The nucleic acid and amino acid sequences used in the present invention are shown in Table 1: Table 1:

[0083] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention.

[0084] Example 1 Selection of enzymes and mutation sites and preparation of vectors and strains 1.1 Selection of enzymes and mutation sites In this patent, fucosyltransferases were selected for mutation. Sequence information for two enzymes, FutC26695 (Table 1, SEQ ID NO: 3, 909 bp) and FucT6002 (Table 2, SEQ ID NO: 4, 1191 bp), was obtained from BLAST (Basic Local Alignment Search Tool). Mutations were performed at two sites (amino acids 150 and 188) and seven sites (amino acids 176, 177, 215, 218, and 274–276), respectively, in Examples 2 and 3.

[0085] 1.2 Construction of fluorescent vector for screening To screen for plasmid-transfected strains using microfluidics, the expression vector for fucosyltransferase must contain a fluorescent protein gene. We purchased the green fluorescent protein vector pBS-IdhGFP from Miaoling Biotechnology and transformed it into a DH5a competent strain (Biyuntian D1031S) (heat shock at 42°C for 45 seconds). Positive clones were selected and cultured. Green fluorescence was visible to the naked eye under visible light, meeting the required fluorescence intensity for screening.

[0086] Examination of the pBS-IdhGFP sequence revealed a BsaI site within its GFP-specific sequence, which could affect subsequent mutant library construction. Therefore, this patent designed primers that cover this site for mutations. The BsaI site was removed from the primers, and circular PCR was then performed to obtain the pBS-IdhGFP vector with the BsaI site removed. The circular p primers, reaction system, and PCR protocol used are shown in Table 2: Table 2:

[0087] The PCR program (using PrimeSTAR enzyme as an example, for other enzymes, please refer to the enzyme instructions for temperature and time) is shown in Table 3: Table 3

[0088] After the above operation, the fluorescence intensity of the obtained pBS-IdhGFP vector with the BsaI site removed was weakened to a certain extent, but still visible to the naked eye and could be used for fluorescence screening.

[0089] Using pBS-IdhGFP with the BsaI site removed as a template, PCR was performed to obtain the GFP gene sequence with the BsaI site removed, which was then inserted into pETDuet-FutC26695 to obtain the pETDuet-FutC26695-mgfp plasmid vector (Table 1, SEQ ID NO: 6), which was used as the basic vector for mutant library construction and fluorescence screening in Examples 2 and 3. The specific experimental method is as follows: the upstream primer GCGctcgagtaatttcacacaggaaacagctatgac (SEQ ID NO: 23) and the downstream primer agcctaggttaattatttgtatagttcatccatgccatgtg (SEQ ID NO: 24) of the GFP gene were used. The primers and the PCR system and procedure in the same table as above were used to obtain DNA fragments, which were then recovered using the Tiangen gel recovery kit (Cat. No. DP209). The fragments and vectors were digested with restriction endonucleases XhoI (R0146S) and AvrII (R0174S) from NEB, and the ligation system used was the T4 ligase system (NEB, M0202S).

[0090] 1.3 Pre-expression of other genes for 2FL synthesis in competent cells Fucosyltransferase is the enzyme used in the final step of 2FL synthesis. To complete the synthesis process, the other genes required for the pathway, manB, manC, gmd, and wcaG, must be transferred into the chassis microorganism. Using the BL21(DE3) competent strain (Biyuntian, Catalog No. D0337), the pRSFDuet-1-manC-manB-gmd-wcaG vector (Qingke Biosynthesis, sequence shown in Table 1, SEQ ID NO: 7) was introduced. The resulting positive strain served as the chassis strain for Examples 2 and 3.

[0091] Example 2 Construction, sorting, sequencing and enzyme product detection of the 2-site mutation library of FutC26695 enzyme 2.1 Obtaining fragments covering two mutation sites The DNA sequence corresponding to the FutC26695 enzyme obtained in Example 1 was split into three segments: 1–474 bp, 470–584 bp, and 580–909 bp. The mutation sites at amino acids 150 (450 bp) and 188 (564 bp) were located at the end primers of the first two segments (primers R1 and R2 below). The three bases at the mutation sites were randomized and designated NNN. Based on the segment splitting and mutation design, the primer sequences used were as follows: F1: ggctacggtctccATGGCGTTTAAAGTTGTT (SEQ ID NO: 10); R1: ggctacggtctccCGCCAGGATCAGTGACAGTTTGCGNNNATATTCTTC (SEQ ID NO: 11); F2: ggctacggtctccGGCGGCGAAAAATTCAGTTTTTGT (SEQ ID NO: 12); R2: ggctacggtctcACGCGTTTCGCCATATATTCNNNCGCTTTTTTCTGA (SEQ ID NO: 13); F3: ggctacggtctcGCGTTCCGAATATGGAACTGTTTGT (SEQ ID NO: 14); R4: ggctacggtctcattactcgagCGCATTATATTTCTGTG (SEQ ID NO: 15).

[0092] The three split fragments of FutC26695 mentioned above were amplified. During amplification, a BsaI site was introduced into the primers. The cleavage position of this site is outside the recognition region. This can create sticky ends while cutting off the redundant region of the introduced enzyme cleavage site. This allows the two parts of the PCR to be reconnected to form a complete enzyme without redundant sequences. Similarly, this method can be extended to other protein mutations and used to introduce mutation sites after splitting the sequence. Generally, the number of mutation sites can be used to determine how many segments the sequence should be split into and then connected. The following structure can be used for the F-end primer and R-end primer: "5' end (connection sequence) containing the BsaI site + complementary sequence", where the connection sequence is as follows: ggctacggtctcc (SEQ ID NO: 16).

[0093] 2.2 Amplification of plasmid backbone and fragment ligation The three fragments of FutC26695 were amplified separately (with BsaI restriction sites added at both ends), resulting in fragments named FutC26695-P1, FutC26695-P2, and FutC26695-P3. Using the aforementioned plasmid pETDuet-FutC26695-mgfp as a template, the fragment excluding FutC26695 was amplified, similarly with BsaI restriction sites added at both ends, to obtain the vector fragment. The four fragments were recovered and purified from the gel. BsaI and T4 ligase were added to the same reaction system, along with the four purified fragments, and the volume was filled to 20 μL with sterile double-distilled water. The reaction system and procedure are shown in Tables 4 and 5.

[0094] Table 4

[0095] Table 5

[0096] 2.3 Conversion 1) Adjust the temperature of the constant temperature water bath to 42℃ in advance.

[0097] 2) Remove a tube (100 μl) of competent E. coli (Biyuntian, D0337) from the -80°C freezer. Immediately melt the tube with your fingers, then place it on ice and incubate for 5-10 minutes.

[0098] 3) Add 20 μl of the mixture of the vector and the two enzyme fragments obtained in Experiment 2.2, shake gently, and place on ice for 20 minutes.

[0099] 4) After gently shaking, place the tube in a 42°C water bath for 1-2 minutes for heat shock, then quickly return it to ice and let it sit for 3-5 minutes.

[0100] 5) In a laminar flow hood, add 1 ml of LB medium (Biyuntian ST163, without antibiotics) to each of the above EP tubes, mix gently, and then secure the tubes to the spring rack of a shaker and oscillate at 37°C for 1 hour.

[0101] 6) Centrifuge at 5000 rpm for 1 min. Discard the supernatant in a clean bench. Add 200 μl of antibody-free LB, mix well, and spread onto a solid LB plate (Solebo, L2010) containing Amp resistance in a culture dish.

[0102] 7) Mark the coated dish and place it upside down in a 37°C incubator overnight.

[0103] 2.4 Scrape the green colonies from the plate and screen them using microfluidics Preparation of droplet culture medium: LB medium (Beyotime ST163) was used for the droplet culture medium, and ampicillin (Beyotime, ST008) was added to a final concentration of 100 μg / ml.

[0104] Sample preparation: scrape all the green single colonies on the plate and resuspend them in the droplet culture medium containing Amp resistance. After thorough mixing, test the OD value and dilute step by step: take a sterilized 15ml centrifuge tube and dilute it according to 10 -1 to 10 -n Number them in the order of the tubes, add 9 ml of droplet culture medium containing Amp resistance (pre-cooled at 4°C) to each tube and set aside; use a pipette to draw 1 ml of bacterial solution and inject 10 -1 10 times diluted centrifuge tube, vortex 20s; -1 Draw 1 ml of the diluted solution from the double-diluted bacterial solution and inject 10 -2 Vortex the diluted solution in a centrifuge tube for 20 seconds. Repeat this process until the final dilution reaches 45-50 CFU / ml. The final dilution volume is ≥40 ml. Transfer the diluted solution to a sterile vial.

[0105] Droplet preparation and incubation: Prepare the sample according to the Miss Cell protocol, including consumables installation, instrument initialization, and placement into the sample injection vial. Droplet preparation and incubation were performed at 37°C for 12 hours.

[0106] Droplet sorting and collection: Add 160 μL of Amp-resistant droplet culture medium to a sterile 96-well plate. Open the lid of the sterile 96-well plate, place it in the Miss Cell instrument, and sterilize under UV for 30 minutes, ensuring sterility throughout. After the droplet culture is complete, perform droplet sorting. Select the "sort target droplets and collect into 96-well plate" sorting mode. During sorting, select the fluorescence channel based on the droplet fluorescence signal. The fluorescence parameters used are: excitation light 488 nm, emission light 512 nm. Droplets with a fluorescence intensity of 1300-2000 a.u. and an OD value of 3.5 or above are collected.

[0107] 2.5 Next-Generation Sequencing Single colonies obtained in Section 2.4 were selected and inoculated into LB liquid medium containing Amp resistance. The cultures were shaken overnight at 37°C and 220 rpm, and samples were sent for first-generation sequencing. A total of 96 single colonies were selected, and the sequencing results were compared using SnapGene. The statistical results are shown in Table 6. Of the 96 strains sent, 94 were sequenced successfully, while 2 failed. Among the 94 successfully sequenced strains, 81 different base combinations were found (the base combination repetition rate was 13 / 94 = 13.8%), and 71 different amino acid combinations were found (12 of which introduced stop codons). Fifty-nine double-site mutant strains were suitable for further experiments (59 / 96 = 61.5% of the total selected strains). The theoretical number of amino acid combinations for a double mutant strain is 20 * 20 = 400. In this example, 59 usable strains were obtained while using a smaller number of strains. The method is simple and has high throughput, and more mutation combinations can be obtained with appropriate increase in the workload.

[0108] Table 6: Sequencing results of 2 mutation sites

[0109] 2.5 Detection of enzyme product yield In this example, FutC26695 is a fucosyltransferase that can react with GDP-Fuc and D-lactose as substrates to produce 2-fucosyllactose (2'-FL). The E. coli strain used in this example is capable of expressing GDP-Fuc and D-lactose (the strain described in 1.3 of Example 1). Measuring 2'-FL production can reflect the enzyme activity after the FutC26695 mutation. Specifically, the mutant strain obtained in 2.4 was cultured, and the production of the downstream product 2-fucosyllactose (2'-FL) after the protein mutation was measured. The specific method is as follows: Single colonies from the plate were picked and transferred to a 50 mL centrifuge tube. After culturing in 5 mL LB medium for 24 hours, 250 µl was inoculated into 50 mL SD (250 mL shake flask) for culture (final OD = 0.15). After culturing for 4-6 hours, the OD was measured, and the OD600 was between 1 and 3. Lactose was added to a final concentration of 0.5%. After further culturing for T = 24 hours, samples were taken to measure the 2FL yield. The results are shown in the figure below. Figure 2 As shown, the wild-type represents the yield of five replicates, and the mutants represent 84 strains (excluding 12 strains with stop codon mutations from the 96 strains mentioned above). It can be seen that the 2FL yield of the mutant strains has changed, showing an overall normal distribution with a mean similar to that of the wild-type. Some strains have outliers in yield, with a significant decrease in yield among many strains, while a few strains have significantly increased yield (the strain with the His-Thr mutation combination has the highest yield). This is consistent with the principle that mutations often cause more harm than good.

[0110] The results of yield measurement indicate that the method for constructing and screening a mutant library described in the present invention is feasible and can be used in practice to screen strains with high 2-fucosyllactose production (i.e., strains with improved enzyme catalytic efficiency).

[0111] Example 3 Construction, sorting and sequencing of a 7-site mutation library of the FucT6002 enzyme 3.1 Obtaining fragments covering the mutation site Similar to the operation of Example 2, the DNA sequence corresponding to the FutT6002 enzyme described in Example 1 was split into three parts, namely 1-492 bp, 488-857 bp, and 835-1191 bp. In this example, the seven mutation sites are close to each other and are all in the second fragment.

[0112] In cases where there are many mutation sites (greater than 5) and they are concentrated (within 500 bp), directly splitting each fragment into smaller pieces may affect the efficiency of post-PCR purification and recovery. Therefore, the three fragments were submitted to a commercial company for synthesis and then ligated after PCR using the following primers. The primer sequences used are as follows: F4: ggctacggtctccATGATCGAAATCCGTCTG (SEQ ID NO: 17); R4: ggctacggtctccttccTGCAGAGAGAAGTCTTTTTTTC (SEQ ID NO: 18); F5: ggctacggtctccGGAAAACCACCTGCCGGTTATG (SEQ ID NO: 19); R5: ggctacggtctcaAAAGAAGAGTTAGCGGTGATAGC (SEQ ID NO: 20); F6: ggctacggtctcactttcTCTTACTGGGGTGCTTAC (SEQ ID NO: 21); R6: ggctacggtctccttaACGCAGGATCAGTTTTTTGA (SEQ ID NO: 22).

[0113] The three split parts of FutT6002 were amplified. During amplification, a BsaI site was introduced into the primer. The cutting position of this site is outside the recognition region. It can cut off the redundant area of the introduced enzyme cutting site while creating sticky ends, so that the three parts of the PCR are connected to form a complete enzyme without redundant sequences. Similarly, this method can be extended to other protein mutations and used to introduce mutation sites after splitting the sequence. The sequence can be split into multiple parts according to the length of the sequence and the distribution of the mutation sites to facilitate the connection of the fragments. The following structure of the F-end primer and the R-end primer can be used: "5' end (connection sequence) containing the BsaI site + complementary sequence", where the connection sequence is as follows: ggctacggtctcc (SEQ ID NO: 16).

[0114] 3.2 Amplification of plasmid backbone and fragment ligation After the three fragments of FutT6002 were amplified separately (with BsaI restriction sites added to both ends of the fragments), the plasmid pETDuet-FutC26695-mgfp was used as a template to amplify the fragment excluding FutC26695 as the vector backbone. The vector backbone and the three fragments were recovered and purified separately. BsaI and T4 ligase, as well as the two purified fragments, were added to the same system and supplemented with sterile double-distilled water to 20 μL. The reaction system and reaction procedure are shown in Tables 7 and 8. The resulting recombinant plasmid map is shown in Figure 3 shown.

[0115] Table 7

[0116] Table 8

[0117] 3.3 Conversion 1) Adjust the temperature of the constant temperature water bath to 42℃ in advance.

[0118] 2) Remove a tube (100 μl) of competent E. coli from the -80°C freezer. Immediately melt the tube with your fingers, then place it on ice and incubate for 5–10 minutes.

[0119] 3) Add 20 μl of the ligation mixture, shake gently, and place on ice for 20 minutes.

[0120] 4) After gently shaking, place the tube in a 42°C water bath for 1-2 minutes for heat shock, then quickly return it to ice and let it sit for 3-5 minutes.

[0121] 5) In a clean bench, add 1 ml of LB medium (without antibiotics) to each of the above EP tubes, mix gently, and then fix the tubes to the spring frame of a shaker and shake at 37°C for 1 hour.

[0122] 6) Centrifuge at 5000 rpm for 1 min. Discard the supernatant in a clean bench. Add 200 µl of antibody-free LB, mix well, and spread onto a solid LB plate containing Amp resistance.

[0123] 7) Mark the coated dish and place it upside down in a 37°C incubator overnight.

[0124] 3.4 Scrape the green colonies from the plate and screen them using microfluidics Preparation of droplet culture medium: LB medium (Beyotime ST163) was used for the droplet culture medium, and ampicillin (Beyotime, ST008) was added to a final concentration of 100 μg / mL.

[0125] Sample preparation: scrape all the green single colonies on the plate and resuspend them in the droplet culture medium containing Amp resistance. After thorough mixing, test the OD value and dilute step by step: take a sterilized 15ml centrifuge tube and dilute it according to 10 -1 to 10 -n Number them in the order of the tubes, add 9 ml of droplet culture medium containing Amp resistance (pre-cooled at 4°C) to each tube and set aside; use a pipette to draw 1 ml of bacterial solution and inject 10 -1 10 times diluted centrifuge tube, vortex 20s; -1 Draw 1 ml of the diluted solution from the double-diluted bacterial solution and inject 10 -2 Vortex the diluted solution in a centrifuge tube for 20 seconds. Repeat this process until the final dilution reaches 45-50 CFU / ml. The final dilution volume is ≥40 ml. Transfer the diluted solution to a sterile vial.

[0126] Droplet preparation and incubation: Prepare the sample according to the Miss Cell protocol, including consumables installation, instrument initialization, and placement into the sample injection vial. Droplet preparation and incubation were performed at 37°C for 12 hours.

[0127] Droplet sorting and collection: Add 160 μL of Amp-resistant droplet culture medium to a sterile 96-well plate. Open the lid of the sterile 96-well plate, place it in the Miss Cell instrument, and sterilize under UV for 30 minutes, ensuring sterility throughout. After the droplet culture is complete, perform droplet sorting. Select the "sort target droplets and collect into 96-well plate" sorting mode. During sorting, select the fluorescence channel based on the droplet fluorescence signal. The fluorescence parameters used are: excitation light 488 nm, emission light 512 nm. Droplets with a fluorescence intensity of 1300-2000 a.u. and an OD value of 3.5 or above are collected.

[0128] After collecting the target droplets, the 96-well plate was taken out, sealed with sealing film, and shaken at 37°C and 220 rpm overnight.

[0129] 3.5 First-generation sequencing results and coverage The next day, take out the shaken bacterial solution from part 3.4 and send it for first-generation sequencing.

[0130] 96 single colonies were picked and the sequencing results were compared using SnapGene. 94 were successfully sequenced, and the amino acid sequences at the 7 mutation sites are shown in Table 9. It can be seen that the mutant strains obtained have different sequences at the 7 sites. The method for constructing the mutation library in this embodiment is simple and has high throughput. When there are many mutation sites, the combination of genes and amino acid sequences is less likely to be repeated compared to the case with fewer mutation sites (such as Example 2). The constructed mutation library can cover more mutant strains under the same bacterial picking workload. The sequencing results of this embodiment also further verify the feasibility of the mutation library construction and positive clone sorting described in this patent.

[0131] Table 9: Sequencing results of 7 mutation sites

[0132] In the description of this specification, reference to the terms "one embodiment," "some embodiments," "example," "specific example," or "some examples" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any appropriate manner in any one or more embodiments or examples. In addition, those skilled in the art may combine and combine different embodiments or examples described in this specification, as well as features of different embodiments or examples, unless they are mutually inconsistent.

[0133] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A method for constructing a bacterial mutant library, characterized in that: The method comprises: (1) Based on the mutation site of the target protein, the encoding nucleic acid is split and processed to construct a saturated mutation site fragment encoding the target protein; (2) constructing a first vector containing an expression signal tag, a SUMO-FutC enzyme fragment, and no type IIS restriction enzyme cleavage site; (3) connecting the saturation mutation site fragment to the first vector to obtain a saturation mutation vector library; (4) transferring the vectors in the saturated mutation vector library into the bacteria to obtain the bacterial mutant library, Wherein, the target protein includes fucosyltransferase.

2. The method according to claim 1, characterized in that The fucosyltransferase has an amino acid sequence shown in SEQ ID NO: 1 or 2; and / or The number of mutation sites is 2 to 10; and / or The mutation sites include at least one of positions 150, 176, 177, 188, 215, 218, 274, 275 and 276.

3. The method according to claim 1, characterized in that The mutation site is at least one of positions 150 and 188 of the amino acid sequence shown in SEQ ID NO: 1, and / or the mutation site is at least one of positions 176, 177, 215, 218, 274, 275 and 276 of the amino acid sequence shown in SEQ ID NO: 2; and / or After the splitting process, the mutation sites of the target protein are located at both ends of the target protein encoding nucleic acid fragment; and / or When the distance between two or two groups of mutation sites of the target protein is greater than 1500 bp, the splitting process includes splitting the sequence between the two or two groups of mutation sites into two or more nucleic acid fragments of similar length and less than 1500 bp, and / or When the distance between two or two groups of mutation sites of the target protein is no more than 1500 bp, the splitting process includes setting the sequence between the two or two groups of mutation sites as a nucleic acid fragment, or splitting it into two or more nucleic acid fragments of similar length; and / or When any distance between multiple or multiple groups of mutation sites of the target protein is no more than 500 bp, the splitting process includes treating the continuous sequence containing all the mutation sites as a nucleic acid fragment and constructing a saturated mutation site fragment by commercial synthesis; and / or After the splitting process, the length of the nucleic acid fragment encoding the target protein is less than 1500 bp; and / or When constructing the saturation mutation site fragment encoding the target protein, a BsaI site is introduced at the end of the nucleic acid fragment after the splitting process.

4. The method according to claim 1, wherein The signal marker comprises at least one of a fluorescent marker and a resistance marker; and / or The bacteria include Escherichia coli; and / or The first vector is selected from one of the following: pETDuet, pICH41308 and pGGAselect; and / or The ligation in step (3) is carried out via the BsaI site.

5. The method according to claim 4, characterized in that The signal marker includes green fluorescent protein; and / or The connection in step (3) is performed by golden-gate; and / or In the ligation reaction system, the mass ratio of the saturation mutation fragment to the first vector is 1:1 to 4:

1.

6. A bacterial mutant library, characterized in that The bacterial mutant library is obtained by the method for constructing a bacterial mutant library according to any one of claims 1 to 5.

7. A method for high-throughput screening of high-yielding 2'-fucosyllactose strains, characterized in that: The method comprises: (1) Encapsulating the strains in the bacterial mutant library according to claim 6 to form droplets, and subjecting the droplets to a first culture; (2) Performing microfluidic screening on the droplets after the first culture to obtain the target strain.

8. The method according to claim 7, characterized in that Before encapsulation to form droplets, the strains in the mutant library are pre-screened for resistance; and / or The droplets contain at least one of the following culture media: LB liquid medium, 2216E, Gao's No. 1, potato culture medium; and / or The first culture is carried out at a temperature of 35°C to 38°C for 10 to 15 hours; and / or The microfluidic screening obtains the target strain by screening signals, wherein the screening signals include at least one selected from the group consisting of fluorescence, absorbance, mass spectrometry, turbidity, chemiluminescence, and Raman spectroscopy; and / or Before performing the microfluidic screening, a screening threshold is preset, and droplets whose screening signal intensity reaches the screening threshold are collected.

9. The method according to claim 8, characterized in that The threshold value includes at least one of the following: a fluorescence intensity of 1300 to 2000 a.u., an OD value of not less than 3.5; and / or performing a first fermentation culture on the strain encapsulated in the collected droplets, separating and extracting 2'-fucosyllactose in the culture broth of the first fermentation culture, and detecting the content of 2'-fucosyllactose; and / or The first fermentation culture is carried out at a temperature of 35° C. to 38° C. for 10 to 24 hours.

10. A high-yield 2'-fucosyllactose strain, characterized in that: The strain is obtained by screening using the high-throughput screening method for high-yield 2'-fucosyllactose strains according to any one of claims 7 to 9.

11. Use of the high-yield 2'-fucosyllactose strain according to claim 10 in producing 2'-fucosyllactose.

12. A method for producing 2'-fucosyllactose, characterized in that: include: (1) subjecting the high-yield 2'-fucosyllactose strain of claim 10 to a second fermentation culture; (2) Separating and extracting 2'-fucosyllactose from the culture broth after the second fermentation culture.

13. Use of the high-yield 2'-fucosyllactose strain according to claim 10 in the preparation of food, beverage, health product, cosmetic, feed or additive that helps in anti-oxidation and / or helps in regulating intestinal flora.

14. Use of the high-yield 2'-fucosyllactose strain according to claim 10 in the preparation of pathogen-inhibiting and / or anti-inflammatory drugs.

Images