SnoRNA for detecting myocardial fibrosis as well as detection method and application thereof

Abstract

The invention belongs to the technical field of cardiovascular disease research, and relates to snoRNA for detecting myocardial fibrosis as well as a detection method and application thereof. The invention discloses a specific snoRNA, which is named as CFASR, and the sequence of the specific snoRNA is shown as SEO ID NO. 1. Overexpression of the CFASR can remarkably inhibit myocardial fibrosis, and silence of the CFASR can promote fibrosis and effectively relieve the problem of cardiovascular diseases. As a therapeutic drug, the CFASR gene has a potential regulation effect in cardiovascular diseases, and provides a new target for prevention and treatment of cardiovascular diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of cardiovascular disease research, and relates to a snoRNA for detecting myocardial fibrosis, a detection method and an application thereof. Background Art

[0002] Cardiovascular disease is considered a major cause of mortality and decreased quality of life, with its incidence increasing with age. However, the molecular mechanisms regulating the development of cardiovascular disease remain largely unresolved. Current treatment strategies for cardiovascular disease are limited, including individual variability in drug tolerance and therapeutic efficacy, posing challenges to the prevention and treatment of cardiovascular disease. In recent years, the role of noncoding RNA (ncRNA) in cardiovascular disease has garnered increasing attention. In particular, small nucleolar RNA (snoRNA), a class of RNA molecules ranging in length from 60 to 300 nucleotides that do not encode proteins, has been shown to play a crucial role in regulating a variety of biological processes, including cell cycle control, cell differentiation, proliferation, apoptosis, and intercellular communication. Although studies have indicated the abnormal expression of snoRNA in cardiovascular disease, our understanding of their specific functions and mechanisms of action remains limited. The regulatory mechanisms of snoRNA in cardiovascular disease have become a hot topic of research. In-depth understanding of how snoRNAs influence the expression of cardiovascular disease-related genes and their involvement in the pathogenesis of cardiovascular disease could provide new strategies for the precision treatment of cardiovascular disease.

[0003] Currently, the treatment of myocardial fibrosis mainly relies on drug therapy, interventional therapy and surgical operations. These methods have limitations. For example, drug therapy may cause drug resistance and side effects, and interventional and surgical operations have higher risks and may not be suitable for all patients. Summary of the Invention

[0004] In the field of cardiovascular disease treatment, noncoding RNA is believed to play an important regulatory role. In light of this, the present invention provides a snoRNA for detecting myocardial fibrosis, as well as a detection method and application thereof. The snoRNA is identified by high-throughput sequencing technology as differentially expressed in cardiovascular cells and is named CFASR in the present invention.

[0005] A marker for myocardial fibrosis, wherein the marker is a snoRNA-CFASR gene, and the CFASR nucleic acid sequence is shown in SEO ID NO.1:

[0006] SEO ID NO.1:

[0007] CATTCTGTGATGACTTTACCAAATGACTTTCGTTCTTCTGAGTTTGCTGAAGCCACACTCAGGTGCTGAGAGGG;

[0008] A kit for detecting the CFASR gene, comprising primers for amplifying RNA transcribed from the CFASR gene, wherein the nucleic acid sequences of CFASR-F and CFASR-R are shown in SEO ID No. 2 and SEO ID No. 3, respectively:

[0009] SEO ID NO.2

[0010] CCAAATGACTTTCGTTCTTCTGAG;

[0011] SEO ID NO.3

[0012] CAGCACCTGAGTGTGGCTTC.

[0013] The present invention also provides use of the snoRNA-CFASR in drugs for diagnosing and / or treating heart disease.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides a specific snoRNA sequence (CFASR), whose expression decreases significantly when myocardial fibrosis occurs. By activating CFASR, the occurrence of myocardial fibrosis can be inhibited, providing a new molecular target for the treatment of cardiovascular diseases. The present invention also provides a kit for detecting myocardial fibrosis, including primers for amplifying RNA transcribed from the CFASR gene, which facilitates rapid detection and assessment of the extent of myocardial fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 To detect the knockdown (or inhibition) efficiency of CFASR in cardiac fibroblasts after ASO treatment by qPCR;

[0017] Figure 2 To detect the proliferation of cardiac fibroblasts after ASO treatment, CCK8 was used to detect the proliferation of cardiac fibroblasts;

[0018] Figure 3 Western blot was used to detect the expression levels of COL3A1 and COL1A1 proteins in cardiac fibroblasts after ASO treatment;

[0019] Figure 4 After ASO treatment, the expression of a-SMA was detected by immunofluorescence staining;

[0020] Figure 5 To detect the expression of CFASR in cardiac fibroblasts treated with TGF-β+CFASR, qPCR was used to detect the expression of CFASR in cardiac fibroblasts;

[0021] Figure 6 To detect the proliferation of cardiac fibroblasts treated with TGF-β+CFASR, CCK8 was used to detect the proliferation of cardiac fibroblasts;

[0022] Figure 7 Western blot was used to detect the expression levels of COL3A1 and COL1A1 proteins in cardiac fibroblasts treated with TGF-β+CFASR;

[0023] Figure 8 The cells were treated with TGF-β+CFASR, and the expression of a-SMA was detected by immunofluorescence staining. DETAILED DESCRIPTION

[0024] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, the embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0025] Example 1: Transfection efficiency of CFASR in fibroblasts

[0026] (1) Extraction and culture of mouse cardiac fibroblasts

[0027] Pre-experimental preparations for primary cell culture: Put ophthalmic surgical straight scissors, ophthalmic curved scissors, tweezers, conical flasks, 300-mesh filter screens, and tin foil into a lunch box, sterilize under high pressure, and then dry for later use. Before the experiment begins, turn on the water bath in advance and set the temperature to 37°C. After sterilizing the clean bench for 30 minutes, first prepare the digestion solution and the end digestion solution. Then prepare a six-well plate and place it on an ice brick, and add PBS to four of the wells for later use. Use curved scissors to cut open the chest cavity of mouse pups that are 1 to 3 days old, squeeze the heart with your left hand to make it jump out, quickly cut it off with scissors and place it in a six-well plate filled with pre-cooled PBS prepared in advance. Repeat the above steps until all the puppies' hearts are removed. Each heart was removed and washed four or more times using forceps. The final collected heart was minced with ophthalmic straight scissors and resuspended in digestion solution. The entire heart was transferred to an Erlenmeyer flask, adding 5 mL of digestion solution at a time. The flask was sealed with tin foil, wrapped with a rubber band several times, and gently rocked in a waterbath. Each digestion lasted for 7 minutes. The supernatant after each digestion was collected into a centrifuge tube containing digestion solution. This step was repeated several times until tissue fragments disappeared. The final supernatant was centrifuged at 1000 rpm for 5 minutes and discarded. The pellet was resuspended in serum-free DMEM / F12, centrifuged again, and the supernatant discarded. 5% DMEM / F12 was then added, gently pipetting the cell pellet. Incompletely digested tissue was filtered through a 300-mesh filter and allowed to adhere for 1.5-2 hours. The supernatant was primary mouse and neonatal cardiomyocytes, while adherent fibroblasts were present. Fibroblasts were plated in culture dishes and allowed to adhere for 24 hours before the medium was changed for subsequent immunofluorescence and qPCR experiments.

[0028] (2) ASO transfection into fibroblasts for CFASR inhibition

[0029] First, fibroblasts were seeded into 6-well plates at a density of 1.0×10 cells / well. 2 mL of complete growth medium was added to each well. The cells were then cultured in a 37°C, 5% CO incubator for 18-24 hours until the cell confluence reached 40%-50%, allowing the cells to adapt to the environment and reach a suitable growth state. Before transfection, the cell culture medium was replaced with serum-free medium (e.g., I). Next, 200 μL I serum-free culture medium was placed in a sterile test tube and 6 μL X-tremeGENE was added. TMHP DNA transfection reagent, gently pipette to mix, then add 2μg ASO, gently pipette to mix again, and then incubate at +15℃ to +25℃ for 15-30 minutes to prepare the transfection complex. Add 200μL of transfection complex dropwise to the cell culture well, gently shake or rotate the culture well to ensure that the complex is evenly distributed. 4-6 hours after transfection, replace the culture medium with complete growth medium and continue to culture the cells for 24-72 hours to ensure that the ASO is fully effective. Collect cell samples 24 hours, 48 ​​hours and 72 hours after transfection for detection of CFASR expression levels. The ASO sequence is SEQID NO.6: AGTCATTTGGTAAAGTCATC;

[0030] Example 2: qPCR detection of CFASR gene expression level

[0031] To extract RNA from cells, separate the treated cells into groups and discard the culture medium using a pipette. Wash them two to three times with PBS, then add 1 mL of Trizol, gently remove the beads with the pipette tip, and collect them in a 1.5 mL centrifuge tube. Lyse on ice for 5 minutes. To extract RNA from tissues, cut a piece of heart tissue of appropriate size, add two grinding beads and 1 mL of Trizol, and grind them in a tissue grinder at 60 Hz for 6 to 7 times, each for 15 seconds. Lyse on ice for 5 minutes. Add 200 μL of phenol to each centrifuge tube to extract RNA. Gently invert to mix, let it stand on ice for 5 minutes, and then centrifuge at 12,000 rpm at 4°C for 15 minutes. After centrifugation, remove the top layer from the tube and add an equal volume of isopropanol. Immediately invert to mix, let it stand on ice for 30 minutes, and then centrifuge at 12,000 rpm at 4°C for 15 minutes. Discard the supernatant, add 500 μL of 75% ethanol, and then centrifuge at 12,000 rpm at 4°C for 15 minutes. Repeat twice. The supernatant was discarded, and after air drying, an appropriate amount of DEPC water was added to the centrifuge tube to dissolve the RNA, and the RNA concentration was measured for subsequent experiments.

[0032] RNA reverse transcription reagents were used from Shanghai Yisheng Biotechnology Co., Ltd.

[0033] gDNA digestion: Add 2 μL of 5× gDNA Digester Mix, 1 μg of total RNA, and RNase-free HO to a 10 μL volume in a PCR tube. Gently pipette to mix. Incubate at 42°C for 2 min.

[0034] Preparation of reverse transcription reaction system: add 5 μL 4× AdvanceFastSuperMix, 2 μL RT-Primer, and 3 μL RNase-free water were added to a 20 μL system. Reverse transcription protocol: 55°C, 5 min; 85°C, 5 s; 4°C, ∞.

[0035] Real-time fluorescence quantitative PCR kit, add 10 μL A 20 μL qPCR reaction system was prepared using SYBR Green Master Mix, 1 μL cDNA, 1 μL Forward Primer, 1 μL Reverse Primer, and 7 μL RNase-free water. After centrifugation, the reaction was loaded onto the instrument. A two-step amplification protocol was used: a pre-denaturation step at 95°C for 5 minutes, with 1 cycle; a denaturation step at 95°C for 10 seconds, and an annealing extension step at 60°C for 30 seconds, for a total of 40 cycles. The instrument default protocol was used for the melting curve analysis. After amplification, the experimental data was analyzed. The qPCR primer sequences were:

[0036]

[0037] like Figure 1 As shown in Figure 3, the expression level of CFASR was reduced after ASO treatment. Figure 2 As shown in Figure 3, the proliferation rate increased after ASO treatment. Figure 5 As shown in Figure 3, the expression level of CFASR was increased after TGF-β+CFASR treatment compared with TGF-β and TGF-β+NC treatment groups. Figure 6 As shown in the results, the proliferation rate of fibroblasts treated with TGF-β+CFASR was lower than that of TGF-β and TGF-β+NC. The results showed that CFASR plays an important regulatory role in fibroblast proliferation and the treatment of cardiovascular diseases.

[0038] Experimental Example 1: CCK8 detection of cardiac fibroblast proliferation

[0039] Cell proliferation and viability were detected using Cell Counting Kit-8 (CCK-8) (purchased from Suzhou New Cell and Molecular Biotechnology Co., Ltd., product number #C6005). The specific experimental steps are as follows: Fibroblasts were plated at 5×10 3 The cells were seeded in a 96-well plate at a density of 100 cells / well. Different groups were set up in the experiment, and they were added to the corresponding wells and cultured for 48 hours. After the culture was completed, 10 μl of CCK-8 solution was added to each well and incubated at 37°C for 3 hours. Finally, the absorbance (A450) of each well was measured at a wavelength of 450 nm using a microplate photometer to evaluate cell viability. Figure 2 and Figure 6The results showed that the proliferation rate of fibroblasts treated with ASO increased significantly, while the proliferation rate of fibroblasts treated with TGF-β+CFASR decreased, which effectively reflected that the CFASR gene played a regulatory role in the proliferation activity of fibroblasts.

[0040] Experimental Example 2: Immunofluorescence staining to detect cardiac fibroblast proliferation

[0041] The method of immunofluorescence is as follows: make a cell slide and spread the cells on a 24-well plate. After the cells adhere to the wall, discard the culture medium and wash once with PBS. Fix with 4% paraformaldehyde at room temperature for 10-20 minutes and wash once with PBS. Then use 0.1% TritonX-100 at room temperature for 20 minutes and wash three times with PBS. Block with 5% BSA at room temperature for 30 minutes; add the primary antibody, at room temperature for 2 hours, and wash three times with PBS. Add the fluorescent secondary antibody, at room temperature for 30 minutes, and wash three times with PBS. Finally, add DAPI, stain for 5 minutes, seal the slide, and observe and take pictures with a fluorescence microscope. Figure 4 As shown in Figure 2, the expression of α-SMA in fibroblasts treated with ASO increased, while that in fibroblasts treated with TGF-β+CFASR decreased. Figure 8 As shown in the results, the expression level of α-SMA was reduced. The results showed that CFASR plays an important role in the treatment of myocardial fibrosis and effectively intervenes in the progression of cardiovascular diseases, bringing new therapeutic hope to patients.

[0042] Experimental Example 3: Western blot technique to detect cardiac fibroblast proliferation marker protein levels

[0043] Step 1: To extract protein, scrape cells with PBS and centrifuge at 4°C for 4 minutes at 12,000 rpm. Discard the supernatant and place on ice. Add cell lysis buffer and PMSF to resuspend the cells. Vortex the tube for 3 seconds every 8 minutes. Centrifuge after 30 minutes. Incubate at 4°C for 5 minutes at 12,000 rpm. Remove the supernatant and add 5X loading. Vortex and boil at 100°C for 10 minutes.

[0044] Step 2: Prepare the separating gel and stacking gel. Run the stacking gel at 80V for approximately 30 minutes. Once the protein marker has separated, adjust the voltage to 120V and continue electrophoresis until the protein sample reaches the bottom of the separating gel. Place the entire separating gel on the black sponge pad on the transfer chuck. Cover the entire gel with the activated PVDF membrane (be careful not to create any bubbles). Secure the chuck and place in the transfer apparatus. Maintain the power at approximately 25W and transfer for 1.5 hours.

[0045] Step 3: After transfer, block the membrane with 5% skim milk powder for 1 hour and wash three times with TBST (10 minutes each). Incubate the membrane with the primary antibody overnight at 4°C and wash three times with TBST (10 minutes each). Apply the secondary antibody on a shaker at room temperature for 1.5 hours and wash three times with TBST (10 minutes each).

[0046] Step 4: Development.

[0047] like Figure 3 As shown in Figure 3, the protein levels of COL3A1 and COL1A1 increased after ASO treatment. Figure 7 As shown in the results, after TGF-β+CFASR treatment, the expression levels of COL3A1 and COL1A1 proteins were lower than those in the TGF-β and TGF-β+NC groups, indicating that CFASR can reduce collagen expression in cardiac fibroblasts and play an important role in preventing myocardial fibrosis.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A marker of myocardial fibrosis, characterized in that: The marker is the snoRNA-CFASR gene, and the nucleic acid sequence of the CFASR gene is shown in SEO ID NO.

1.

2. A kit for detecting myocardial fibrosis, characterized in that: The kit includes primers for amplifying RNA transcribed from the CFASR gene: CFASR-F and CFASR-R, whose nucleic acid sequences are shown as SEO ID NO.2 and SEO ID NO.3 respectively. The kit is used to detect the marker according to claim 1.

3. Use of the marker CFASR gene according to claim 1 in a drug for diagnosing and / or treating heart disease.

Images