Primer probe composition for detecting peste des petits ruminants virus and application thereof

Abstract

The invention provides a primer probe composition for detecting peste des petits ruminants virus and application thereof, and relates to the technical field of biological detection, the primer probe composition comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 33, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 41, and a specific fluorescent probe. The invention provides the primer probe for detecting the peste des petits ruminants virus based on the RPA, and solves the technical problem that the RPA primer for detecting the peste des petits ruminants virus is lacked in the prior art.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, in particular to a primer-probe composition for detecting peste des petits ruminants virus and an application thereof. Background Art

[0002] Peste des petits ruminants (PPR), commonly known as sheep plague, also known as pseudorinderpest, pneumoenteritis, or stomatitis-pneumoenteritis complex, is an acute viral and parasitic disease caused by the peste des petits ruminants virus. It primarily infects small ruminants and is characterized by fever, stomatitis, diarrhea, and pneumonia. Peste des petits ruminants virus (PPRV) belongs to the genus Morbillivirus in the family Paramyxoviridae and shares similar physicochemical and immunological properties with rinderpest virus. The virus is pleomorphic, typically having a rough, spherical shape. The PPRV genome is a single-stranded, negative-sense RNA of 15,948 nt in length. The 3' end of the genome houses the genomic promoter region, while the 5' end houses the reversed genomic promoter region. The six genes are arranged in the order 3'-NPMF-HL-5', encoding the six structural proteins nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin (H), and large protein (L). The P gene also encodes two nonstructural proteins, C and V. The nucleocapsid protein N is highly conserved.

[0003] Since the first outbreak of PPR in 1942, the disease has continued to spread both domestically and internationally, with its scope expanding and the number of infected hosts increasing, severely restricting the development of the sheep industry. Rapid detection is an effective means of promptly detecting and controlling the spread of PPR and is also a key approach to eradicating the disease. Although various PPR nucleic acid and antibody detection methods have been established, such as virus isolation (VI), agar gel immunodiffusion assay, immunocapture ELISA, and RT-qPCR, these methods either require sophisticated instruments and are costly, or have long detection times and cumbersome result determination methods, limiting their widespread application in clinical diagnosis. There is an urgent need for a field diagnostic method with high specificity, strong sensitivity, simple operation, and short reaction time to provide technical support for rapid on-site diagnosis in areas where technology and equipment are scarce.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] One of the objectives of the present invention is to provide a primer-probe combination for detecting Peste des Petits Ruminants virus, so as to solve the technical problem of the lack of RPA primers for detecting Peste des Petits Ruminants virus in the prior art.

[0006] A second object of the present invention is to provide the use of the above-mentioned primer-probe combination in preparing products for detecting or assisting in detecting Peste des Petits Ruminants virus, preparing products for detecting whether a sample contains Peste des Petits Ruminants virus, preparing products for diagnosing or assisting in diagnosing diseases caused by Peste des Petits Ruminants virus, or preparing products for screening diseases caused by Peste des Petits Ruminants virus.

[0007] A third object of the present invention is to provide a reagent for detecting peste des petits ruminants virus.

[0008] A fourth object of the present invention is to provide a kit for detecting peste des petits ruminants virus.

[0009] A fifth object of the present invention is to provide the use of the above-mentioned reagent or the above-mentioned kit in preparing products for detecting or assisting in detecting Peste des Petits Ruminants virus, preparing products for detecting whether a sample contains Peste des Petits Ruminants virus, preparing products for diagnosing or assisting in diagnosing diseases caused by Peste des Petits Ruminants virus, or preparing products for screening diseases caused by Peste des Petits Ruminants virus.

[0010] A sixth object of the present invention is to provide a method for detecting or assisting in detecting peste des petits ruminants virus for non-therapeutic and non-diagnostic purposes.

[0011] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are adopted:

[0012] In the first aspect, the present invention provides a primer-probe composition for detecting peste des petits ruminants virus, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 33, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 41, and a specific fluorescent probe with a nucleotide sequence as shown in SEQ ID NO: 16.

[0013] Furthermore, the specific fluorescent probe contains a tetrahydrofuran residue site between positions 30 and 31, and includes a blocking modification at the 3' end of the nucleotide sequence shown in SEQ ID NO: 16.

[0014] Furthermore, the T base at position 30 of the specific fluorescent probe is labeled with a fluorescent reporter group or a fluorescent quencher group, and the T base at position 32 of the specific fluorescent probe is labeled with a fluorescent reporter group or a fluorescent quencher group;

[0015] Preferably, the fluorescent reporter group is selected from at least one of FAM, VIC, HEX, JOE, FITC, TRT, CY3, CY5, ROX, TET, TexasRed, SYTO-13, SYTO-82, LCRED460 or LCRED705;

[0016] The fluorescence quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, Dabcy1 or TAMRA;

[0017] The 3' end of SEQ ID NO. 16 is connected to C3-spacer.

[0018] In a second aspect, the present invention provides the use of the primer-probe combination described above in any of the following:

[0019] A1. Use in the preparation of products for detecting or assisting in the detection of peste des petits ruminants virus;

[0020] A2. Use in the preparation of products for detecting the presence of peste des petits ruminants virus in samples;

[0021] A3. Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by peste des petits ruminants virus;

[0022] A4. Application in the preparation of products for screening diseases caused by peste des petits ruminants virus.

[0023] In a third aspect, the present invention provides a reagent for detecting peste des petits ruminants virus, comprising the above-mentioned primer-probe combination.

[0024] In a fourth aspect, the present invention provides a kit for detecting peste des petits ruminants virus, comprising the above-mentioned primer-probe combination or the above-mentioned reagent.

[0025] Furthermore, other reagents required for isothermal amplification of the recombinase are also included.

[0026] In a fifth aspect, the present invention provides the use of the above-mentioned reagent or the above-mentioned kit in any of the following:

[0027] B1. Use in detecting or assisting in the detection of peste des petits ruminants virus or in the preparation of products for detecting or assisting in the detection of peste des petits ruminants virus;

[0028] B2. Use in detecting whether a sample contains the peste des petits ruminants virus or in preparing products for detecting whether a sample contains the peste des petits ruminants virus;

[0029] B3. Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by peste des petits ruminants virus;

[0030] B4. Use in screening for diseases caused by peste des petits ruminants virus or in preparing products for screening for diseases caused by peste des petits ruminants virus.

[0031] In a sixth aspect, the present invention provides a method for detecting or assisting in the detection of Peste des Petits Ruminants virus for non-therapeutic and non-diagnostic purposes, comprising performing recombinase isothermal amplification on a sample using the above-mentioned primer-probe combination, the above-mentioned reagent or the above-mentioned kit, and determining whether Peste des Petits Ruminants virus is present in the sample based on the fluorescent signal.

[0032] Furthermore, the reaction temperature of the recombinase isothermal amplification is 35-41°C, preferably 39°C;

[0033] Preferably, the reaction time of the recombinase isothermal amplification is 30 min.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) The primer-probe combination provided by the present invention has good specificity for Peste des Petits Ruminants virus and can detect it efficiently and accurately.

[0036] (2) Compared with the existing PCR technology, the detection method provided by the present invention is simple and rapid to operate, and does not require expensive thermal cycling detection equipment. The method can directly read the test results in only 30 minutes, which is suitable for emergency and on-site detection needs with a short detection time. Compared with the RPA test strip method, this method does not require opening the lid after amplification, which minimizes the risk of aerosol contamination. This method provides strong technical support for the prevention and control of PPR virus and has very broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0038] Figure 1 The RPA amplification results after different upstream primers and downstream primers are paired in Example 1;

[0039] Figure 2 The RPA amplification results after different upstream primers and downstream primers are paired in Example 2;

[0040] Figure 3 The RPA amplification results after different upstream primer and downstream primer pairings in Example 3;

[0041] Figure 4 The RPA amplification results of Example 4 with different primer concentrations (Figure A) and different probe concentrations (Figure B) are shown;

[0042] Figure 5 For Example 5 different Mg 2+ RPA amplification results of concentration;

[0043] Figure 6 This is a specificity test of the RPA detection method for peste des petits ruminants virus in Example 6;

[0044] Figure 7 This is a repeatability test of the RPA detection method for peste des petits ruminants virus in Example 8. DETAILED DESCRIPTION

[0045] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear; however, in the event of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In this application, the use of "or" means "and / or" unless otherwise stated. In addition, the use of the term "including" and other forms is non-limiting.

[0046] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

[0047] On the one hand, the present invention provides a primer-probe composition for detecting peste des petits ruminants virus, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 33, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 41, and a specific fluorescent probe with a nucleotide sequence as shown in SEQ ID NO: 16.

[0048] The specific fluorescent probe contains a tetrahydrofuran residue site between positions 30 and 31, and includes a blocking modification at the 3' end of the nucleotide sequence shown in SEQ ID NO: 16.

[0049] Specifically, the blocking modification is to modify the blocking group, and any modification group that can prevent the polymerase from synthesizing new bases can be selected.

[0050] In some optional embodiments, the T base at position 30 of the specific fluorescent probe is labeled with a fluorescent reporter group, and the T base at position 32 is labeled with a fluorescent quencher group.

[0051] In some optional embodiments, the T base at position 30 of the specific fluorescent probe is labeled with a fluorescent quencher group, and the T base at position 32 is labeled with a fluorescent reporter group.

[0052] Specifically, the fluorescent reporter group modified with the probe can be any fluorescent group, and the fluorescent quencher group modified on the probe can be any group sufficient to quench the corresponding fluorescent group. In some specific embodiments, the fluorescent reporter group is selected from at least one of FAM, VIC, HEX, JOE, FITC, TRT, CY3, CY5, ROX, TET, TexasRed, SYTO-13, SYTO-82, LCRED460, or LCRED705. The fluorescent quencher group is selected from at least one of BHQ1, BHQ2, BHQ3, Dabcy1, or TAMRA. The 3' end of SEQ ID NO: 16 is connected to a C3-spacer.

[0053] The primer-probe combination provided by the present invention is designed according to the nucleotide sequence shown in SEQ ID NO: 1, which solves the technical problem of the lack of RPA primers for detecting peste des petits ruminants virus in the prior art.

[0054] In order to further improve the amplification efficiency, in some specific embodiments, the molar ratio of the upstream primer, the downstream primer and the specific fluorescent probe is 5:5:1.

[0055] According to another aspect of the present invention, there is also provided the use of the above primer-probe combination in any of the following:

[0056] A1. Use in the preparation of products for detecting or assisting in the detection of peste des petits ruminants virus;

[0057] A2. Use in the preparation of products for detecting the presence of peste des petits ruminants virus in samples;

[0058] A3. Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by peste des petits ruminants virus;

[0059] A4. Application in the preparation of products for screening diseases caused by peste des petits ruminants virus.

[0060] The product may be a reagent, a test kit, or other detection products.

[0061] According to another aspect of the present invention, a reagent for detecting peste des petits ruminants virus is provided, comprising the above-mentioned primer-probe combination.

[0062] According to another aspect of the present invention, a kit for detecting peste des petits ruminants virus is provided, comprising the above-mentioned primer-probe combination or the above-mentioned reagent.

[0063] In some specific embodiments, other reagents required for isothermal amplification of the recombinase are also included.

[0064] According to another aspect of the present invention, there is also provided the use of the above reagent or the above kit in any of the following:

[0065] B1. Use in detecting or assisting in the detection of peste des petits ruminants virus or in the preparation of products for detecting or assisting in the detection of peste des petits ruminants virus;

[0066] B2. Use in detecting whether a sample contains the peste des petits ruminants virus or in preparing products for detecting whether a sample contains the peste des petits ruminants virus;

[0067] B3. Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by peste des petits ruminants virus;

[0068] B4. Use in screening for diseases caused by peste des petits ruminants virus or in preparing products for screening for diseases caused by peste des petits ruminants virus.

[0069] According to another aspect of the present invention, a method for detecting or assisting in the detection of Peste des Petits Ruminants virus for non-therapeutic and non-diagnostic purposes is also provided, comprising performing recombinase isothermal amplification on a sample using the above-mentioned primer-probe combination, the above-mentioned reagent or the above-mentioned kit, and determining whether Peste des Petits Ruminants virus is present in the sample based on a fluorescent signal.

[0070] Wherein, the sample includes an environmental sample or an animal tissue and / or organ.

[0071] The system for isothermal amplification of the recombinase was 50 μL, and the reaction system was shown in Table 1.

[0072] Table 1 Recombinase isothermal amplification system

[0073]

[0074] In some specific embodiments, the reaction temperature of the recombinase isothermal amplification is 35-41°C, preferably 39°C;

[0075] In some specific embodiments, the reaction time of the recombinase isothermal amplification is 30 minutes.

[0076] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0077] The recombinase isothermal amplification (RPA amplification) used in the following examples all used the TwistAmp nfo kit (manufacturer: TwistDx, model: TANFO02KIT).

[0078] Example 1 Primary screening of RPA amplification primers

[0079] 1. Design of Primary Candidate Primer Sets

[0080] Using the N sequence (nucleotide sequence shown in SEQ ID NO: 1) as a template, seven pairs of primers with a fixed length of 32 bp were designed. The upstream primer set was F1 to F7, and the downstream primer set was R1 to R7. The details are shown in Table 2. The following sequences were sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis.

[0081] Table 2 Primary candidate primer sets

[0082]

[0083]

[0084] 2. Probe Design

[0085] Using the sequence between F7 and R7 as a template, probe design was performed according to the TwistDx RPA kit instructions. The probe sequence is:

[0086] ATGTTATCATAGTCCCGATTCCCGGAGACTHGTCCATCATTACCCGTB (SEQ ID NO: 16), where H represents a THF (tetrahydrofuran) residue, B represents a blocking group (C3-spacer), the T at position 30 is labeled with a fluorescent reporter group (dT-FAM), and the T at position 32 is labeled with a fluorescent quencher group (dT-BHQ1). This sequence was synthesized at Shanghai Sangon Biotechnology Co., Ltd.

[0087] 3. RPA Amplification

[0088] The primers and probes in Table 2 were amplified by recombinase polymerase isothermal amplification using the TwistDx RPA kit. The total volume of the RPA reaction system was 50 μL, wherein 2.1 μL of the forward primer at a concentration of 10 μmol / L was added, 2.1 μL of the reverse labeled primer was added, 0.6 μL of the probe at a concentration of 10 μmol / L was added, 1 μL of the DNA template at a concentration of 20 fg / μL (a plasmid containing an N sequence) was added, 29.5 μL of the RPA reaction buffer, and 0.5 M MgCl2 were added. 2+ Add 1.4 μL of ddH2O and make up to 50 μL.

[0089] First, the selected primer F1 was fixed and paired with primers R1-R7 for amplification. After comparing the amplification efficiency of these primer pairs, the best amplification primer among the R primers was fixed and paired with primers F1-F7 for amplification, and the amplification effects were compared.

[0090] The RPA amplification reaction procedure is: constant temperature reaction at 39°C and amplification for 30 minutes.

[0091] Detection of RPA products: Use a constant temperature fluorescence detector to record the changes in fluorescence signals in real time, and then compare the start time of each reaction signal and the strength of the signal. Figure 1 As shown, A is the RPA amplification result after fixing the upstream primer F1 and then pairing F1 with the downstream primers in pairs; B is the RPA amplification result after fixing the downstream primer R6 and then pairing R6 with the upstream primers in pairs. Figure 1 A shows that R6 pairing amplification efficiency is better. Figure 1 From B, we can see that F2 has a better amplification efficiency.

[0092] Primary screening results: F2 and R6 are the primer pair with the highest amplification efficiency in this round.

[0093] Example 2 Secondary Screening of RPA Primers

[0094] 1. Primer Design

[0095] Based on the optimal primer pair F2 and R6 in Example 1, the primer lengths were kept constant and the primers were shifted by about 2 bp to obtain a new upstream primer set and downstream primer set. The following sequences were sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis. The specific sequences are shown in Table 3.

[0096] Table 3 Second level candidate primer sets

[0097]

[0098]

[0099] 2. RPA Amplification

[0100] The primers in Table 3 were amplified by recombinase polymerase isothermal amplification using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL, wherein 2.1 μL of the forward primer at a concentration of 10 μmol / L, 2.1 μL of the reverse labeled primer, 0.6 μL of the probe at a concentration of 10 μmol / L, 1 μL of the DNA template (plasmid containing the N sequence) at a concentration of 20 fg / μL, 29.5 μL of the RPA reaction buffer, and 0.5 M MgCl2 were added. 2+ Add 1.4 μL of ddH2O and make up to 50 μL.

[0101] First, the selected primer F2 was fixed and amplified using primers R61-R63, R6, and R64-R67 in pairs. After comparing the amplification efficiencies of these primer pairs, the optimal amplification primers among the R primers were fixed and amplified using primers F21-F23, F2, and F24-F27 in pairs, and the amplification effects were compared.

[0102] The RPA amplification reaction procedure is: constant temperature reaction at 39°C and amplification for 30 minutes.

[0103] Detection of RPA products: Use a constant temperature fluorescence detector to record the changes in fluorescence signals in real time, and then compare the start time of each reaction signal and the strength of the signal. Figure 2 As shown, A is the RPA amplification result after fixing the upstream primer F2 and then pairing F2 with the downstream primers in pairs; B is the RPA amplification result after fixing the downstream primer R65 and then pairing R65 with the upstream primers in pairs. Figure 1 A shows that R65 pairing amplification efficiency is better. Figure 1 From B, we can see that F26 has a better amplification efficiency.

[0104] Second-level screening results: F26 and R65 are the primer pair with the highest amplification efficiency in this round.

[0105] Example 3: Tertiary Screening of RPA Primers

[0106] 1. Primer Design

[0107] Based on the optimal primer pair F26 and R65 in Example 2, the 5' end positions of the primers were kept unchanged and the primers were shortened or extended by 1 bp to obtain new upstream and downstream primer sets. The sequences were sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis. The specific sequences are shown in Table 4.

[0108] Table 4 Third-level candidate primer sets

[0109] Primers Sequence (5'—3') serial number F261 AAAGCTTAGCATTGTTCAAAAGGAACAAAG SEQ ID NO:31 F262 AAAGCTTAGCATTGTTCAAAAGGAACAAAGA SEQ ID NO:32 F263 AAAGCTTAGCATTGTTCAAAAGGAACAAAGACA SEQ ID NO:33 F264 AAAGCTTAGCATTGTTCAAAAGGAACAAAGACAA SEQ ID NO:34 F265 AAAGCTTAGCATTGTTCAAAAGGAACAAAGACAAA SEQ ID NO:35 F266 AAAGCTTAGCATTGTTCAAAAGGAACAAAGACAAAG SEQ ID NO:36 F267 AAAGCTTAGCATTGTTCAAAAGGAACAAAGACAAAGC SEQ ID NO:37 R651 CAGGATCTCCGGCCAATCTGACTAGCCTGT SEQ ID NO:38 R652 CAGGATCTCCGGCCAATCTGACTAGCCTGTC SEQ ID NO:39 R653 CAGGATCTCCGGCCAATCTGACTAGCCTGTCGA SEQ ID NO:40 R654 CAGGATTCCGGCCAATCTGACTAGCCTGTCGAG SEQ ID NO:41 R655 CAGGATCTCCGGCCAATCTGACTAGCCTGTCGAGC SEQ ID NO:42 R656 CAGGATTCCGGCCAATCTGACTAGCCTGTCGAGCA SEQ ID NO:43 R657 CAGGATCTCCGGCCAATCTGACTAGCCTGTCGAGCAG SEQ ID NO:44

[0110] 2. RPA Amplification

[0111] The primers in Table 4 were amplified by recombinase polymerase isothermal amplification using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL, wherein 2.1 μL of the forward primer at a concentration of 10 μmol / L, 2.1 μL of the reverse labeled primer, 0.6 μL of the probe at a concentration of 10 μmol / L, 1 μL of the DNA template (plasmid containing the E4 sequence) at a concentration of 20 fg / μL, 29.5 μL of the RPA reaction buffer, and 0.5 M MgCl2 were added. 2+ Add 1.4 μL of ddH2O and make up to 50 μL.

[0112] First, select primer F26 and pair it with primers R651-R652, R6, and R653-R657 for amplification. After comparing the amplification efficiencies of these primer pairs, the optimal amplification primer among the R primers was fixed and paired with primers F261-F262, F2, and F263-F267 for amplification, and the amplification effects were compared.

[0113] The RPA amplification reaction procedure is: constant temperature reaction at 39°C and amplification for 30 minutes.

[0114] Detection of RPA products: Use a constant temperature fluorescence detector to record the changes in fluorescence signals in real time, and then compare the start time of each reaction signal and the strength of the signal. Figure 3 As shown in Figure 1, A is the RPA amplification result after fixing the upstream primer F26 and then pairing F26 with the downstream primers in pairs; B is the RPA amplification result after fixing the downstream primer R654 and then pairing R654 with the upstream primers in pairs. Figure 3 From A, we can see that R654 reaction signal has the fastest starting time and the strongest signal, so R654 is the best downstream primer. Figure 3 From Figure B, we can see that the F263 reaction signal has the fastest onset time and the strongest signal, and F263 is the best upstream primer.

[0115] The third-level screening results: F263 and R654 are the primer pair with the highest amplification efficiency in this round.

[0116] Example 4 Screening of primer and probe concentrations

[0117] 1. Optimal primer concentration

[0118] Recombinase polymerase isothermal amplification was performed using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL, and primers F263 and R654 at a concentration of 10 μmol / L were added to the system according to the following gradient volumes of 1.5 μL, 1.8 μL, 2.1 μL, 2.4 μL, 2.7 μL, 3 μL, 3.3 μL, and 3.6 μL, respectively. 0.6 μL of the probe at a concentration of 10 μmol / L was added, 1 μL of the DNA template at a concentration of 20 fg / μL (a plasmid containing an N sequence) was added, 29.5 μL of RPA reaction buffer, and 0.5 M MgCl2 were added. 2+ Add 1.4 μL of ddH2O and make up to 50 μL.

[0119] The RPA amplification reaction procedure is: constant temperature reaction at 39°C and amplification for 30 minutes.

[0120] Detection of RPA products: Use a constant temperature fluorescence detector to record the changes in fluorescence signals in real time, and then compare the start time of each reaction signal and the strength of the signal. Figure 4As shown in A, it is the effect of different primer concentrations. The amplification efficiency is the highest when 3 μL of primer is added (i.e., 600 nM).

[0121] 2. Optimal probe concentration

[0122] Recombinase polymerase isothermal amplification was performed using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL. 3 μL of primers F263 and R654 at a concentration of 10 μmol / L were added, 0.6 μL, 0.8 μL, 1 μL and 1.2 μL of probe at a concentration of 10 μmol / L were added, 1 μL of DNA template (plasmid containing N sequence) at a concentration of 20 fg / μL was added, 29.5 μL of RPA reaction buffer, 0.5 M MgCl2 were added, and 0.6 μL, 0.8 μL, 1 μL and 1.2 μL of probe at a concentration of 10 μmol / L were added. 2+ Add 1.4 μL of ddH2O and make up to 50 μL.

[0123] The RPA amplification reaction procedure is: constant temperature reaction at 39°C and amplification for 30 minutes.

[0124] Detection of RPA products: Use a constant temperature fluorescence detector to record the changes in fluorescence signals in real time, and then compare the start time of each reaction signal and the strength of the signal. Figure 4 As shown in B, the amplification efficiency is highest when 0.6 μL of probe is added, and the amount of probe added used in the subsequent amplification reaction is selected to be 0.6 μL (ie, 120 nM).

[0125] Example 5 Best Mg 2+ Screening of ion concentration

[0126] Recombinase polymerase isothermal amplification was performed using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL, 3 μL of primers F263 and R654 at a concentration of 10 μmol / L were added, 0.6 μL of a probe at a concentration of 10 μmol / L was added, 1 μL of a DNA template at a concentration of 20 fg / μL (a plasmid containing an N sequence) was added, 29.5 μL of RPA reaction buffer, and 0.5 M MgCl2 were added. 2+ Add 1.2 μL, 1.4 μL, 1.6 μL and 1.8 μL respectively, and make up to 50 μL with ddH2O.

[0127] The RPA amplification reaction procedure is: constant temperature reaction at 39°C and amplification for 30 minutes.

[0128] Detection of RPA products: Use a constant temperature fluorescence detector to record the changes in fluorescence signals in real time, and then compare the start time of each reaction signal and the strength of the signal. Figure 5 As shown, 0.5 M Mg 2+ The amplification efficiency was highest when 1.4 μL was added.

[0129] Example 6 Specificity detection of primers and probes

[0130] The optimal primers F263 and R654 and probes obtained by screening were used to perform the specific detection of common ruminant diseases according to the optimal reaction system explored in Examples 4 and 5. The test sample nucleic acids tested were: (1) PPRV nucleic acid templates preserved by this laboratory. (2) Bacterial sample control group: Pasteurella, Clostridium perfringens type C, Clostridium perfringens type D nucleic acid templates. (3) Virus sample control group: Foot-and-mouth disease type O (FMDV-O), bovine leukemia virus (BLV), bovine infectious rhinotracheitis (BoHV-1) nucleic acid templates. (4) Negative control: ddH2O.

[0131] The bacterial and viral control group samples were subjected to viral nucleic acid extraction using the magnetic bead viral DNA / RNA extraction kit (Catalog No.: CW2509S (96preps)) of Kangwei Century Biotechnology Co., Ltd. and stored at -20°C for future use.

[0132] The test results are shown in Table 5 and Figure 6 As shown, it can be seen that the method established by the present invention can specifically amplify PPRV templates, but cannot specifically amplify other viruses. The primers and probes of the present invention have good specificity.

[0133] Table 5 Specificity test results of PPRV RPA detection method

[0134]

[0135] Example 7 Sensitivity Detection of Primers and Probes

[0136] The sensitivity of the primers and probes was tested using the optimal primers F263 and R654 obtained from the screening, according to the optimal reaction system explored in Examples 4 and 5. 20 fg / μL of DNA template (plasmid containing the N sequence) was used as a positive control, and ddH2O was used as a negative control.

[0137] The specific operations are as follows:

[0138] The DNA template (plasmid containing the N sequence) with a concentration of 1000 copies / μL was serially diluted 10-fold and numbered 1 to 4. The negative control was numbered 5. The detection was performed according to the reaction conditions optimized in Examples 1 to 5. The specific Tt value results are shown in Table 6, indicating that the sensitivity can reach 10 copies / μL.

[0139] Table 6 Comparison results of sensitivity test of PPRV detection method

[0140]

[0141] Example 8 Repeatability Verification

[0142] The best primers F263 and R654 and the probe obtained by screening were used to perform three repetitive experiments according to the best reaction system explored in Examples 4 and 5. The positive sample was a DNA template (a plasmid containing an N sequence) at a concentration of 20 fg / μL, and ddH2O was used as a negative control. The amplification results are shown in FIG. Figure 7 The specific Tt values ​​are shown in Table 7. It can be seen that the method of the present invention has good stability.

[0143] Table 7 Stability test results of PRRV RPA detection method

[0144]

[0145] Example 9 Clinical Application and Comparison

[0146] In order to compare the detection results of the RPA method developed in the present invention with those of the qPCR method, this example used the national standard (GB / T 27982-2011) as a comparison method to detect 50 clinical suspected samples.

[0147] The results are shown in Table 8. For samples detected as positive by the national standard, the RPA method of the present invention also detected positive results, with a positive agreement rate of 100%. For samples detected as negative by the national standard method, the RPA method of the present invention also detected negative results. It can be seen that the agreement rate between the RPA method of the present invention and the qPCR in the national standard is 100%.

[0148] Table 8 Comparison of RPA and qPCR results

[0149]

Claims

1. A primer-probe combination for detecting peste des petits ruminants virus, characterized in that: It includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 33, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 41, and a specific fluorescent probe with a nucleotide sequence as shown in SEQ ID NO:

16.

2. The primer-probe combination according to claim 1, wherein The specific fluorescent probe contains a tetrahydrofuran residue site between positions 30 and 31, and includes a blocking modification at the 3' end of the nucleotide sequence shown in SEQ ID NO:

16.

3. The primer-probe combination according to claim 1, wherein The T base at position 30 of the specific fluorescent probe is labeled with a fluorescent reporter group or a fluorescent quencher group, and the T base at position 32 of the specific fluorescent probe is labeled with a fluorescent reporter group or a fluorescent quencher group; Preferably, the fluorescent reporter group is selected from at least one of FAM, VIC, HEX, JOE, FITC, TRT, CY3, CY5, ROX, TET, TexasRed, SYTO-13, SYTO-82, LCRED460 or LCRED705; The fluorescence quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, Dabcy1 or TAMRA; The 3' end of SEQ ID NO. 16 is connected to C3-spacer.

4. The primer-probe combination according to claim 1, wherein The molar ratio of the upstream primer, the downstream primer and the specific fluorescent probe is 5:5:

1.

5. Use of the primer-probe combination according to any one of claims 1 to 3 in any of the following: A1. Use in the preparation of products for detecting or assisting in the detection of peste des petits ruminants virus; A2. Use in the preparation of products for detecting the presence of peste des petits ruminants virus in samples; A3. Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by peste des petits ruminants virus; A4. Application in the preparation of products for screening diseases caused by peste des petits ruminants virus.

6. A reagent for detecting peste des petits ruminants virus, characterized in that: The invention comprises the primer-probe combination according to any one of claims 1 to 3.

7. A kit for detecting peste des petits ruminants virus, characterized in that: Comprising the primer-probe combination according to any one of claims 1 to 3 or the reagent according to claim 5; Preferably, the kit further comprises other reagents required for isothermal amplification of the recombinase.

8. Use of the reagent according to claim 5 or the kit according to claim 6 or 7 in any of the following: B1. Use in detecting or assisting in the detection of peste des petits ruminants virus or in the preparation of products for detecting or assisting in the detection of peste des petits ruminants virus; B2. Use in detecting whether a sample contains the peste des petits ruminants virus or in preparing products for detecting whether a sample contains the peste des petits ruminants virus; B3. Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by peste des petits ruminants virus; B4. Use in screening for diseases caused by peste des petits ruminants virus or in preparing products for screening for diseases caused by peste des petits ruminants virus.

9. A method for detecting or assisting in the detection of peste des petits ruminants virus for non-therapeutic and non-diagnostic purposes, characterized in that: The method comprises performing recombinase isothermal amplification on a sample using the primer-probe combination according to any one of claims 1 to 3, the reagent according to claim 5, or the kit according to claim 6 or 7, and determining whether peste des petits ruminants virus is present in the sample based on a fluorescent signal.

10. The method according to claim 9, characterized in that The reaction temperature of the recombinase isothermal amplification is 35-41°C, preferably 39°C; Preferably, the reaction time of the recombinase isothermal amplification is 30 min.

Images