A high-concentration carbon dioxide-resistant chlorella and a preparation method and application thereof

Abstract

This invention belongs to the field of biotechnology and relates to a high-concentration carbon dioxide-tolerant *Synechococcus* species, its preparation method, and its applications. The high-concentration carbon dioxide-tolerant *Synechococcus* species includes a CRISPR / dCas9 plasmid, a gRNA plasmid, and a knockout ω plasmid. This invention enables the growth of PCC7942 under high CO2 conditions by transcribedly activating PEPC using the CRISPR / dCas9 system. Furthermore, the fusion between the ω subunit of RNAP and a Cas9 nuclease mutant that binds to the upstream promoter region allows for programmable transcriptional activation. By knocking out the ω subunit, the CRISPR / dCas9 transcriptional regulation system is used to optimize the microalgal photosynthetic carbon fixation pathway, thereby improving the growth and carbon fixation efficiency of microalgae under high CO2 conditions.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a Synechococcus aureus resistant to high concentrations of carbon dioxide, its preparation method, and its application. Background Technology

[0002] CO2 capture, utilization, and storage (CCUS) technology is crucial as an important greenhouse gas emission reduction technology. CCUS technology is an important means to achieve long-term CO2 emission reduction, with carbon capture being the core component, involving the separation of CO2 from energy use, industrial production, and the atmosphere. CCUS technologies mainly include physical, chemical, and biological methods. Physical methods involve temporarily storing CO2 by injecting it into the deep sea or underground, which has high requirements for the geological environment and carries the risk of leakage. Chemical methods use chemical reagents to absorb and fix CO2, consuming large amounts of reagents. Biological methods, especially microalgal photosynthesis, convert absorbed CO2 into biomass energy stored within the organism, enabling carbon recycling. Furthermore, microalgae are a valuable renewable biomass resource, which helps reduce dependence on fossil fuels. Therefore, microalgal carbon fixation through photosynthesis is an effective method for achieving carbon emission reduction through carbon cycling. Utilizing microalgae for carbon fixation is an economically feasible, environmentally friendly, and sustainable carbon fixation technology with enormous application potential.

[0003] Microalgae, composed of eukaryotic microalgae (such as diatoms and green algae) and prokaryotic microalgae (such as cyanobacteria), can utilize solar energy to convert CO2 into biomass such as proteins, starches, and lipids through photosynthesis. Compared with traditional carbon capture methods, microalgal carbon fixation has the following advantages: ① It can directly utilize solar energy, saving a significant amount of energy compared to physical and chemical methods; ② The microalgal carbon fixation process is environmentally friendly, producing no secondary pollutants in its metabolites; ③ Microalgae have a short growth cycle (4-10 days) and high photosynthetic efficiency, 10-50 times that of typical terrestrial plants; ④ Microalgae are aquatic organisms with strong environmental adaptability, capable of being cultivated in coastal mudflats, saline-alkali lands, and deserts without competing with terrestrial plants for soil. Cultivating microalgae in suitable environments for resource utilization can reduce atmospheric CO2.

[0004] However, microalgal carbon fixation technology faces several challenges, such as cultivation costs, large-scale production, and efficient utilization of biomass. Different microalgal species have different optimal CO2 concentrations for growth, but excessively high CO2 concentrations have negative effects on all types of microalgae, including inhibiting photosynthesis and growth, and even causing microalgal death. Therefore, a series of methods are needed to improve the carbon fixation efficiency of microalgae and establish more optimized microalgal carbon fixation mechanisms. However, current genetic manipulation tools for cyanobacteria are still relatively scarce and inefficient. Developing efficient cyanobacterial gene regulation tools is of great significance for cyanobacterial systems and synthetic biology research. Summary of the Invention

[0005] This invention addresses the shortcomings of existing technologies by providing a high-concentration carbon dioxide-tolerant Synechococcus microcarpa, its preparation method, and its applications. It utilizes the CRISPR / dCas9 transcriptional regulation system to optimize the microalgal photosynthetic carbon fixation pathway, thereby improving the growth and carbon fixation efficiency of microalgae under high CO2 concentrations. The specific technical solution is as follows:

[0006] The first objective of this invention is to provide a Synechococcus species resistant to high concentrations of carbon dioxide, comprising a CRISPR / dCas9 plasmid, a PEPCgRNA plasmid, and a knockout ω plasmid.

[0007] The CRISPR / dCas9 plasmid is formed by integrating the exogenous gene fragment 7942dCas9-ω subunit expression cassette into the Synechococcus pANS-pUC19 free plasmid;

[0008] The PEPCgRNA plasmid is formed by integrating the exogenous gene fragment PEPCgRNA into the Synechococcus pANS-pUC19 free plasmid;

[0009] The knockout ω plasmid replaces the ω subunit with chloramphenicol resistance through homologous recombination.

[0010] CRISPR (clustered regularly interspaced short palindromic repeats) is a genetically adaptive immune system within the cells of organisms such as bacteria. Bacteria can use this system to defend against invading DNA. It is mainly composed of crRNA (CRISPR RNA) and the corresponding Cas (CRISPR-associated) protein. Cas9 is an RNA-guided double-stranded DNA nuclease involved in CRISPR-Cas immune defense against prokaryotic viruses. CRISPR / dCas9 is a system with transcriptional regulatory functions obtained by modifying the Cas9 protein in the CRISPR / Cas9 system into dCas9 (catalytically dead Cas9). Compared to the CRISPR / Cas9 system, the CRISPR / dCas9 system has the characteristic of binding to the target site without cleaving DNA. By utilizing dead Cas9 (dCas9), which retains DNA-binding activity but loses nuclease activity, a CRISPR activation (CRISPRa) system can be established in cyanobacteria to activate gene transcription. Transcriptional activation of PEPC via the CRISPR / dCas9 system enables PCC7942 to grow under high CO2 conditions. Furthermore, fusion of the RNAP ω subunit with a Cas9 nuclease mutant that binds to the upstream promoter region allows for programmable transcriptional activation. By knocking out the ω subunit, the CRISPR / dCas9 transcriptional regulation system can optimize the microalgal photosynthetic carbon fixation pathway, thereby enhancing microalgal growth and carbon fixation efficiency under high CO2 conditions.

[0011] Furthermore, the gene sequence of the 7942dCas9-ω subunit expression cassette is shown in SEQ ID NO.3.

[0012] Furthermore, the PEPCgRNA gene sequence is shown in SEQ ID NO.6.

[0013] Furthermore, homologous arms from both ends of the BamH1 restriction site on plasmid pANS-pUC19 were added before and after the PEPCgRNA gene sequence, and the plasmid was inserted into the BamH1 restriction site through homologous recombination.

[0014] Furthermore, the homologous arm gene sequences at both ends of the BamH1 restriction site are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0015] Furthermore, the ω subunit gene sequence is shown in SEQ ID NO.5.

[0016] Furthermore, the ω subunit is knocked out via the ω subunit homologous arm, the gene sequence of which is shown in SEQ ID NO.9.

[0017] Furthermore, the CRISPR / dCas9 plasmid is stored in E. coli and carries the Kan resistance gene; the PEPCgRNA plasmid is stored in E. coli and carries Amp resistance; and the knockout ω plasmid is stored in E. coli and carries Chl resistance.

[0018] The second objective of this invention is to provide a method for preparing the above-mentioned Synechococcus toxicus resistant to high concentrations of carbon dioxide, by using a natural transformation method to transfer the CRISPR / dCas9 plasmid, PEPCgRNA plasmid, and knockout ω plasmid into Synechococcus toxicus 7942.

[0019] The third objective of this invention is to provide the application of the above-mentioned Synechococcus faecium, which is resistant to high concentrations of carbon dioxide, in the growth of high concentrations of CO2 and in improving carbon fixation efficiency.

[0020] The beneficial effects of this invention are as follows:

[0021] This invention enables PCC7942 to grow under high CO2 conditions by activating PEPC transcriptionally through the CRISPR / dCas9 system. Furthermore, the fusion of the RNAP ω subunit with a Cas9 nuclease mutant that binds to the upstream promoter region allows for programmable transcriptional activation. By knocking out the ω subunit, the CRISPR / dCas9 transcriptional regulation system optimizes the microalgal photosynthetic carbon fixation pathway, enhancing microalgal growth and carbon fixation efficiency under high CO2 conditions. Attached Figure Description

[0022] Figure 1 This is the gene map of the free plasmid pANS-pUC19 from Synechococcus in this invention;

[0023] Figure 2 This invention is 7942 dCas9 Transformer;

[0024] Figure 3 This invention is 7942 dCas9 Transformant PCR verification;

[0025] Figure 4 This invention is 7942 dCas9 / Transformer;

[0026] Figure 5 This invention is 7942 dCas9 / Transformant PCR verification;

[0027] Figure 6 This invention is 7942dCas9 -PEPCgRNA transformant;

[0028] Figure 7 This invention is 7942 dCas9 -PEPCgRNA transformants were validated by PCR.

[0029] Figure 8 This invention is 7942 dCas9 / -PEPCgRNA transformant;

[0030] Figure 9 This invention is 7942 dCas9 / -PEPCgRNA transformants were validated by PCR.

[0031] Figure 10 The present invention induces 7942 copper ions at different concentrations. dCas9 Line graph;

[0032] Figure 11 This is a graph showing the effect of knocking out the rpoZ gene on algae in this invention.

[0033] Figure 12 This is a growth curve of WT and transformants under air conditions according to the present invention;

[0034] Figure 13 This is a growth curve of WT and transformants under 5% CO2 conditions according to the present invention;

[0035] Figure 14 This is a growth curve of WT and transformants under 10% CO2 conditions according to the present invention;

[0036] Figure 15 This is a growth curve of WT and transformants under 15% CO2 conditions according to the present invention;

[0037] Figure 16 This is a diagram showing changes in gene expression in this invention.

[0038] Figure 17 This is a PEPC enzyme activity diagram of the present invention. Detailed Implementation

[0039] The principles and features of the present invention are described below with reference to embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0040] By designing and constructing synthetic CRISPR / dCas9 plasmids, PEPCgRNA plasmids, and knockout ω plasmids

[0041] (1) Design and construction of synthetic CRISPR / dCas9 plasmids

[0042] The exogenous gene fragment 7942dCas9-ω subunit expression cassette (standard gene synthesis performed by Qingke Company) was integrated into the Synechococcus pANS-pUC19 free plasmid (e.g. Figure 1 The CRISPR / dCas9 plasmid was obtained from the sample (shown). The exogenous gene fragment 7942dCas9-ω subunit expression cassette is linked to the ω subunit (…). rpoZ The gene encoding (231 bp) is a transcriptional activator of CRISPR / dCas9, derived from the wild-type (WT) Synechococcus 7942, and is a component of RNA polymerase. The 7942dCas9-ω subunit expression cassette (7978 bp) contains the 7942dCas9 subunit expression cassette (dCas9) (4104 bp), which requires codon optimization into the Synechococcus 7942pANS-pUC19 free plasmid. It needs to be ligated to the BamH1 restriction site on the provided plasmid pANS-pUC19 to overcome the problem of low expression efficiency of exogenous genes in host cells, thereby improving protein expression levels, correct folding rate, and functional activity.

[0043] In particular, the 7942dCas9-ω subunit expression cassette (7978 bp) sequence was augmented with homologous arms from both ends of the BamH1 restriction site on plasmid pANS-pUC19.

[0044] SEQ ID NO.1: AGTGAATTCGAGCTCGGTACCCGGG;

[0045] SEQ ID NO.2: GATCCTCTAGAGTCGACCTGCAGGC;

[0046] The sequence can be directly inserted into the site by homologous recombination.

[0047] The gene sequence of the 7942dCas9-ω subunit expression cassette is shown in SEQ ID NO.3;

[0048] The dcas9 (4104 bp) gene sequence is shown in SEQ ID NO.4;

[0049] The ω subunit (231 bp) gene sequence is shown in SEQ ID NO.5;

[0050] The CRISPR / dCas9 plasmid, containing the Kan resistance gene, is stored in *E. coli*. Therefore, Kan antibiotics are added before bacterial activation. This large exogenous gene fragment is a copper-inducible promoter, thus copper-deficient medium is required during transformation and mutant selection. The mutant strain can be expressed in the CRISPR / dCas9 system by adding copper ions.

[0051] (2) Design and construction of synthetic PEPCgRNA plasmid

[0052] The exogenous gene fragment PEPCgRNA (synthesized using standard gene synthesis by Qingke Company) was integrated into the Synechococcus pANS-pUC19 free plasmid to obtain the PEPCgRNA (pANS19-PEPCgRNA) plasmid. The 7942 PEPCgRNA (227 bp) does not require codon optimization. It needs to be ligated to the BamH1 restriction site on the pANS-pUC19 plasmid.

[0053] The PEPCgRNA sequence was augmented with homologous arms from both ends of the BamH1 restriction site on plasmid pANS-pUC19.

[0054] SEQ ID NO.1: AGTGAATTCGAGCTCGGTACCCGGG;

[0055] SEQ ID NO.2: GATCCTCTAGAGTCGACCTGCAGGC;

[0056] The sequence can be directly inserted into the site by homologous recombination.

[0057] The PEPCgRNA (with homologous arms) gene sequence is shown in SEQ ID NO. 6;

[0058] The pANS19-PEPCgRNA gene sequence is shown in SEQ ID NO.7;

[0059] The PEPCgRNA plasmid is preserved in E. coli and carries Amp resistance.

[0060] (3) Knockout of ω plasmid

[0061] The endogenous gene fragment (ω subunit) was derived from Synechococcus 7942. The ω subunit was knocked out through homologous arms, and the sequence was replaced by chloramphenicol resistance through homologous recombination.

[0062] The ω-knockout plasmid was preserved in E. coli, and the plasmid with the ω subunit knocked out carried Chl resistance.

[0063] The gene sequence of the knockout ω plasmid (7942rpozup-chl-7942rpozdown) of the plasmid that replaces the ω subunit of chloramphenicol resistance is shown in SEQ ID NO.8;

[0064] The gene sequences of the ω subunit homologous arms are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0065] Example:

[0066] The plasmids described above were transformed into Synechococcus 7942 (7942WT) using natural transformation. The CRISPR / dCas9 plasmid was then introduced, the ω subunit was knocked out, and then the PEPCgRNA plasmid was introduced. In other words, 7942WT was transformed with dCas9 protein, the ω subunit was knocked out, and PEPCgRNA was introduced; this plasmid is denoted as 7942. dCas9 / -gRNA.

[0067] (1) Two days before transformation, in the algal solution cultured to the logarithmic growth phase (OD) 750 =0.6-0.8) Add EDTA to a final concentration of 2mM.

[0068] (2) Take 30 mL of Synechococcus 7942 in the logarithmic growth stage, put it into a 50 mL centrifuge tube, and enrich it multiple times; centrifuge at 4000 rpm for 5 min, and then discard the supernatant to collect the algae at the bottom of the centrifuge tube.

[0069] (3) Add 10 mL of copper-deficient BG-11 liquid to wash and resuspend it; centrifuge at 4000 rpm for 5 min and discard the supernatant.

[0070] (4) Repeat step (3) once.

[0071] (5) Add 10 mL of 10 mM NaCl to resuspend, centrifuge at 4000 rpm for 5 min, and discard the supernatant.

[0072] (6) Add copper-deficient BG-11 liquid culture medium to resuspend it, and then suspend it in the newly prepared copper-deficient BG-11 culture medium.

[0073] (7) Add 100 μL of algal solution to a 1.5 or 2 mL centrifuge tube, add plasmid to make the final plasmid concentration 5 μg, and mix gently. Incubate in the dark for 16-18 h.

[0074] (8) Transfer to copper-deficient BG-11 solid medium with resistance and continue to culture in an incubator until the appearance of transformant single algal colonies is seen.

[0075] Comparative Example 1:

[0076] Compared to the previous example, only the CRISPR / dCas9 plasmid was transferred into Synechococcus 7942, that is, dCas9 protein was transferred into 7942WT, denoted as 7942. dCas9 .

[0077] Comparative Example 2:

[0078] Compared to the previous example, only the CRISPR / dCas9 plasmid was transferred, and the ω subunit in PCC7942 was knocked out. That is, dCas9 protein was transferred into 7942WT and the ω subunit was knocked out, denoted as 7942. dCas9 / .

[0079] Comparative Example 3:

[0080] Compared to the previous example, the CRISPR / dCas9 plasmid and PEPCgRNA plasmid were transformed into 7942WT, specifically dCas9 protein and PEPCgRNA were transformed into the same plasmid. dCas9 -gRNA.

[0081] Validation of transformants

[0082] (1) Streaking a monoclonal algae onto a solid culture medium containing antibiotics;

[0083] (2) Pass the transformation through four consecutive generations to obtain a stable transformant;

[0084] (3) Use an inoculation loop to pick the transformants into a six-well plate containing 2 mL of copper-deficient BG11 liquid medium;

[0085] (4) Inoculate at 10% of the culture medium volume, and gradually scale up to 10 mL, 50 mL, and 300 mL;

[0086] (5) Centrifuge to collect algal solution and extract transformant genome: Take 10 ml of algal solution, centrifuge at 4000 rpm for 10 min, add water to resuspend and transfer to a 2 mL centrifuge tube; then centrifuge at 12000 rpm for 2 min, discard the supernatant, add 400 μL of Elution Buffer to the tube for resuspension. Add 350 μL of SiO2, then add 400 μL of DNA extraction buffer and DNA extraction phenol reagent, vortex for 10 min. Centrifuge at 12000 rpm for 10 min, collect the supernatant to a 1.5 mL centrifuge tube, add an equal volume of DNA extraction buffer, vortex for 2 min. Centrifuge at 12000 rpm for 2 min, separate the layers, collect the supernatant to another centrifuge tube, add 1 mL of isopropanol and mix well, then settle overnight at -20 ℃. Remove the sample and allow it to come to room temperature. Centrifuge at 12,000 rpm for 10 min, discard the supernatant, add 70 v% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 10 min, discard the supernatant, and dry the sample. Add 50 μL of Elution Buffer.

[0087] (6) Using genomic DNA as a template, PCR verification is performed. If the band size is correct, the gel is recovered and sent for testing to verify whether the sequence is correct.

[0088] The results are shown in the figure:

[0089] Figure 2 7942 dCas9 Transformants selected from 7942WT of dCas9 protein were screened. Figure 3 The results were validated by PCR for the transformants. The dCas9 transformants were analyzed by electrophoresis. The results showed that lane 1 contained a band of wild-type *Synechococcus*, serving as a negative control. Lane 2 contained a band of the positive control, and lane 3 contained a single colony of the dCas9 transformant. The selected transformants showed a distinct band around 8000 bp.

[0090] Figure 4 7942 dCas9 / Transformants selected from 7942WT cells after incorporation of dCas9 protein and knockout of the ω subunit. Figure 5 The results were validated by PCR. Transformants with 7942WT protein transformed into dCas9 protein and rpoz knockout were subjected to electrophoresis. The electrophoresis results showed that lane 1 was the negative control band, lane 2 was the positive control band, and lanes 3-4 were single colonies of rpoz knockout transformants. The selected transformants all showed distinct bands around 3000 bp.

[0091] Figure 6 7942 dCas9 Transformants selected from PEPCgRNA (7942WT of dCas9 protein followed by PEPCgRNA) Figure 7 The results were validated by PCR. Transformants transformed with dCas9 protein and then PEPCgRNA from 7942WT cells were analyzed by electrophoresis. The electrophoresis results showed that lanes 1-5 contained single colonies of transformants transformed with PEPCgRNA. One selected transformant showed a distinct band around 500 bp.

[0092] Figure 8 7942 dCas9 / Transformants selected from PEPCgRNA (7942WT cells transfected with dCas9 protein knocked out ω subunit and then transfected with PEPCgRNA) Figure 9 The gel image was used to verify the PCR results of the transformants. Transformants from 7942WT cells, in which the ω subunit of dCas9 protein was knocked out and PEPCgRNA was introduced, were subjected to electrophoresis. The results showed that lanes 1-9 contained single colonies of transformants containing PEPCgRNA. The selected transformants showed a distinct band around 500 bp.

[0093] The growth indicators of each mutant strain were measured.

[0094] (1) Verify the effect of transferring to the CRISPR / dCas9 system on algae

[0095] To the Control group, Aggregatibacter 7942 (7942WT), 7942 dCas9 Adding different concentrations of Cu to the algal strain 2+ The expression of 7942 was induced by the CRISPR / dCas9 system. The results showed that different concentrations of copper ions induced expression. dCas9 The lack of significant growth changes indicates that the CRISPR / dCas9 system has a relatively weak toxic effect on algae.

[0096] (2) Verification of knockout of ω subunit ( rpoZ The influence of genes on algal strains

[0097] Determination of Synechococcus 7942 (7942WT), 7942 dCas9 7942 dCas9 / The growth curve of the algal strain, such as Figure 11 As shown, 7942WT grows better than 7942. dCas9 Better than 7942 dCas9 / This indicates that introducing dCas9 into 7942WT will affect algal growth, and knocking out... rpoZ Genes can also affect the growth of algae.

[0098] (3) Prepare copper-deficient culture medium by mixing wild-type Synechococcus 7942 and Synechococcus 7942 transformed with dCas9 and PEPCgRNA. dCas9 -PEPCgRNA) and Synechococcus 7942 (7942) transfected with dCas9 and PEPCgRNA and with the ω subunit knocked out. dCas9 / Centrifuge at 5000 rpm for 10 min, discard the supernatant, and wash twice with copper-deficient medium. Add copper sulfate stock solution to the copper-deficient medium to ensure that Cu... 2+ The final concentration was 300 nM. Different volumes of algal solution were added to 300 mL of copper-deficient and copper-added culture medium. The OD values ​​of the algae were measured using a microplate reader, ranging from 0.03 to 0.04. Six replicates were prepared, each 50 mL, and the OD750 of the algae were measured under air conditions of 5 v% CO2, 8 v% CO2, 10 v% CO2, and 15 v% CO2. Growth curves were then constructed. The growth of wild-type 7942 algae was measured under air conditions of 5 v% and 10 v% CO2. dCas9 7942 dCas9 / 7942 dCas9 -PEPCgRNA, 7942 dCas9 / - Growth curve of PEPCgRNA.

[0099] like Figure 12-15 As shown, the results indicate that with increasing CO2 concentration, 7942 dCas9 / -PEPCgRNA biomass was higher than that of wild-type 7942. dCas9 7942 dCas9 / 7942 dCas9 -PEPCgRNA. This indicates that transcriptional activation of PEPC in Synechococcus PCC 7942 via the CRISPR / dCas9 system can improve its growth under high CO2 concentrations, and knocking out the ω subunit can further improve the transcriptional activation efficiency.

[0100] RNA extraction and cDNA synthesis from Synechococcus.

[0101] 7942WT was collected under high concentration CO2 (8v%) conditions. dCas9 -PEPCgRNA, 7942 dCas9 / -PEPCgRNA was extracted from algal cultures on days 6, 8, and 10, yielding 7942 WT. dCas9 -PEPCgRNA, 7942 dCas9 / -PEPCgRNA RNA.

[0102] (1) Collect about 50 mL of algal solution in the logarithmic growth phase by centrifugation, centrifuge at 8000 rpm for 5 min, and discard the supernatant of the old culture medium;

[0103] (2) Add 5 mL of fresh copper-deficient BG11 medium, wash the precipitate by pipetting, centrifuge at 8000 rpm for 5 min at 4℃, discard the supernatant, absorb the liquid with absorbent paper, and freeze quickly with liquid nitrogen.

[0104] (3) Spray RNase and nucleic acid remover on the table and mortar. After about 5 minutes, wipe the table with a clean paper towel or alcohol wipe to create an experimental environment free of RNase and nucleic acid template.

[0105] (4) Grind an appropriate amount of algal precipitate in a mortar pre-cooled with liquid nitrogen without RNase treatment;

[0106] (5) The ground algal powder was collected in a 1.5 mL centrifuge tube without RNase, and 500 μL of RNA-easy solution was added and vortexed to mix.

[0107] (6) Add 200 μL of DEPC water to the centrifuge tube, mix by inverting, and let stand at room temperature for 5 min.

[0108] (7) Centrifuge at 12000 rpm for 15 min, remove the upper aqueous phase and transfer it to a new centrifuge tube;

[0109] (8) Add an equal volume of pre-cooled isopropanol, mix well and let stand for 30 min;

[0110] (9) Centrifuge at 12000 rpm for 15 min and discard all supernatant;

[0111] (10) Add 500 μL of 75% ethanol, wash the precipitate twice, and air dry the liquid;

[0112] (11) Add 50 μL of DEPC water to dissolve the RNA precipitate, aliquot it and store it in a -80℃ freezer.

[0113] RNA reverse transcription

[0114] Mix the solutions in RNase-free microcentrifuge tubes according to Table 1.1, and gently pipette to mix. Incubate at 42°C for 2 min.

[0115] Table 1.1 RNA template denaturation system

[0116]

[0117] Collect the reaction solution at the bottom of the centrifuge tube by brief centrifugation, add reagents according to Table 1.2, and mix well by pipetting. Precisely control the temperature in the PCR instrument at 50 ℃ for 15 min and 85 ℃ for 5 s. After aliquoting, store at -80 ℃.

[0118] Table 1.2 First-strand cDNA Reaction Synthesis

[0119]

[0120] Real-time PCR

[0121] (1) qPCR primers were designed based on the reference sequence of the genome of Synechocystis. The primers were synthesized by Qingke Biotechnology Co., Ltd. and purified by PAGE. The reaction system was prepared by adding samples according to Table 2.3 qPCR system into sterile enzyme-free PCR tubes and then performing real-time PCR according to Table 2.4.

[0122] Table 2.3 qPCR system sample loading table

[0123]

[0124] Table 2.4 qPCR reaction procedure

[0125]

[0126] The RT-qPCR results were normalized, with the wild-type gene expression level set to 1, to obtain the fold change in expression of the transformant relative to the wild-type, as shown below. Figure 16 As shown, Figure 16 As can be seen from this, under high CO2 concentration conditions, 7942 dCas9 / -PEPCgRNA and 7942 dCas9 -PEPCgRNA showed higher RNA transcription levels of PEPC than the wild-type 7942.

[0127] Phosphoenolpyruvate carboxylase activity (PEPC) assay

[0128] Phosphoenolpyruvate carboxylase activity (PEPC) was determined using an enzyme-linked immunosorbent assay (ELISA).

[0129] (1) Kit (phosphoenolpyruvate carboxylase activity assay kit, Nanjing Jiancheng, catalog number: A130-1-1) Equilibrate the reagents at room temperature for 15-30 min. Dilute the standard according to the kit instructions. The standard is diluted to 200 U / L, 100 U / L, 50 U / L, 25 U / L and 12.5 U / L respectively. The CA enzyme standard is diluted to 120 U / L, 60 U / L, 30 U / L, 15 U / L and 7.5 U / L respectively.

[0130] (2) Set up blank wells, standard wells and sample wells respectively, and accurately add 50 μL of sample to the microplate (40 μL sample diluent plus 10 μL sample to be tested), and gently shake to mix.

[0131] (3) After sealing with sealing film, at 37 o Incubate at C for 30 min;

[0132] (4) Incubate the concentrated washing solution in warm water to aid dissolution, and then dilute the concentrated washing solution 30 times before use;

[0133] (5) Discard the liquid and shake it dry. Fill the hole with washing liquid, let it stand for 30 minutes and then discard it. Repeat 5 times and pat dry.

[0134] (6) Add 50 μL of enzyme-labeled reagent to all wells except the blank well;

[0135] (7) Repeat steps 3 and 4;

[0136] (8) Add 50 μL of colorimetric reagent A and 50 μL of colorimetric reagent B to each well in sequence, shake to mix, and incubate at 37°C. o C. Develop color in the dark for 10 minutes;

[0137] (9) Add 50 μL of stop solution to all wells. The blue color will immediately turn yellow.

[0138] (10) Within 15 min after termination, zero the blank wells and measure the absorbance of each well at 450 nm. Calculate the enzyme activity based on the standard curve and protein concentration.

[0139] from Figure 17 It can be seen from the high concentration of CO2 that 7942 dCas9 / -PEPCgRNA has a PEPC enzyme activity higher than 7942. dCas9 -PEPCgRNA and 7942 wild type.

[0140] In summary, the results indicate that transcriptional activation of PEPC via the CRISPR / dCas9 system enables PCC7942 to grow under high CO2 conditions. Knocking out the ω subunit further enhances the transcriptional activation effect and, from the perspective of enzyme activity, is also more conducive to the photosynthesis and carbon fixation of PCC7942.

[0141] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A type of Synechococcus aureus resistant to high concentrations of carbon dioxide, characterized in that, This includes CRISPR / dCas9 plasmids, PEPCgRNA plasmids, and knockout ω plasmids; The CRISPR / dCas9 plasmid is formed by integrating the exogenous gene fragment 7942dCas9-ω subunit expression cassette into the Synechococcus pANS-pUC19 free plasmid; The PEPCgRNA plasmid is formed by integrating the exogenous gene fragment PEPCgRNA into the Synechococcus pANS-pUC19 free plasmid; The knockout ω plasmid is achieved by replacing the ω subunit with chloramphenicol resistance through homologous recombination; In Synechococcus 7942 (7942WT), a CRISPR / dCas9 plasmid was introduced to knock out the ω subunit, followed by the introduction of a PEPCgRNA plasmid. In other words, 7942WT was denoted as 7942 after the dCas9 protein was introduced to knock out the ω subunit and then PEPCgRNA was introduced. dCas9 / -gRNA; The gene sequence of the 7942dCas9-ω subunit expression cassette is shown in SEQ ID NO.3; The dcas9 (4104 bp) gene sequence is shown in SEQ ID NO.4; The ω subunit (231 bp) gene sequence is shown in SEQ ID NO.5; The PEPCgRNA (with homologous arms) gene sequence is shown in SEQ ID NO.

6.

2. The Synechococcus hydrophila resistant to high concentrations of carbon dioxide according to claim 1, characterized in that, The PEPCgRNA gene sequence was augmented with homologous arms at both ends of the BamH1 restriction site on plasmid pANS-pUC19, and the plasmid was inserted into the BamH1 restriction site through homologous recombination.

3. The Synechococcus hydrophila resistant to high concentrations of carbon dioxide according to claim 2, characterized in that, The homologous arm gene sequences at both ends of the BamH1 restriction site are shown in SEQ ID NO.1 and SEQ ID NO.

2.

4. The Synechococcus hydrophila tolerant to high concentrations of carbon dioxide according to claim 1, characterized in that, The ω subunit is knocked out via the ω subunit homologous arm, the gene sequence of which is shown in SEQ ID NO.

9.

5. The Synechococcus hydrophila tolerant to high concentrations of carbon dioxide according to claim 1, characterized in that, The CRISPR / dCas9 plasmid is stored in E. coli and carries the Kan resistance gene; the PEPCgRNA plasmid is stored in E. coli and carries Amp resistance; the knockout ω plasmid is stored in E. coli and carries Chl resistance.

6. A method for preparing Synechococcus hydrophila tolerant to high concentrations of carbon dioxide as described in any one of claims 1-5, characterized in that, CRISPR / dCas9 plasmid, gRNA plasmid, and knockout ω plasmid were transformed into Synechococcus 7942 using natural transformation.

7. The application of Synechococcus as described in any one of claims 1-5 in the growth of Synechococcus under high concentration CO2 and in improving carbon fixation efficiency.

Images