A reagent combination or kit for constructing an intestinal organoid and use thereof

By using a specific combination of culture medium and growth factors, epithelial cells are induced to differentiate into intestinal organoids, solving the problems of time-consuming, complex, and high-risk generation of intestinal organoids in existing technologies, and providing an efficient research model for intestinal diseases.

CN120555324BActive Publication Date: 2026-03-24GUANGZHOU NAT LAB
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410222975.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-02-28
Publication Date
2026-03-24
Estimated Expiration
2044-02-28

AI Technical Summary

Technical Problem

Existing technologies are difficult to generate intestinal organoids from human pluripotent stem cells efficiently and non-invasively, and there is a risk of tumor development. Furthermore, in vitro regeneration of intestinal tissue is time-consuming and complex.

Method used

Using specific combinations of culture media and growth factors, epithelial cells were induced to produce endoderm progenitor cells and intestinal organoids. This included the use of DNA methyltransferase inhibitors, histone demethylation inhibitors, TGF-β activators, phosphatidylinositol 3-kinase (PI3K) inhibitors, EZH2 inhibitors, and histone deacetylation inhibitors, combined with different culture media and growth factors, to gradually induce epithelial cells to differentiate into intestinal organoids.

Benefits of technology

This technology enables the non-invasive induction of intestinal organoids from epithelial cells, simplifying the generation process, reducing tumor risk, and providing an efficient research model for intestinal diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004718707760000011
    Figure HDA0004718707760000011
  • Figure HDA0004718707760000021
    Figure HDA0004718707760000021
  • Figure HDA0004718707760000031
    Figure HDA0004718707760000031
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and discloses a reagent combination or kit for constructing an intestinal organoid and application thereof. The reagent combination or kit can obtain an intestinal organoid from donor-derived epithelial cells in a non-invasive manner, the obtained intestinal organoid can be frozen and recovered, and can be long-term expanded in vitro; the transcriptome characteristics are similar to those of real human small intestinal tissues, and a plurality of typical marker genes of small intestinal lineage cell types are highly expressed; compared with an intestinal organoid induced by pluripotent stem cells, the intestinal organoid is more characteristic of an intestinal lineage, and the intestinal function development is more mature; after the intestinal organoid is promoted to be mature, genes related to drug absorption and metabolism are also highly expressed, the intestinal organoid has similar drug absorption capacity to an immortalized intestinal cell line, but more outstandingly shows intestinal cell lineage characteristics, and is closer to a real intestinal environment in a human body, and can be used for intestinal disease drug screening; and has an intestinal barrier function.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a reagent combination or kit for constructing intestinal organoids and its application. Background Technology

[0002] Three-dimensional organoids cultured in vitro can reconstruct the structure, organization, and function of in vivo tissues, making them an ideal platform for studying development and disease. The intestinal epithelium is a highly dynamic layer of columnar cells that isolates intestinal contents from host matter and performs several important functions, such as nutrient absorption, regulation of the mucosal immune system, and control of intestinal permeability. Dysfunction of the intestinal epithelium is associated with various intestinal diseases, including inflammatory bowel disease, celiac disease, and cystic fibrosis. Therefore, in vitro regeneration of intestinal organoids is crucial for studying intestinal diseases. In the field of biomedical research, there have been reports of intestinal organoids generated from primary LGR5+ stem cells (Sato, T. et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature, (2009).). However, obtaining sufficient normal tissue to generate large-scale human intestinal tissue for clinical applications is not easy and involves a degree of invasiveness. Therefore, the development of methods for generating intestinal organoids (P-iIOs) from human pluripotent stem cells (Mithal, A. et al. Human Pluripotent Stem Cell-Derived Intestinal Organoids Model SARS-CoV-2 Infection Revealing a Common Epithelial Inflammatory Response. Stem Cell Reports, (2021).) provides a valuable in vitro model for research. However, these differentiation processes are both time-consuming and complex, and the differentiation of human pluripotent stem cells may be incomplete, leading to the risk of tumor development. Therefore, it is necessary to find non-invasive methods to obtain starting cells and develop transformation protocols that bypass the pluripotency stage to induce the generation of intestinal organoids. Further research and exploration will contribute to the development of personalized disease modeling and drug screening. Summary of the Invention

[0003] The first aspect of this invention is to provide a reagent combination or kit for inducing epithelial cells to produce endodermal progenitor cells or intestinal organoids.

[0004] The second aspect of the present invention aims to provide the application of the reagent combination or kit of the first aspect.

[0005] A third aspect of the present invention aims to provide a method for inducing epithelial cells to produce endoderm progenitor cells or intestinal organoids.

[0006] The fourth aspect of this invention is to provide a method for culturing intestinal organoids.

[0007] The fifth aspect of this invention aims to provide a method for promoting the maturation of intestinal organs.

[0008] The sixth aspect of this invention is to provide an intestinal organoid.

[0009] The seventh aspect of this invention is to provide the application of the intestinal organoids of the sixth aspect of this invention.

[0010] The object of the eighth aspect of the present invention is to provide a product.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0012] A first aspect of the present invention provides a reagent combination or kit comprising a second culture medium;

[0013] The second culture medium is a basal medium containing DNA methyltransferase inhibitors, histone demethylation inhibitors, TGF-β activators, phosphatidylinositol 3-kinase (PI3K) inhibitors, EZH2 inhibitors, and histone deacetylation inhibitors.

[0014] Preferably, the second culture medium is used to induce pre-segmental mesodermal progenitor cells (UiPSM) to produce endoderm progenitor cells (UiEPC).

[0015] Preferably, the DNA methyltransferase inhibitor in the second culture medium comprises one or more of RG108, Decitabine, and SGI-1027; more preferably, it is RG108.

[0016] Preferably, the histone demethylation inhibitor in the second culture medium comprises one or more of transphenylcyclopropane, GSK2879, LSD-C76, S2101, and RN1; more preferably, transphenylcyclopropane.

[0017] Preferably, the TGF-β activator in the second culture medium comprises one or more of TGF-β and activator A; more preferably, it is activator A.

[0018] Preferably, the phosphatidylinositol 3-kinase (PI3K) inhibitor in the second culture medium comprises one or more of PIK-90 and LY294002; more preferably LY294002.

[0019] Preferably, the EZH2 inhibitor in the second culture medium comprises one or more of EPZ6438, EPZ011989, EBI-2511, EPZ5676, EPZ005687, GSK343, UNC 1999, GSK126, GSK503, EI1, and PF-06726304; more preferably, EPZ011989.

[0020] Preferably, the histone deacetylation inhibitor in the second culture medium comprises at least one of VPA, MS-275, SAHA, LBH589, TSA, MGCD0103, MC1568, LAQ824, PCI-34051, RGFP966, AR-42, CI994, sodium butyrate, M344, Tubacin, Scriptaid, Tubastatin A, and LMK235; more preferably, sodium butyrate.

[0021] Preferably, the concentration of the DNA methyltransferase inhibitor in the second culture medium is 0.05–5 μM; more preferably 0.4–0.6 μM; and even more preferably 0.5 μM.

[0022] Preferably, the concentration of the histone demethylation inhibitor in the second culture medium is 0.2–10 μM; more preferably 1.8–2.2 μM; and even more preferably 2 μM.

[0023] Preferably, the concentration of the TGF-β activator in the second culture medium is 10–150 ng / mL; more preferably 90–110 ng / mL; and even more preferably 100 ng / mL.

[0024] Preferably, the concentration of the phosphatidylinositol 3-kinase (PI3K) inhibitor in the second culture medium is 0.2–15 μM; more preferably 1.8–2.2 μM; and even more preferably 2 μM.

[0025] Preferably, the concentration of the EZH2 inhibitor in the second culture medium is 0.05–8 μM; more preferably 0.8–1.2 μM; and even more preferably 1 μM.

[0026] Preferably, the concentration of the histone deacetylation inhibitor in the second culture medium is 10–180 μM; more preferably 80–120 μM; and even more preferably 100 μM.

[0027] Preferably, the reagent combination or kit further comprises a first culture medium;

[0028] The first culture medium is a basal culture medium containing GSK3β inhibitor, growth factor, and DOT1L inhibitor.

[0029] Preferably, the first culture medium is used to induce epithelial cells to produce presegmental mesodermal progenitor cells (UiPSM).

[0030] Preferably, the GSK3β inhibitor in the first culture medium comprises one or more of GSK3β inhibitor IX, SB216763, GSK3β inhibitor VII, L803-mts, 6-bromo-indirubin-3'-oxime, TWS119, AZD2858, AR-A014418, TDZD-8, LY2090314, 2-D08, IM-12, 1-Azakenpaullone, Indirubin, and CHIR99021; more preferably CHIR99021.

[0031] Preferably, the growth factors in the first culture medium include one or more of epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), insulin-like growth factor-I (IGF-1), IGF-II, leukemia inhibitory factor (LIF), nerve growth factor (NGF), oncogene M (OSM), platelet-derived endothelial growth factor (PDECGF), transforming growth factor-α (TGF-α), and vascular endothelial growth factor (VEGF); further includes one or more of epidermal growth factor (EGF) and fibroblast growth factor (FGF); and even more specifically, epidermal growth factor (EGF) and fibroblast growth factor (FGF).

[0032] Preferably, the mass ratio of epidermal growth factor (EGF) to fibroblast growth factor (FGF) is 1:(0.3-1.5); more preferably 1:1.

[0033] Preferably, the fibroblast growth factor comprises at least one of acidic fibroblast growth factor (aFGF) and basic fibroblast growth factor (bFGF); more preferably, the fibroblast growth factor comprises basic fibroblast growth factor.

[0034] Preferably, the DOT1L inhibitor in the first culture medium comprises one or more of EPZ004777, EPZ5676 and SGC0946; more preferably EPZ5676.

[0035] Preferably, the concentration of the GSK3β inhibitor in the first culture medium is 0.3–20 μM; more preferably 2.5–3.5 μM; and even more preferably 3 μM.

[0036] Preferably, the concentration of the growth factor in the first culture medium is 3-130 ng / mL; more preferably 18-22 ng / mL; and even more preferably 20 ng / mL.

[0037] Preferably, the concentration of the DOT1L inhibitor in the first culture medium is 0.05–10 μM; more preferably 0.8–1.2 μM; and even more preferably 1 μM.

[0038] Preferably, the reagent combination or kit comprises a first culture medium and a second culture medium, the combination or kit being used to induce epithelial cells to produce endodermal progenitor cells (UiEPC).

[0039] Preferably, the reagent combination or kit further comprises a third culture medium;

[0040] The third culture medium is a basal medium containing BMP4 inhibitor, TGFβ / ALK inhibitor, growth factors, GSK3β inhibitor, and SHH agonist.

[0041] Preferably, the third culture medium is used to induce endoderm progenitor cells (UiEPC) to differentiate into hindgut endoderm cells (U-iHE).

[0042] Preferably, the BMP4 inhibitor in the third culture medium comprises one or more of dorsomorphin, Noggin, LDN-193189, follistatin, chordin, gremlin, and DMH1; more preferably, Noggin.

[0043] Preferably, the TGFβ / ALK inhibitor in the third culture medium comprises one or more of SB431542, SB-505, A-83-01, GW6604, IN-1130, Ki26894, LY2157299, LY364947(HTS-466284), LY550410, LY573636, LY580276, NPC-30345, SB-505124, SD-093, Sm16, SM305, SX-007, Antp-Sm2A, and LY2109761; more preferably, SB431542.

[0044] Preferably, the growth factors in the third culture medium include one or more of the following: epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), insulin-like growth factor-I (IGF-1), IGF-II, leukemia inhibitory factor (LIF), nerve growth factor (NGF), oncogene M (OSM), platelet-derived endothelial growth factor (PDECGF), transforming growth factor-α (TGF-α), and vascular endothelial growth factor (VEGF); more preferably, fibroblast growth factor (FGF).

[0045] Preferably, the fibroblast growth factor (FGF) comprises one or more of FGF1, FGF4, FGF7, FGF8, FGF9, FGF10, and FGF19; more preferably, it is FGF4.

[0046] Preferably, the GSK3β inhibitor in the third culture medium comprises one or more of GSK3β inhibitor IX, SB216763, GSK3β inhibitor VII, L803-mts, 6-bromo-indirubin-3'-oxime, TWS119, AZD2858, AR-A014418, TDZD-8, LY2090314, 2-D08, IM-12, 1-Azakenpaullone, Indirubin, and CHIR99021; more preferably CHIR99021.

[0047] Preferably, the SHH agonist in the third culture medium comprises one or more of SHH, SHH C25II, SAG, SAG 21K, Hh-Ag1.5, 20α-hydroxycholesterol, and puromorphamine; more preferably, it is SAG.

[0048] Preferably, the concentration of the BMP4 inhibitor in the third culture medium is 80–300 ng / mL; more preferably 180–220 ng / mL; and even more preferably 200 ng / mL.

[0049] Preferably, the concentration of the TGFβ / ALK inhibitor in the third culture medium is 1–20 μM; more preferably 8–12 μM; and even more preferably 10 μM.

[0050] Preferably, the concentration of the growth factor in the third culture medium is 100–600 ng / mL; more preferably 480–520 ng / mL; and even more preferably 500 ng / mL.

[0051] Preferably, the concentration of the GSK3β inhibitor in the third culture medium is 0.2–100 μM; more preferably 1.8–2.2 μM; and even more preferably 2 μM.

[0052] Preferably, the concentration of the SHH agonist in the third culture medium is 0.05–10 μM; more preferably 0.8–1.2 μM; and even more preferably 1 μM.

[0053] Preferably, the reagent combination or kit comprises a first culture medium, a second culture medium, and a third culture medium, the combination or kit being used to induce epithelial cells to produce hindgut endoderm cells (U-iHE).

[0054] Preferably, the reagent combination or kit further comprises a fourth culture medium;

[0055] The fourth culture medium is a basal culture medium containing GSK3β inhibitors, BMP signaling pathway activators, and nuclear receptor ligands.

[0056] Preferably, the fourth culture medium is used to induce hindgut endoderm cells (U-iHE) to differentiate into intestinal progenitor cells (U-iIP).

[0057] Preferably, the GSK3β inhibitor in the fourth culture medium comprises one or more of GSK3β inhibitor IX, SB216763, GSK3β inhibitor VII, L803-mts, 6-bromo-indirubin-3'-oxime, TWS119, AZD2858, AR-A014418, TDZD-8, LY2090314, 2-D08, IM-12, 1-Azakenpaullone, Indirubin, and CHIR99021; more preferably CHIR99021.

[0058] Preferably, the BMP signaling pathway activator in the fourth culture medium comprises one or more of BMP2, BMP4, SB4, SJ000291942, SJ000063181, SJ000370178, isoliquiritin, geraniol, apigenin, and chickpea sprout extract; more preferably, BMP4.

[0059] Preferably, the nuclear receptor ligand in the fourth culture medium comprises one or more of estradiol, retinoic acid, dexamethasone, clobetasol, androgens, thyroxine, troglitazone, pioglitazone, and prostaglandins; more preferably, retinoic acid.

[0060] Preferably, the concentration of the GSK3β inhibitor in the fourth culture medium is 0.3–13.5 μM; more preferably 3–4 μM; and even more preferably 3.5 μM.

[0061] Preferably, the concentration of the BMP signaling pathway activator in the fourth culture medium is 2–30 ng / mL; more preferably 18–22 ng / mL; and even more preferably 20 ng / mL.

[0062] Preferably, the concentration of the nuclear receptor ligand in the fourth culture medium is 0.05–8.5 μM; more preferably 0.4–0.6 μM; and even more preferably 0.5 μM.

[0063] Preferably, the reagent combination or kit comprises a first culture medium, a second culture medium, a third culture medium, and a fourth culture medium, the combination or kit being used to induce epithelial cells to produce intestinal progenitor cells (U-iIP).

[0064] Preferably, the reagent combination or kit further comprises a fifth culture medium;

[0065] The fifth culture medium is a basal culture medium containing growth factors and GSK3β inhibitors.

[0066] Preferably, the fifth culture medium is used to induce intestinal progenitor cells (U-iIP) to differentiate into intestinal organoids (U-iIO).

[0067] Preferably, the growth factors in the fifth culture medium include one or more of the following: epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), insulin-like growth factor-I (IGF-1), IGF-II, leukemia inhibitory factor (LIF), nerve growth factor (NGF), oncogene M (OSM), platelet-derived endothelial growth factor (PDECGF), transforming growth factor-α (TGF-α), and vascular endothelial growth factor (VEGF); more preferably, fibroblast growth factor (FGF).

[0068] Preferably, the fibroblast growth factor (FGF) comprises one or more of FGF1, FGF4, FGF7, FGF8, FGF9, FGF10, and FGF19; further comprises one or two of FGF7 and FGF10; and even more preferably comprises FGF7 and FGF10.

[0069] Preferably, the mass ratio of FGF7 to FGF10 is 1:(0.8 to 1.2); more preferably, it is 1:1.

[0070] Preferably, the GSK3β inhibitor in the fifth culture medium comprises one or more of GSK3β inhibitor IX, SB216763, GSK3β inhibitor VII, L803-mts, 6-bromo-indirubin-3'-oxime, TWS119, AZD2858, AR-A014418, TDZD-8, LY2090314, 2-D08, IM-12, 1-Azakenpaullone, Indirubin, and CHIR99021; more preferably CHIR99021.

[0071] Preferably, the concentration of the growth factor in the fifth culture medium is 2–200 ng / mL; more preferably 18–22 ng / mL; and even more preferably 20 ng / mL.

[0072] Preferably, the concentration of the GSK3β inhibitor in the fifth culture medium is 0.2–15 μM; more preferably 2.5–3.5 μM; and even more preferably 3 μM.

[0073] Preferably, the reagent combination or kit comprises a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, and a fifth culture medium, the combination or kit being used to induce epithelial cells to produce intestinal organoids (U-iIO).

[0074] Preferably, the reagent combination or kit further comprises a seventh culture medium;

[0075] The seventh culture medium is a basal culture medium containing GSK3β inhibitor, serum, growth factors, and TGFβ / ALK inhibitor.

[0076] Preferably, the seventh culture medium is used to promote the maturation of intestinal organoids (U-iIO).

[0077] Preferably, the GSK3β inhibitor in the seventh culture medium comprises one or more of the following: GSK3β inhibitor IX, SB216763, GSK3β inhibitor VII, L803-mts, 6-bromo-indirubin-3'-oxime, TWS119, AZD2858, AR-A014418, TDZD-8, LY2090314, 2-D08, IM-12, 1-Azakenpaullone, Indirubin, and CHIR99021; more preferably, CHIR99021.

[0078] Preferably, the serum in the seventh culture medium is fetal bovine serum (FBS).

[0079] Preferably, the growth factors in the seventh culture medium include one or more of the following: epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), insulin-like growth factor-I (IGF-1), IGF-II, leukemia inhibitory factor (LIF), nerve growth factor (NGF), oncogene M (OSM), platelet-derived endothelial growth factor (PDECGF), transforming growth factor-α (TGF-α), and vascular endothelial growth factor (VEGF); further, one or more of the following: fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and oncogene M; and even further, fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and oncogene M.

[0080] Preferably, the mass ratio of fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and tumor suppressor M is (1-2.5):(0.25-1):1; more preferably 1:1:1.

[0081] Preferably, the fibroblast growth factor (FGF) comprises one or more of FGF1, FGF4, FGF7, FGF8, FGF9, FGF10, and FGF19; further comprises one or two of FGF7 and FGF10; and even more preferably comprises FGF7 and FGF10.

[0082] Preferably, the mass ratio of FGF7 to FGF10 is 1:(0.3 to 1.5); further, it is 1:(0.8 to 1.2); and even further, it is 1:1.

[0083] Preferably, the TGFβ / ALK inhibitor in the seventh culture medium comprises one or more of SB431542, SB-505, A8301, GW6604, IN-1130, Ki26894, LY2157299, LY364947(HTS-466284), LY550410, LY573636, LY580276, NPC-30345, SB-505124, SD-093, Sm16, SM305, SX-007, Antp-Sm2A, and LY2109761; more preferably, A8301.

[0084] Preferably, the concentration of the GSK3β inhibitor in the seventh culture medium is 1–8 μM; more preferably 2.5–3.5 μM; and even more preferably 3 μM.

[0085] Preferably, the concentration of the serum in the seventh culture medium is 5-15% v / v; more preferably 8-12% v / v; and even more preferably 10% v / v.

[0086] Preferably, the concentration of the growth factor in the seventh culture medium is 7.5–260 ng / mL; more preferably 55–65 ng / mL; and even more preferably 60 ng / mL.

[0087] Preferably, the concentration of the TGFβ / ALK inhibitor in the seventh culture medium is 0.05–5 μM; more preferably 0.4–0.6 μM; and even more preferably 0.5 μM.

[0088] Preferably, the reagent combination or kit comprises a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, a fifth culture medium, and a seventh culture medium, the combination or kit being used to induce epithelial cells to produce intestinal organoids (U-iIO).

[0089] Preferably, the reagent combination or kit further comprises a sixth culture medium;

[0090] The sixth culture medium is a basal medium containing GSK3β inhibitors and growth factors.

[0091] Preferably, the sixth culture medium is used for the culture and / or passage of intestinal organoids (U-iIO).

[0092] Preferably, the GSK3β inhibitor in the sixth culture medium comprises one or more of the following: GSK3β inhibitor IX, SB216763, GSK3β inhibitor VII, L803-mts, 6-bromo-indirubin-3'-oxime, TWS119, AZD2858, AR-A014418, TDZD-8, LY2090314, 2-D08, IM-12, 1-Azakenpaullone, Indirubin, and CHIR99021; more preferably, CHIR99021.

[0093] Preferably, the growth factors in the sixth culture medium include one or more of the following: epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), insulin-like growth factor-I (IGF-1), IGF-II, leukemia inhibitory factor (LIF), nerve growth factor (NGF), oncogene M (OSM), platelet-derived endothelial growth factor (PDECGF), transforming growth factor-α (TGF-α), and vascular endothelial growth factor (VEGF); further, one or more of the following: fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and oncogene M; and even further, fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and oncogene M.

[0094] Preferably, the mass ratio of fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and tumor suppressor M is (1-2):(0.25-1):1; more preferably 1:1:1.

[0095] Preferably, the fibroblast growth factor (FGF) comprises one or more of FGF1, FGF4, FGF7, FGF8, FGF9, FGF10, and FGF19; further comprises one or two of FGF7 and FGF10; and even more preferably comprises FGF7 and FGF10.

[0096] Preferably, the mass ratio of FGF7 to FGF10 is 1:(0.8 to 1.2); more preferably, it is 1:1.

[0097] Preferably, the concentration of the GSK3β inhibitor in the sixth culture medium is 0.5–30 μM; more preferably 2–3 μM; and even more preferably 2.5 μM.

[0098] Preferably, the concentration of the growth factor in the sixth culture medium is 4.5–400 ng / mL; more preferably 55–65 ng / mL; and even more preferably 60 ng / mL.

[0099] Preferably, the reagent combination or kit comprises a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, a fifth culture medium, a sixth culture medium, and a seventh culture medium, the combination or kit being used to induce epithelial cells to produce intestinal organoids (U-iIO) and to culture and / or passage intestinal organoids (U-iIO).

[0100] Preferably, the reagent combination or kit contains any one of a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, a fifth culture medium, a sixth culture medium, and a seventh culture medium, that is, it may contain a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, a fifth culture medium, a sixth culture medium, or a seventh culture medium; the purpose of the reagent combination or kit corresponds to the culture medium.

[0101] Preferably, the basal media of the first, second, third, fourth, fifth, sixth, and seventh media are each independently selected from one or more of IMDM (Iscove's Modified Dulbecco's Medium), Eagle's Basal Medium (BME), MEM, DMEM, Ham's F-12, RPMI 1640, Advanced RPMI 1640, Advanced DF-12 (Advanced DMEM / F-12), and DMEM / F12 media; more preferably, the basal media of the first, second, third, fourth, fifth, sixth, and seventh media are each independently selected from one of Advanced RPMI 1640, Advanced DF-12 (Advanced DMEM / F-12), and DMEM / F12 media.

[0102] Preferably, the basal medium of the first culture medium is Advanced DF-12 medium.

[0103] Preferably, the basal medium of the second culture medium is Advanced RPMI 1640 medium.

[0104] Preferably, the basal medium of the second culture medium is a basal medium containing glutamine (preferably GlutaMAX additive), non-essential amino acids, B27 additive, N2 additive and β-mercaptoethanol.

[0105] Preferably, the concentration of glutamine in the second culture medium is 0.5 to 1.5×; more preferably 1×.

[0106] Preferably, the concentration of the non-essential amino acids in the second culture medium is 0.5 to 1.5 × 10⁻⁶; more preferably, it is 1 × 10⁻⁶.

[0107] Preferably, the concentration of the B27 additive in the second culture medium is 0.5 to 1.5×; more preferably 1×.

[0108] Preferably, the concentration of the N2 additive in the second culture medium is 0.5 to 1.5×; more preferably 1×.

[0109] Preferably, the concentration of β-mercaptoethanol in the second culture medium is 0.05–1 mM; more preferably 0.08–0.12 mM; and even more preferably 0.1 mM.

[0110] Preferably, the basal medium of the third culture medium is DMEM / F-12 medium.

[0111] Preferably, the basal medium of the third culture medium is a basal medium containing glutamine (preferably GlutaMAX additive), B27 additive, N2 additive, vitamin C and thioglycerol.

[0112] Preferably, the concentration of glutamine in the third culture medium is 0.5 to 1.5×; more preferably 1×.

[0113] Preferably, the concentration of the B27 additive in the third culture medium is 0.5 to 1.5×; more preferably 1×.

[0114] Preferably, the concentration of the N2 additive in the third culture medium is 0.5 to 1.5×; more preferably 1×.

[0115] Preferably, the concentration of vitamin C in the third culture medium is 5–100 μg / mL; more preferably 45–55 μg / mL; and even more preferably 50 μg / mL.

[0116] Preferably, the concentration of the thioglycerol in the third culture medium is 0.01–40 mM; more preferably 0.38–0.42 mM; and even more preferably 0.4 mM.

[0117] Preferably, the basal medium of the fourth culture medium is DMEM / F-12 medium.

[0118] Preferably, the basal medium of the fourth culture medium is a basal medium containing glutamine (preferably GlutaMAX additive), B27 additive, N2 additive, vitamin C and thioglycerol.

[0119] Preferably, the concentration of glutamine in the fourth culture medium is 0.5 to 1.5×; more preferably 1×.

[0120] Preferably, the concentration of the B27 additive in the fourth culture medium is 0.5 to 1.5×; more preferably 1×.

[0121] Preferably, the concentration of the N2 additive in the fourth culture medium is 0.5 to 1.5×; more preferably 1×.

[0122] Preferably, the concentration of vitamin C in the fourth culture medium is 5–80 μg / mL; more preferably 45–55 μg / mL; and even more preferably 50 μg / mL.

[0123] Preferably, the concentration of the thioglycerol in the third culture medium is 0.01–40 mM; more preferably 0.38–0.42 mM; and even more preferably 0.4 mM.

[0124] Preferably, the basal medium of the fifth culture medium is DMEM / F-12 medium.

[0125] Preferably, the basal medium of the fifth culture medium is a basal medium containing glutamine (preferably GlutaMAX additive), B27 additive, N2 additive, thioglycerol, and vitamin C.

[0126] Preferably, the concentration of glutamine in the fifth culture medium is 0.5 to 1.5×; more preferably 1×.

[0127] Preferably, the concentration of the B27 additive in the fifth culture medium is 0.5 to 1.5×; more preferably 1×.

[0128] Preferably, the concentration of the N2 additive in the fifth culture medium is 0.5 to 1.5 × 10⁻⁶; more preferably, it is 1 × 10⁻⁶.

[0129] Preferably, the concentration of vitamin C in the fifth culture medium is 5–80 μg / mL; more preferably 45–55 μg / mL; and even more preferably 50 μg / mL.

[0130] Preferably, the concentration of the thioglycerol in the fifth culture medium is 0.01–40 mM; more preferably 0.38–0.42 mM; and even more preferably 0.4 mM.

[0131] Preferably, the basal medium of the sixth culture medium is DMEM / F-12 medium.

[0132] Preferably, the basal medium of the sixth culture medium is a basal medium containing glutamine (preferably GlutaMAX additive), B27 additive, N2 additive, and vitamin C.

[0133] Preferably, the concentration of glutamine in the sixth culture medium is 0.5 to 1.5×; more preferably 1×.

[0134] Preferably, the concentration of the B27 additive in the sixth culture medium is 0.5 to 1.5×; more preferably 1×.

[0135] Preferably, the concentration of the N2 additive in the sixth culture medium is 0.5 to 1.5×; more preferably 1×.

[0136] Preferably, the concentration of vitamin C in the sixth culture medium is 2–150 μg / mL; more preferably 45–55 μg / mL; and even more preferably 50 μg / mL.

[0137] Preferably, the basal medium of the seventh culture medium is Advanced DMEM / F-12 medium.

[0138] Preferably, the basal medium of the seventh culture medium is a basal medium containing glutamine (preferably GlutaMAX additive), B27 additive, N2 additive, and vitamin C.

[0139] Preferably, the concentration of glutamine in the seventh culture medium is 0.5 to 1.5×; more preferably 1×.

[0140] Preferably, the concentration of the B27 additive in the seventh culture medium is 0.5 to 1.5×; more preferably 1×.

[0141] Preferably, the concentration of the N2 additive in the seventh culture medium is 0.5 to 1.5 × 10⁻⁶; more preferably, it is 1 × 10⁻⁶.

[0142] Preferably, the concentration of vitamin C in the seventh culture medium is 5–100 μg / mL; more preferably 45–55 μg / mL; and even more preferably 50 μg / mL.

[0143] Preferably, the reagent combination or kit further comprises: a carrier for transforming the epithelial cells, the carrier being capable of improving cell permeability to induce or enhance cell reprogramming.

[0144] Preferably, the vector expresses one or more of the following factors: Oct4, Sox2, SV40LT, Klf4, miRNA302, miRNA 303, miRNA 304, miRNA305, miRNA306 and miRNA 307.

[0145] Preferably, the carrier comprises pEP4E02SET2K and pCEP4-miR-302-367.

[0146] pEP4EO2SET2K is a non-integrative episome vector encoding OCT4, SOX2, SV40LT, and KLF4, and pCEP4-miR-302-367 is a non-integrative episome vector encoding the miR302-367 cluster, which can be used to promote cell permeability.

[0147] Preferably, the epithelial cells are derived from urine, feces, saliva, hair, nasal secretions, earwax, tears, or vagina; more preferably, from urine.

[0148] Preferably, the epithelial cells are derived from mammals, such as humans, non-human primates (e.g., orangutans, apes), rodents (e.g., rats, mice, guinea pigs), pets (e.g., cats, dogs), and livestock (e.g., horses, cattle, sheep, pigs, rabbits).

[0149] Preferably, the reagent combination or kit further comprises: urine cell culture medium for the proliferation of urine epithelial cells.

[0150] Preferably, the urine cell culture medium is a mixed culture medium consisting of renal epithelial growth medium and DMEM high glucose medium.

[0151] Preferably, the volume ratio of the renal epithelial growth medium to the DMEM high glucose medium is 1:(0.5-1.5); more preferably, it is 1:1.

[0152] Preferably, the urine cell culture medium contains serum (preferably FBS), glutamine (preferably GlutaMAX additive), and non-essential amino acids.

[0153] Preferably, the urine cell culture medium further contains an antibiotic (preferably Primocin).

[0154] Preferably, the concentration of glutamine in the urine cell culture medium is 0.5 to 1.5×; more preferably 1×.

[0155] Preferably, the concentration of the non-essential amino acid in the urine cell culture medium is 0.5 to 1.5 × 10⁻⁶; more preferably 1 × 10⁻⁶.

[0156] Preferably, the concentration of the serum in the urine cell culture medium is 5-15% v / v; more preferably 8-12% v / v; and even more preferably 10% v / v.

[0157] Preferably, the concentration of the antibiotic in the urine cell culture medium is 40-60 ng / mL; more preferably 50 ng / mL.

[0158] In a second aspect of the present invention, the use of the reagent combination or kit of the first aspect of the present invention in any one of (1) to (8) is provided;

[0159] (1) Preparation of endoderm progenitor cells; (2) Preparation of hindgut endoderm cells; (3) Preparation of intestinal progenitor cells; (4) Preparation of intestinal organoids; (5) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce endoderm progenitor cells; (6) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce hindgut endoderm cells; (7) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce intestinal progenitor cells; (8) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce intestinal organoids.

[0160] Preferably, the epithelial cells are derived from urine, feces, saliva, hair, nasal secretions, earwax, tears, or vagina; more preferably, from urine.

[0161] Preferably, the epithelial cells are derived from mammals, such as humans, non-human primates (e.g., orangutans, apes), rodents (e.g., rats, mice, guinea pigs), pets (e.g., cats, dogs), and livestock (e.g., horses, cattle, sheep, pigs, rabbits).

[0162] A third aspect of the present invention provides a method for inducing epithelial cells to produce endoderm progenitor cells or intestinal organoids, comprising the steps of using a reagent combination or kit of the first aspect of the present invention.

[0163] Preferably, the method for inducing epithelial cells to generate endoderm progenitor cells includes the following steps:

[0164] S1: Induces epithelial cells to produce presegmental mesodermal progenitor cells;

[0165] S2: Inducing presegmental mesodermal progenitor cells to generate endoderm progenitor cells: Presegmental mesodermal progenitor cells are cultured in the second culture medium of the reagent combination or kit of the first aspect of the present invention.

[0166] Preferably, the method for inducing epithelial cells to produce intestinal organoids comprises the following steps:

[0167] S1: Induces epithelial cells to produce presegmental mesodermal progenitor cells;

[0168] S2: Inducing presegmental mesodermal progenitor cells to generate endoderm progenitor cells: Presegmental mesodermal progenitor cells are cultured in the second culture medium of the reagent combination or kit of the first aspect of the present invention.

[0169] S3: Induces endoderm progenitor cells to differentiate into hindgut endoderm cells;

[0170] S4: Induces hindgut endoderm cells to differentiate into intestinal progenitor cells;

[0171] S5: Induces intestinal precursor cells to differentiate into intestinal organoids.

[0172] Preferably, the induction of presegmental mesodermal progenitor cells from epithelial cells specifically involves culturing the epithelial cells in a first culture medium within the reagent combination or kit of the first aspect of this invention.

[0173] Preferably, the induction of endoderm progenitor cells to differentiate into hindgut endoderm cells specifically involves culturing the endoderm progenitor cells in the third culture medium of the reagent combination or kit in the first aspect of the present invention.

[0174] Preferably, the induction of hindgut endoderm cells to differentiate into intestinal progenitor cells specifically involves culturing the hindgut endoderm cells in the fourth culture medium of the reagent combination or kit in the first aspect of the present invention.

[0175] Preferably, the induction of intestinal progenitor cells to differentiate into intestinal organoids specifically involves culturing the intestinal progenitor cells in the fifth culture medium of the reagent combination or kit in the first aspect of the present invention.

[0176] Preferably, the presegmental mesodermal progenitor cells are cultured in the second culture medium for 8 to 12 days; more preferably 9 to 11 days; and even more preferably 10 days.

[0177] Preferably, the epithelial cells are cultured in the first culture medium for 8 to 12 days; more preferably 9 to 11 days; and even more preferably 10 days.

[0178] Preferably, the endoderm progenitor cells are cultured in the third culture medium for 3 to 5 days; more preferably 3.5 to 4.5 days; and even more preferably 4 days.

[0179] Preferably, the hindgut endoderm cells are cultured in the fourth culture medium for 6 to 11 days; more preferably 6.5 to 7.5 days; and even more preferably 7 days.

[0180] Preferably, the intestinal precursor cells are cultured in the fifth culture medium for 5 to 9 days; more preferably 6 to 8 days; and even more preferably 7 days.

[0181] Preferably, the method for inducing epithelial cells to produce intestinal organoids further includes a step of 3D culture of the intestinal organoids (preferably cultured until the intestinal organoids are in the form of large vesicles; further, for 10 to 18 days), specifically as follows: the intestinal organoids are resuspended in a matrix gel (preferably 3D intestinal matrix), and then cultured in a fifth culture medium (preferably cultured for 5 to 9 days), the spherical organoids are removed, and resuspended in a new matrix gel (preferably Matrigel) for further culture.

[0182] Preferably, the expanded culture is carried out using a fifth culture medium (preferably cultured until the intestinal organoids exhibit large vesicular structures; further cultured for 5 to 9 days).

[0183] Preferably, the epithelial cells are epithelial cells transformed by a vector, and the vector is the vector in the first aspect of the present invention.

[0184] Preferably, the cell confluence of the epithelial cells reaches 55%; more preferably, it reaches 60%.

[0185] Preferably, the epithelial cells are derived from urine, feces, saliva, hair, nasal secretions, earwax, tears, or vagina; more preferably, from urine.

[0186] Preferably, the epithelial cells are derived from mammals, such as humans, non-human primates (e.g., orangutans, apes), rodents (e.g., rats, mice, guinea pigs), pets (e.g., cats, dogs), and livestock (e.g., horses, cattle, sheep, pigs, rabbits).

[0187] Preferably, the method for preparing the epithelial cells is as follows: urine cells are cultured in urine cell culture medium for the first time to obtain epithelial cells, digested, and then cultured in urine cell culture medium for the second time.

[0188] Preferably, the urine cell culture medium is a mixed culture medium consisting of renal epithelial growth medium and DMEM high glucose medium.

[0189] Preferably, the volume ratio of the renal epithelial growth medium to the DMEM high glucose medium is 1:(0.5-1.5); more preferably, it is 1:1.

[0190] Preferably, the urine cell culture medium contains serum (preferably FBS), glutamine (preferably GlutaMAX additive), and non-essential amino acids.

[0191] Preferably, the urine cell culture medium further contains an antibiotic (preferably Primocin).

[0192] Preferably, the concentration of glutamine in the urine cell culture medium is 0.5 to 1.5×; more preferably 1×.

[0193] Preferably, the concentration of the non-essential amino acid in the urine cell culture medium is 0.5 to 1.5 × 10⁻⁶; more preferably 1 × 10⁻⁶.

[0194] Preferably, the concentration of the serum in the urine cell culture medium is 5-15% v / v; more preferably 8-12% v / v; and even more preferably 10% v / v.

[0195] Preferably, the concentration of the antibiotic in the urine cell culture medium is 40-60 ng / mL; more preferably 50 ng / mL.

[0196] Preferably, the first culture period is 10 to 14 days; further, 11 to 13 days; and even further, 12 days.

[0197] Preferably, the second culture time is 8 to 12 days; further, 9 to 11 days; and even further, 10 days.

[0198] Preferably, the first and second cultures are conducted on a gelatin-coated culture device.

[0199] Preferably, the above-mentioned cultivation conditions are 32–38°C and 4–6% CO2.

[0200] Preferably, the culture medium is completely changed every 2 days during the above culture process.

[0201] A fourth aspect of the present invention provides a method for culturing intestinal organoids, wherein the intestinal organoids are cultured in the sixth culture medium of the first aspect of the present invention.

[0202] Preferably, the intestinal organoid is the intestinal organoid of the third aspect of the present invention (i.e., the intestinal organoid obtained by the method of inducing epithelial cells to produce intestinal organoids in the third aspect).

[0203] Preferably, the culture time is 7 to 11 days; further, 8 to 10 days; and even further, 9 days.

[0204] Preferably, the method further includes the step of passage the cultured intestinal organoids.

[0205] Preferably, the subculture is performed once every 7 to 14 days (preferably 8 to 10 days; more preferably 9 days).

[0206] Preferably, the passaging density is 1:(8-12); more preferably 1:10.

[0207] Preferably, the above-mentioned cultivation conditions are 32–38°C and 4–6% CO2.

[0208] Preferably, the culture medium is completely changed every 2 days during the above culture process.

[0209] A fifth aspect of the present invention provides a method for promoting the maturation of intestinal organoids by culturing the intestinal organoids in a seventh culture medium in the reagent combination or kit of the first aspect of the present invention.

[0210] Preferably, the intestinal organoid is the intestinal organoid of the third aspect or the fourth aspect of the present invention (i.e., the intestinal organoid obtained by the method of inducing epithelial cells to produce intestinal organoids in the third aspect, or the intestinal organoid obtained by the method in the fourth aspect).

[0211] Preferably, the culture time is 8 to 12 days; further, 9 to 11 days; and even further, 10 days.

[0212] Preferably, the above-mentioned cultivation conditions are 32–38°C and 4–6% CO2.

[0213] Preferably, the culture medium is completely changed every 2 days during the above culture process.

[0214] A sixth aspect of the present invention provides an intestinal organoid obtained by the method of inducing epithelial cells to produce an intestinal organoid according to the third aspect of the present invention, the method of the fourth aspect of the present invention, or the method of the fifth aspect of the present invention.

[0215] Preferably, the intestinal organoids highly express transmembrane transport-related genes (e.g., SLC12A9, SLC16A1, SLC16A10, SLC17A4, SLC17A5, SLC1A1, SLC1A3, SLC22A23, SLC23A3, SLC25A6, SLC2A8, SLC30A1, SLC30A2, SLC35A3, SLC37A1, SLC39A14, SLC46A3, SLC52A3, SLC5A6, SLC5A9, SLC6A20, SLC6A4, and / or SLC9A3), thus possessing transmembrane transport function.

[0216] Preferably, the intestinal organoids highly express intestinal absorption-related genes (e.g., CEL, SOAT2, MOGAT2, NPC1L1, SCARB1, LPCAT3, and / or SLC26A6), thus possessing intestinal absorption function.

[0217] Preferably, the intestinal organoids highly express drug metabolism-related genes (e.g., CYP2C19, CYP2S1, CYP2U1, CYP3A4, CYP51A1, and / or ABCB1), thus possessing drug metabolism function.

[0218] Preferably, the intestinal organoids highly express lipid metabolism-related genes (e.g., SULT1E1, PDE3B, SMPD3, IDH1, ACER2, CPT1B, and / or ACBD5), thus possessing lipid metabolism function.

[0219] The determination of gene expression levels can be made in the following ways, but is not limited to: low or high gene expression refers to the conclusion drawn from the comparison of the number of gene mRNA or protein between two groups (samples). If one group (sample) has fewer or more gene mRNA or protein than another group (sample), it is said that the gene in that sample is low or high expressed. The samples used for comparing the number of gene mRNAs and proteins were the aforementioned intestinal organoids and intestinal organoids derived from pluripotent stem cells (e.g., P-iIOs-1 (Workman MJ et al. Engineered human pluripotent-stem-cell-derived intestinal tissues with a functional enteric nervous system. Nat Med, (2017.)), P-iIOs-2 (Mithal A. et al. Generation of mesenchyme free intestinal organoids from human induced pluripotent stem cells. Nat Commun, (2020.)), P-iIOs-3 (Mithal A. et al. Human Pluripotent Stem Cell-Derived Intestinal Organoids Model SARS-CoV-2 Infection Revealing a Common Epithelial Inflammatory Response. Stem Cell Reports, (2021.)).

[0220] A seventh aspect of the invention provides the use of the intestinal organoids of the sixth aspect of the invention in any one of a1) to a5):

[0221] a1) Establishing intestinal disease models;

[0222] a2) Evaluate the pharmacokinetics of the tested substance;

[0223] a3) Evaluate the toxicity of the tested substance;

[0224] a4) Screening drugs for the prevention and treatment of intestinal diseases;

[0225] a5) Preparation of transplantation materials.

[0226] Preferably, the pharmacokinetics includes one or more of the following: metabolism, absorption, membrane permeability, drug interaction, induction of drug-metabolizing enzymes, and induction of drug transport proteins.

[0227] Preferably, the transplant material is used to treat intestinal diseases.

[0228] Preferably, the intestinal disease includes one or more of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS), Crohn's disease, ulcerative colitis (UC), short bowel syndrome, enterocolitis, hereditary enteropathy such as megacolon, cystic fibrosis, and celiac disease.

[0229] An eighth aspect of the present invention provides any one of b1) to b2):

[0230] b1) A product prepared from an intestinal organoid according to the sixth aspect of the present invention, said product being an intestinal disease model;

[0231] b2) A product comprising the intestinal organoid of the sixth aspect of the present invention, said product being a transplant material.

[0232] Preferably, the transplant material is used to treat intestinal diseases.

[0233] Preferably, the intestinal disease includes one or more of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS), Crohn's disease, ulcerative colitis (UC), short bowel syndrome, enterocolitis, hereditary enteropathy such as megacolon, cystic fibrosis, and celiac disease.

[0234] The beneficial effects of this invention are:

[0235] This invention provides a reagent combination or kit that can non-invasively obtain intestinal organoids from donor-derived cell-derived epithelial cells. The obtained intestinal organoids can be cryopreserved and thawed, and can be expanded in vitro for extended periods. Their transcriptomic characteristics are similar to those of real human small intestine tissue, and they highly express typical marker genes from various small intestinal lineages. They exhibit more prominent intestinal functional characteristics, including intestinal absorption, digestion, lipid metabolism, and alcohol metabolism. In contrast, existing pluripotent stem cell-induced intestinal organoids lack intestinal functions such as drug absorption and metabolism, and transmembrane transport. This invention... The intestinal organoids obtained by Ming have more intestinal lineage characteristics and more mature intestinal function compared to those induced by pluripotent stem cells. After accelerated maturation, these intestinal organoids also highly express genes related to drug absorption and metabolism, and have drug absorption capabilities similar to immortalized intestinal cell lines, but exhibit more prominent intestinal cell lineage characteristics, which are closer to the real human intestinal environment, and can be used for drug screening for intestinal diseases. They also have intestinal barrier function, which can effectively prevent the penetration of FITC-glucan, and express multiple drug transporters, enabling them to take up the specific substrate rhodamine 123 (RH123). Attached Figure Description

[0236] Figure 1 The generation of intestinal organoids (U-iIO) is illustrated in section a: a) shows the technical roadmap for reprogramming urinary cells (UC) into endoderm progenitor cells (UiEPC) and inducing them into intestinal organoids (U-iIO); b) shows the 3D cultured cell morphology of intestinal organoids (U-iIO) and the immunofluorescence image of intestinal organoids (U-iIO) (both scale bars are 50 μm); c) shows the qPCR analysis results of marker genes for urinary cells (PAX8), primitive stripes (T), endoderm cells (FOXA2), intestines (CDX2, ISX), and intestinal villi (VIL1) during the process of reprogramming urinary cells (UC) into endoderm progenitor cells (UiEPC) and inducing them into intestinal organoids (U-iIO); d) shows the cell morphology of intestinal organoids (U-iIO) at different passages after cryopreservation, thawing, and passage (scale bar is 50 μm).

[0237] Figure 2 The transcriptomic features of intestinal organoids (U-iIO) are presented as follows: a) a heatmap showing similar gene regulation patterns in intestinal organoids (U-iIO) and small intestine (with published small intestinal tissue samples as positive controls) (log2FC (FC, fold-change) obtained by differential expression analysis compared with urine cells (UC)); b) a graph showing the gene ontology (GO) analysis results of upregulated genes in intestinal organoids (U-iIO) and small intestine (with published small intestinal tissue samples as positive controls) compared with urine cells (UC); c) a graph showing the differential expression analysis results of intestinal organoids (U-iIO) and small intestine (with published small intestinal tissue samples as positive controls) (intestinal lineage genes in intestinal organoids and small intestine are significantly upregulated compared with urine cells (UC)); and d) a heatmap showing the expression of small intestine-specific function-related genes in intestinal organoids (U-iIO).

[0238] Figure 3A comparison of transcriptomic features between intestinal organoids U-iIOs (U-iIO-1-P10, U-iIO-1-P15, U-iIO-1-P20) and pluripotent stem cell-derived intestinal organoids P-iIOs (P-iIOs-1, P-iIOs-2, P-iIOs-3) is presented: (a) shows the transcriptomic features of intestinal organoids U-iIOs (U-iIO-1-P10, U-iIO-1-P15, U-iIO-1-P20) and pluripotent stem cell-derived intestinal organoids P-iIOs (P-iIOs-1, P-iIOs-2, P-iIOs-3). GO enrichment analysis results (Common represents the physiological processes co-expressed by U-iIOs and P-iIOs, U-iIO-1-P represents the physiological processes specifically enriched by U-iIOs, and P-iIOs-1, P-iIOs-2, and P-iIOs-3 represent their respective physiological processes specifically enriched); b shows a heatmap of the functional representative gene expression of U-iIOs (U-iIO-1-P10, U-iIO-1-P15, U-iIO-1-P20) and P-iIOs (P-iIOs-1, P-iIOs-2, and P-iIOs-3).

[0239] Figure 4 A heatmap showing the expression of genes related to metallothionein (MT) family genes, intestinal lineage genes, and drug absorption and metabolism in mature intestinal organoids (U-iIO-1-FBS), pluripotent stem cell-derived intestinal organoids P-iIOs (P-iIOs-1, P-iIOs-2, P-iIOs-3), small intestine (published small intestinal tissue samples), and intestinal immortalized cell lines (Caco-2, HT-29).

[0240] Figure 5 The in vitro functional test results of intestinal organoids (U-iIO) are shown: a) shows a schematic diagram of the circumferential intestinal organoid transporter; b) shows the transporter test results of intestinal organoids (U-iIO) (scale bar is 50μm); c) shows the live cell imaging results of intestinal organoids (U-iIO) (scale bar is 50μm). Detailed Implementation

[0241] The present invention will be further described in detail below through specific embodiments.

[0242] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0243] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available.

[0244] Example 1: A kit for constructing intestinal organoids

[0245] A kit for constructing intestinal organoids, comprising: a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, a fifth culture medium, a sixth culture medium, and a seventh culture medium;

[0246] The first culture medium was Advanced DMEM / F-12 (Gibco, 12634-010) containing 3 μM CHIR99021 (Targetmol, T2310), 10 ng / mL bFGF (PeproTech, P09038), 10 ng / mL EGF (R&D systems, 236-EG) and 1 μM EPZ5676 (Selleck Chemicals, S7062), which was used to induce urinary cells (UC, urinary epithelial cells) to produce presegmental mesodermal progenitor cells (UiPSM).

[0247] The second culture medium was Advanced RPMI 1640 medium containing 1X GlutaMAX supplement (GIBCO, 35050-061), 1X non-essential amino acids (NEAA; GIBCO, 11140-050), 1X B27 supplement (GIBCO), 1X N2 supplement (GIBCO), 0.1mM β-mercaptoethanol (β-ME, SIGAMA), 0.5μM RG108 (TOPSCIENCE), 2μM tranylcypromine (P8511, TOPSCIENCE), 100ng / mL activin A (PeproTech), 2μM LY294002 (TOPSCIENCE), 1μM EPZ011989 (TOPSCIENCE), and 100μM sodium butyrate (NaB, TOPSCIENCE). 1640, GIBCO), which is used to induce pre-segmental mesodermal progenitor cells (UiPSM) to produce endoderm progenitor cells (UiEPC);

[0248] The third culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 50 μg / mL vitamin C (VC), 0.4 mM thioglycerol (MTG), 200 ng / mL Noggin, 10 μM SB431542, 500 ng / mL FGF4, 2 μM CHIR99021, and 1 μM SAG. This medium was used to induce endoderm progenitor cells (UiEPC) to differentiate into hindgut endoderm cells (U-iHE).

[0249] The fourth culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 50 μg / mL vitamin C (VC), 0.4 mM thioglycerol (MTG), 3.5 μM CHIR99021, 20 ng / mL BMP4, and 0.5 μM retinoic acid (RA), which was used to induce hindgut endoderm cells (U-iHE) to differentiate into intestinal progenitor cells (U-iIP);

[0250] The fifth culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 50 μg / mL vitamin C (VC), 0.4 mM thioglycerol (MTG), 10 ng / mL FGF7, 10 ng / mL FGF10, and 3 μM CHIR99021. It was used to induce intestinal progenitor cells (U-iIP) to differentiate into intestinal organoids (U-iIO).

[0251] The sixth culture medium is DMEM / F-12 medium containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 2.5μM CHIR99021, 10ng / mL FGF10, 10ng / mL FGF7, 50μg / mL vitamin C (VC), 20ng / mL HGF, and 20ng / mL OSM, which is used for the culture (culture during passage) and / or passage of intestinal organoids (U-iIO);

[0252] The seventh culture medium was Advanced DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 3μM CHIR99021, 10ng / mL FGF10, 10ng / mL FGF7, 50μg / mL Vitamin C (VC), 20ng / mL HGF, 20ng / mL OSM, 10% v / v FBS, and 0.5μM A8301. It was used to promote the maturation of intestinal organoids (U-iIO).

[0253] Example 2: A kit for constructing intestinal organoids

[0254] A kit for constructing intestinal organoids, comprising: a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, a fifth culture medium, a sixth culture medium, and a seventh culture medium;

[0255] The first culture medium was Advanced DMEM / F-12 (Gibco, 12634-010) containing 20 μM CHIR99021 (Targetmol, T2310), 30 ng / mL bFGF (PeproTech, P09038), 100 ng / mL EGF (R&D systems, 236-EG) and 10 μM EPZ5676 (Selleck Chemicals, S7062), which was used to induce urinary cells (UC, urinary epithelial cells) to produce presegmental mesodermal progenitor cells (UiPSM).

[0256] The second culture medium was Advanced RPMI 1640 containing 1X GlutaMAX supplement (GIBCO, 35050-061), 1X non-essential amino acids (NEAA; GIBCO, 11140-050), 1X B27 supplement (GIBCO), 1X N2 supplement (GIBCO), 1mM β-mercaptoethanol (β-ME, SIGAMA), 5μM RG108 (TOPSCIENCE), 10μM tranylcypromine (P8511, TOPSCIENCE), 150ng / mL activin A (PeproTech), 15μM LY294002 (TOPSCIENCE), 8μM EPZ011989 (TOPSCIENCE), and 180μM sodium butyrate (NaB, TOPSCIENCE). 1640 (GIBCO) medium, which is used to induce pre-segmental mesodermal progenitor cells (UiPSM) to produce endoderm progenitor cells (UiEPC);

[0257] The third culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 100 μg / mL vitamin C (VC), 40 mM thioglycerol (MTG), 300 ng / mL Noggin, 20 μM SB431542, 600 ng / mL FGF4, 100 μM CHIR99021, and 10 μM SAG. This medium was used to induce endoderm progenitor cells (UiEPC) to differentiate into hindgut endoderm cells (U-iHE).

[0258] The fourth culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 80 μg / mL vitamin C (VC), 40 mM thioglycerol (MTG), 13.5 μM CHIR99021, 30 ng / mL BMP4, and 8.5 μM retinoic acid (RA), which was used to induce hindgut endoderm cells (U-iHE) to differentiate into intestinal progenitor cells (U-iIP);

[0259] The fifth culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 80 μg / mL vitamin C (VC), 40 mM thioglycerol (MTG), 100 ng / mL FGF7, 100 ng / mL FGF10, and 15 μM CHIR99021. It was used to induce intestinal progenitor cells (U-iIP) to differentiate into intestinal organoids (U-iIO).

[0260] The sixth medium was DMEM / F-12 medium containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 30μM CHIR99021, 100ng / mL FGF10, 100ng / mL FGF7, 150μg / mL Vitamin C (VC), 100ng / mL HGF, and 100ng / mL OSM, which was used for the culture (culture during passage) and / or passage of intestinal organoids (U-iIO);

[0261] The seventh culture medium was an Advanced DMEM / F-12 medium containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 8μM CHIR99021, 30ng / mL FGF10, 100ng / mL FGF7, 100μg / mL Vitamin C (VC), 30ng / mL HGF, 100ng / mL OSM, 10% v / v FBS, and 5μM A8301, which was used to promote the maturation of intestinal organoids (U-iIO).

[0262] Example 3: A kit for constructing intestinal organoids

[0263] A kit for constructing intestinal organoids, comprising: a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, a fifth culture medium, a sixth culture medium, and a seventh culture medium;

[0264] The first culture medium was Advanced DMEM / F-12 (Gibco, 12634-010) containing 0.3 μM CHIR99021 (Targetmol, T2310), 1 ng / mL bFGF (PeproTech, P09038), 2 ng / mL EGF (R&D systems, 236-EG) and 0.05 μM EPZ5676 (Selleck Chemicals, S7062), which was used to induce urinary cells (UC, urinary epithelial cells) to produce somatic premesoderm progenitor cells (UiPSM).

[0265] The second culture medium was Advanced RPMI 1640 containing 1×GlutaMAX supplement (GIBCO, 35050-061), 1×Non-essential amino acids (NEAA; GIBCO, 11140-050), 1× B27 supplement (GIBCO), 1× N2 supplement (GIBCO), 0.05 mM β-mercaptoethanol (β-ME, SIGAMA), 0.05 μM RG108 (TOPSCIENCE), 0.2 μM tranylcypromine (P8511, TOPSCIENCE), 10 ng / mL activin A (PeproTech), 0.2 μM LY294002 (TOPSCIENCE), 0.05 μM EPZ011989 (TOPSCIENCE), and 10 μM sodium butyrate (NaB, TOPSCIENCE). 1640 (GIBCO) medium, which is used to induce pre-segmental mesodermal progenitor cells (UiPSM) to produce endoderm progenitor cells (UiEPC);

[0266] The third culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 5 μg / mL vitamin C (VC), 0.01 mM thioglycerol (MTG), 80 ng / mL Noggin, 1 μM SB431542, 100 ng / mL FGF4, 0.2 μM CHIR99021, and 0.05 μM SAG. This medium was used to induce the differentiation of endoderm progenitor cells (UiEPC) into hindgut endoderm cells (U-iHE).

[0267] The fourth culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 5 μg / mL vitamin C (VC), 0.01 mM thioglycerol (MTG), 0.3 μM CHIR99021, 2 ng / mL BMP4, and 0.05 μM retinoic acid (RA), which was used to induce hindgut endoderm cells (U-iHE) to differentiate into intestinal progenitor cells (U-iIP);

[0268] The fifth culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 5 μg / mL vitamin C (VC), 0.01 mM thioglycerol (MTG), 1 ng / mL FGF7, 1 ng / mL FGF10, and 0.2 μM CHIR99021, which was used to induce intestinal progenitor cells (U-iIP) to differentiate into intestinal organoids (U-iIO).

[0269] The sixth culture medium was DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 0.5μM CHIR99021, 1ng / mL FGF10, 1ng / mL FGF7, 2μg / mL Vitamin C (VC), 0.5ng / mL HGF, and 2ng / mL OSM, which was used for the culture of intestinal organoids (U-iIO) during passage and / or passage.

[0270] The seventh culture medium was Advanced DMEM / F-12 containing 1X GLUTAMA additive, 1X B27 additive, 1X N2 additive, 1μM CHIR99021, 3ng / mL FGF10, 2ng / mL FGF7, 5μg / mL Vitamin C (VC), 0.5ng / mL HGF, 2ng / mL OSM, 10% v / v FBS, and 0.05μM A8301. It was used to promote the maturation of intestinal organoids (U-iIO).

[0271] Example 4: A method for constructing intestinal organoids

[0272] 1. A method for constructing intestinal organoids, comprising the steps of using the kit of Example 1, as follows:

[0273] (1) Isolation and culture of human urine cells:

[0274] With informed consent, midstream urine samples were collected from healthy volunteers and purified after being stored at 8°C for 4 hours. 100 mL of the urine cell sample (as described above) was centrifuged at 500 g for 8 min, and the cell pellet was collected. The pellet was washed twice with DPBS supplemented with 1× penicillin / streptomycin (Hyclone, SH40003.01). The cells were then transferred to 6 cm gelatin-coated culture dishes and cultured in urine cell culture medium supplemented with 50 ng / mL Primocin (Invitrogen, ant-pm-05) for 12 days (37°C, 5%). The urine cell culture medium was a mixed medium containing 10% v / v FBS, 1×-GlutaMAX additive (GIBCO, 35050-061), and 1× non-essential amino acids (NEAA; GIBCO, 11140-050). The mixed medium was prepared by mixing renal epithelial growth medium (REGM, LONZA, CC-3191) and DMEM high glucose (Hyclone, SH30022.01) at a volume ratio of 1:1 until epithelial cells appeared and clumped. Then, the urine epithelial cells were digested with 0.25% trypsin-EDTA (GIBCO, 25200072) and transferred to a new 6 cm gelatin-coated culture dish. The urine cell culture medium with 50 ng / mL Primocin (Invitrogen, ant-pm-05) was cultured for 10 days (37℃, 5% CO2) until the cell confluence reached 80%.

[0275] (2) Inducing urinary cells (UC, urinary epithelial cells) to produce endoderm progenitor cells (UiEPC):

[0276] Take 1.5 × 10 6The urine cells (UC, urine epithelial cells) obtained in step (1) with a cell confluence of 80% were electrotransfected with the vectors pEP4EO2SET2K (6 μg) and pCEP4-miR-302-367 (4 μg) (the above vectors have been disclosed in patent document CN117280021A) (the electrotransfer kit was Amaxa™ Basic Nucleo-fector™ kit (Lonza, VPI-1005)). The treated urine cells were plated at a ratio of 1:7 onto Matrigel (Corning, 354230) coated 12-well plates and cultured for 5 days (37°C, 5% CO2) in urine cell culture medium supplemented with 50 ng / mL Primocin (Invitrogen, ant-pm-05) until the confluence reached 60%. The culture medium was then replaced with the first culture medium from Example 1 (referred to as Day 0) and cultured for 10 days (37°C, 5% CO2), with the medium completely changed every 2 days, until small color cells appeared on the epithelial cells and aggregated to form many clones (obtaining somitonic premesoderm progenitor cells (UiPSM)). The culture medium was then replaced with the second culture medium and cultured for 10 days (37°C, 5% CO2), with the medium completely changed every 2 days, until large clones appeared (obtaining endoderm progenitor cells (UiEPC)).

[0277] (3) Induction of endoderm progenitor cells (UiEPC) to differentiate into intestinal organoids (U-iIO): The culture medium was replaced with the third medium and cultured for 4 days (37℃, 5% CO2), with a complete medium change every 2 days to obtain hindgut endoderm cells (U-iHE); the culture medium was replaced with the fourth medium and cultured for 7 days (37℃, 5% CO2), with a complete medium change every 2 days to obtain intestinal progenitor cells (U-iIP); the culture medium was replaced with the fifth medium and cultured for 7 days (37℃, 5% CO2), with a complete medium change every 2 days to obtain intestinal organoids (U-iIO); the intestinal organoids (U-iIO) were resuspended in 3D intestinal matrix (Corning 354234), 80 μL was added, and the droplet was solidified in a 37℃ incubator for 20 minutes. Then, the cells were treated with the fifth medium for 7 days (37℃, 5% CO2). CO2, change the medium every 2 days), use a glass needle to remove the spherical organoids that appear, and resuspend them in a new Matrigel droplet to continue expanding the culture (treat the cells with the fifth medium for 7 days (37℃, 5% CO2, change the medium every 2 days)) to show large vesicles;

[0278] (4) Promote the maturation of intestinal organoids (U-iIO): Take the intestinal organoids (U-iIO) with large vesicles obtained in step (3), add the seventh culture medium, and culture for 10 days (37℃, 5% CO2), and change the medium completely every 2 days.

[0279] 2. The technical roadmap for reprogramming urinary cells (UC) into endoderm progenitor cells (UiEPC) and inducing them into intestinal organoids (U-iIO) is as follows: Figure 1 As shown in Figure a: Intestinal organoids can be obtained by reprogramming and inducing human urine cells within 40 days using the kit of Example 1. Specifically, after electroporation of urine cells, they are induced into five major stages: presegmental mesodermal progenitor cells (UiPSM), endoderm progenitor cells (UiEPC), hindgut endoderm (U-iHE), intestinal progenitor cells (U-iIP), and intestinal organoids (U-iIO).

[0280] The intestinal organoids (U-iIO) obtained in step (3) exhibiting a large vesicular shape are as follows: Figure 1 As shown in Figure b: This is a small organoid with a ring-shaped spherical structure. When the organoid is picked out and continuously cultured, it appears as a large ring-shaped vesicle.

[0281] Immunofluorescence staining was performed on the large vesicular intestinal organoids (U-iIO) obtained in step (3), as follows: The intestinal organoids (U-iIO) obtained in step (3) were frozen sections, and then the frozen sections stored at -80℃ were taken out and placed at room temperature for about 4 minutes to thaw; removal of cryoembedding medium (OCT): DPBS was added to the sections and washed for 10 minutes to thoroughly remove OCT; membrane perforation and blocking: membrane perforation and blocking working solution (containing 2.5% BSA, 5% FBS, 0.1% Tritium) was used. Incubate with x-100 DPBS, perforate and block the cell membrane at room temperature for 60 minutes; Primary antibody incubation: discard the perforation and blocking working solution, add primary antibody (catalog number: ab76541; manufacturer: Abcam), incubate overnight at 4°C, then wash with DPBS for 5 minutes, repeat three times to remove the primary antibody; Secondary antibody incubation: add secondary antibody (catalog number: A11011; manufacturer: Invitrogen), incubate at room temperature in the dark for 60 minutes, then wash with DPBS for 10 minutes, repeat three times to remove the secondary antibody; DAPI staining of cell nuclei (3 minutes), wash with DPBS for 5 minutes to remove DAPI. Mount the slide, examine under a microscope, and mount with nail polish. Results are as follows. Figure 1 As shown in Figure b: Most cells express the gut-specific marker CDX2.

[0282] Take the large vesicular intestinal organoids (U-iIO) obtained in step (3) and perform real-time quantitative PCR (RT-qPCR): First, dilute the qPCR primers: 5 μL each of the upstream and downstream primer stock solutions (100 μmol / L). The primer sequences are as follows: CDX2-F (GGCAGCCAAGTGAAAACCAG, SEQ ID NO:1), CDX2-R (GGTGATGTAGCGACTGTAGTGAA, SEQ ID NO:2); VIL1-F (CCCAAGTCAAAGGCTCTCTCA, SEQ ID NO:3), VIL1-R (CTGCTGGCTGTCTTGTGGATA, SEQ ID NO:4); ISX-F (GCATAAAGGACCCCACAAGGA, SEQ ID NO:5), ISX-R (TAGGCCAGGATCCCTTCAGC, SEQ ID NO:6), PAX8-F (GGTGGCAGGAAGTGAATA, SEQ ID NO:4); NO: 7), PAX8-R (TGATTGTGGAACTGTAATAATATGG, SEQ ID NO: 8), TF (GCAAATCCTCATCCTCAGT, SEQ ID NO: 9), TR (TTGTCAGAATAGGTTGGAGAAT, SEQ ID NO: 10), FOXA2-F (ACAGCAGTCTTCTTCACC, SEQ ID NO: 11), FOXA2-R (AGCAGGAGTCTACACAGTA, SEQ ID NO: 12), GAPDH-F (GTGGACCTGACCTGCCGTCT, SEQ ID NO: 13), GAPDH-R (GGAGGAGTGGGTGTCGCTGT, SEQ ID NO: 14); add 190 μL dd Mix H2O thoroughly to prepare a working solution (2.5 μmol / L); extract RNA from the above-mentioned urinary cells (UC), endothelial progenitor cells (UiEPC), hindgut endoderm cells (U-iHE), intestinal progenitor cells (U-iIP), and the macrovesicle-like intestinal organoids (U-iIO) obtained in step (3), and then reverse transcribe to obtain cDNA. Configure the reaction system in a 96-well plate (RTSuperMix for qPCR, catalog number: R222-01, manufacturer: Vazyme). The reaction system is 10 μL: SYBR, 5 μL, H2O, 1.7 μL, 30-fold diluted cDNA, 2.5 μL, forward and reverse primers, 0.8 μL. The reaction program is: 95℃, 2 min; 95℃, 10 sec; 60℃, 20 sec; return to step 2 and perform 39 cycles.During data processing, the ΔCt method was used for analysis. GAPDH was selected as the internal reference gene, and the relative expression result of the target gene to the internal reference was 2. -ΔCt ΔCt = Ct(target gene) - Ct(internal reference GAPDH). The results are as follows: Figure 1 As shown in Figure c: Different genes exhibit staged expression during the reprogramming induction process. The intestinal organoids (U-iIO) obtained in step (3) that exhibit macrovesicle-like structures express intestinal-specific marker genes CDX2, ISX, and VIL.

[0283] The droplets containing macrovesicle-like intestinal organoids obtained in step (3) were cryopreserved: the cryopreservation process was to first release the organoids from Matrigel without digestion, mix them with CS10 cryopreservation solution containing 10 μM Y27632, and then cryopreserve for one month (500 μL of CS10 cryopreservation solution containing Y27632 was added to every 50 μL of Matrigel-coated organoids). For thawing, the cryovials were first rapidly thawed in a 37°C water bath. The cryopreservation solution was then diluted with 5 times its volume of PBS, centrifuged for approximately 8 minutes, and the supernatant was discarded. The precipitate was resuspended in Matrigel and seeded into 24-well plates. The medium from Example 1 (section VI) was added, and the plates were cultured for 9 days (37°C, 5% CO2, denoted as P1). The medium was completely changed every 2 days. Subculturing was then performed as follows: each well was treated with 1 mL of cell recovery medium (Corning cat.no. 354253). All liquid and Matrigel mixtures were transferred to EP tubes and incubated at 4°C for 2 hours. All contents were spun at 250×g for 5 minutes. Organoids were gently pipetted and treated with 500 μL of 0.05% trypsin-EDTA for 2 minutes. [The text abruptly ends here, likely due to an incomplete translation or missing information.] FBS was used to stop PBS digestion. All contents were spun at 250×g for 5 minutes. The organoids were gently pipetted and resuspended in new Matrigel droplets. The sixth culture medium from Example 1 was added for subculture (subcultured once every 9 days at a subculture density of 1:10).

[0284] The cell morphology of intestinal organoids (U-iIO) obtained in step (3) after cryopreservation, thawing, and passage at different generations, exhibiting a macrovesicle-like structure, is shown in the figure. Figure 1 As shown in Figure d: Intestinal organoids (U-iIO) can survive thawing after cryopreservation, maintain organoid morphology after passage after thawing, and expand over a long period of time.

[0285] 3. To characterize the lineage of intestinal organoids (U-iIO), RNA-seq sequencing was performed on the above-mentioned urinary cells (UC) and the intestinal organoids (U-iIO) with macrovesicles obtained in step (3) (U-iIO-1 is U-iIO, and U-iIO-2 is a duplicate of U-iIO-1) (NA-seq sequencing was performed using paired-end 150bp. After the samples were sequenced by the company, the reads information of each sample was extracted using bcl2fastq according to the index sequence to obtain a fastq file for a single sample). RNA-seq data of primary intestinal tissue from previously reported clinical biopsies (public database GEO:GSE159751) was selected as a positive control (small intestine). The obtained data were quality controlled, and the sequencing reads were compared with the transcriptome index generated by GENCODE annotated transcriptome (hg38). The input for downstream differential expression analysis was the calculated transcript per kilobase million (TPM) value. Differential Expression Analysis (DEG) was performed to analyze gene expression, using log2FC > 1 as the threshold for screening differentially expressed genes (FC, fold-change). Gene ontology (GO) enrichment analysis was performed using the R package clusterProfiler. All statistical analyses were performed in R (v4.1.3), and plots were created using the R packages ggplot2 and pheatmap. The results are shown below. Figure 2 As shown: Intestinal organoids (U-iIO) and positive controls have similar gene regulation patterns. Figure 2 In the middle (a), the genes upregulated in intestinal organoids (U-iIO) and positive controls were mainly enriched in small intestine-related physiological processes such as lipid metabolism, fatty acid metabolism, lipid localization, intestinal absorption, and digestion. Figure 2 In section b), the transcriptome of the intestinal organoid (U-iIO) is similar to that of real human small intestine tissue, highly expressing typical marker genes of various small intestinal lineage cell types (KRT20 / CDH17MUC13 in intestinal cells, CHGA / REG4 / GLB1 in enteroendocrine cells, LYZ / GPX2 / AGR2 in paneth, VILL / VIL1 / CDHR5 in villi, and MUC2 / TFF3 / GUCA2A in goblet cells, similar to the primary small intestine in vivo). Figure 2In the intestinal organoids (U-iIO), the small intestine-specific functional genes are highly expressed. These include multiple transporter genes from the two major transporter families related to absorption, the SLC and ABC families, such as SLC26A6 and SLC26A3 (related to sodium ion absorption and transport in the small intestine), SLC5A6 (related to intestinal vitamin absorption), SLC7A8 (related to cationic amino acid absorption and transport), and transporter genes such as ABCB1 and ABCC2. Genes related to small intestinal digestion are also expressed, including the trefoil peptide genes TFF1 and TFF3 for repairing the small intestinal surface, and the oxytocin gene OXT for regulating nutrient absorption. Furthermore, genes from the mucus MUC family related to enteritis, such as MUC2 and MUC17, and CEACAM6 related to Crohn's disease, are expressed. Lipid metabolism genes such as APOE, APOB, and NPC1L1 are also expressed, as well as P450 enzyme functional genes such as CYP3A4 and CYP3A5 related to detoxification. Figure 2 (d).

[0286] 4. To distinguish the obtained intestinal organoids from those derived in other articles, the following intestinal organoids were compared: three passaged intestinal organoids (U-iIOs, U-iIO-1-P10, U-iIO-1-P15, and U-iIO-1-P20, where U-iIO-1-P represents the average of U-iIO-1-P10, U-iIO-1-P15, and U-iIO-1-P20) obtained from the aforementioned passaged culture (i.e., intestinal organoids obtained through cryopreservation, thawing, and passage in section 2). These were compared with intestinal organoids derived from pluripotent stem cells from other articles: P-iIOs-1 (Workman MJ et al. Engineered human pluripotent-stem-cell-derived intestinal tissues with afunctional enteric nervous system. Nat Med, (2017.)) and P-iIOs-2 (Mithal A. et al. Generation of mesenchyme-free intestinal organoids from human induced pluripotent stem cells). cells. Nat Commun, (2020.).), P-iIOs-3(Mithal A.et al.HumanPluripotent Stem Cell-Derived Intestinal Organoids Model SARS-CoV-2InfectionRevealing a Common Epithelial Inflammatory Response.Stem Cell A comparison was made with the report (2021.). RNA-seq sequencing was performed on U-iIO-1-P10, U-iIO-1-P15, U-iIO-1-P20, P-iIOs-1, P-iIOs-2, and P-iIOs-3 (RNA-seq sequencing used paired-end 150bp; after sequencing by the company, read information for each sample was extracted using bcl2fastq based on the index sequence to obtain a single-sample fastq file). The obtained data underwent quality control, and the sequencing reads were compared with the transcriptome index generated by GENCODE annotated transcriptome (hg38). The input for downstream differential expression analysis was the calculated transcript per million (TPM) value. For Differential Expression Analysis (DEG) gene differential expression analysis, the standard used was log2FC>1 as the threshold for screening differentially expressed genes (FC, fold-change).Gene ontology (GO) enrichment analysis was performed using the R package clusterProfiler. All statistical analyses were performed in R (v4.1.3), and plots were generated using the R packages ggplot2 and pheatmap.

[0287] The results are as follows Figure 3 As shown, compared with P-iIOs (P-iIOs-1, P-iIOs-2, P-iIOs-3) obtained through different methods, the three passaged intestinal organoids U-iIOs (U-iIO-1-P10, U-iIO-1-P15, U-iIO-1-P20) obtained from the aforementioned passaged culture exhibited more prominent intestinal functional characteristics, including intestinal functions such as intestinal absorption, digestion, drug metabolism, lipid metabolism, and alcohol metabolism. Figure 3 (a) Comparison of gut-specific functional representative genes between P-iIOs (P-iIOs-1, P-iIOs-2, P-iIOs-3) and the three passaged intestinal organoids U-iIOs (U-iIO-1-P10, U-iIO-1-P15, U-iIO-1-P20) obtained from the aforementioned passage culture. Figure 3 Figure b) shows that P-iIOs (P-iIOs-1, P-iIOs-2, P-iIOs-3) do not have intestinal functions such as drug absorption and metabolism, and transmembrane transport by transporters. It can be seen that the three passaged intestinal organoids (U-iIO-1-P10, U-iIO-1-P15, U-iIO-1-P20) obtained above have more intestinal lineage characteristics and more mature intestinal function development than the intestinal organoids (P-iIOs) induced by pluripotent stem cells.

[0288] 5. For the aforementioned matured intestinal organoids (U-iIO-1-FBS, i.e., the intestinal organoids obtained in step (4) of 1), and other pluripotent stem cell-derived intestinal organoids from other articles, P-iIOs-1 (Workman MJ et al. Engineered human pluripotent-stem-cell-derived intestinal tissues with a functional entericnervous system. Nat Med, (2017.)), P-iIOs-2 (Mithal A. et al. Generation of mesenchyme free intestinal organoids from human induced pluripotent stem cells. Nat Commun, (2020.)), P-iIOs-3 (Mithal A. et al. Human Pluripotent StemCell-Derived Intestinal Organoids Model SARS-CoV-2 Infection Revealing a Common Epithelial Inflammatory Response. Stem Cell Reports (2021.) RNA-seq sequencing was performed on intestinal immortalized cell lines (Caco-2, HT-29) (RNA-seq sequencing used paired-end 150bp sequencing; after sequencing by the company, read information for each sample was extracted using bcl2fastq based on the index sequence to obtain a single-sample fastq file). RNA-seq data from previously reported clinical biopsies of primary intestinal tissue (public database GEO: GSE159751) was selected as a positive control (small intestine). The obtained data underwent quality control, and the sequencing reads were compared with the transcriptome index generated by GENCODE annotated transcriptome (hg38). The input for downstream differential expression analysis was the calculated transcript per million (TPM) value. Differential Expression Analysis (DEG) was performed, using log2FC>1 as the threshold for screening differentially expressed genes (FC, fold-change). Gene ontology (GO) enrichment analysis was performed using the R package clusterProfiler. All statistical analyses were performed in R (v4.1.3), and plots were created using the R packages ggplot2 and pheatmap.

[0289] The intestinal organoids that have undergone accelerated maturation exhibit rapid expansion and more "bubbling and budding" phenomena, meaning that the seventh culture medium enables organoid differentiation to be more diverse and closer to the individual's in vivo condition. At the genetic level, U-iIO-1_FBS specifically expresses a family of metallothionein (MT) genes, which are expressed only in the human gut. U-iIO-1_FBS also highly expresses the cytochrome P450 (CYP450) protein family, which is related to intestinal detoxification function. These genes are also expressed in the human gut. MT family genes and CYP450 may be related to the treatment of intestinal inflammation and diseases. In contrast, human pluripotent stem cell-derived intestinal organoids P-iIOs (P-iIOs-1, P-iIOs-2, P-iIOs-3) do not express these related characteristics. Immortalized intestinal cell lines (Caco-2, HT-29) are primarily used for drug absorption and metabolism and are widely applied in cell models to evaluate the effects of new drugs on intestinal function. U-iIO-1_FBS also highly expresses genes related to drug absorption and metabolism, exhibiting similar drug absorption capabilities to immortalized intestinal cell lines, but more prominently displaying intestinal cell lineage characteristics. Figure 4 Overall, U-iIO-1_FBS more closely resembles the real human intestinal environment and can be used for drug screening for intestinal diseases.

[0290] 6. Transporter Test: After forming a complete circular structure, intestinal organoids (U-iIO) also possess characteristics of good polarity and selective barrier properties. The cavity inside the ring is the apical side (AP side) of the intestine, while the space outside the ring is considered the basolateral side (BL side) of the intestinal substance exchange process. The P-gp-controlled transport direction is from the BL side to the AP side, and is unidirectional and irreversible. Figure 5 (a) Due to the presence of the intact barrier, other substances cannot enter the inner cavity of the organoid from the outside without the action of transporters. FITC-dextrain (3kDa-5kDa) was used as a substance to verify the intestinal barrier. 1 μM of FITC-dextrain (intestinal organoids U-iIOs obtained by passage 15 times from the aforementioned passage culture (i.e., the intestinal organoids obtained by cryopreservation, thawing, and passage in Example 2)) was added to the organoid culture medium (the sixth medium in Example 1), and observed under bright field and fluorescence, respectively. The results are as follows. Figure 5As shown in Figure b: After 17 hours of incubation with fluorescent dye, no fluorescence was observed inside the organoid, demonstrating that U-iIO possesses a complete intestinal barrier and cell viability. After adding 0.5 μM Rh123 to the organoid culture medium (the sixth medium in Example 1) and incubating for 17 hours (the intestinal organoids were U-iIOs obtained through 15 generations of passage culture as described above (i.e., the intestinal organoids obtained from cryopreservation, thawing, and passage in Example 2)), significant fluorescence appeared inside the organoid, forming a high-contrast difference with the outside, demonstrating that the organoid cells possess P-gp transporters and have the function of transporting substrates.

[0291] Live-cell imaging: The previously passaged and well-formed (commonly ring-shaped) organoids (30 passaged intestinal organoids U-iIOs obtained from the previous passaged culture (i.e., the two types of cryopreserved, thawed, and passaged intestinal organoids) were dissolved in old Matrigel at 4°C using CRS (cell recovery medium). After removing the supernatant, the organoids were resuspended in approximately 30 μL of Matrigel and spread evenly in 12-well plates. Pipeline tips were used to allow the flow to a relatively large area. When using a live-cell workstation (BioStation CT) to capture timed fluorescence images, the plates were first placed in the instrument, and one bright-field and one fluorescence image were captured every 20 minutes. After the first stage of imaging, the plates were removed and replaced with the sixth culture medium from Example 1, which contained 1 μM Rh123, and imaging continued. The entire process took approximately 4 hours. After capturing images before drug addition, images were taken at the time points after replacing the medium with 1 μM Rh123 (see details). Figure 5 (c) After each image capture, the cell plate was returned to the incubator; the entire process took approximately 8-9 hours. Results are as follows... Figure 5 As shown in Figure c: Live-cell imaging revealed that fluorescence within the organoid gradually increased over time, demonstrating the transporter function of U-iIO. In conclusion, U-iIO possesses intestinal barrier function.

[0292] Intestinal organoids obtained using the kits from Examples 2 and 3 according to the above method have similar effects.

[0293] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A reagent combination or kit comprising a second culture medium; The second culture medium is a basal medium containing DNA methyltransferase inhibitors, histone demethylation inhibitors, TGF-β activators, phosphatidylinositol 3-kinase inhibitors, EZH2 inhibitors, and histone deacetylation inhibitors; The DNA methyltransferase inhibitor in the second culture medium is RG108; The histone demethylation inhibitor in the second culture medium is transphenylcyclopropane; The TGF-β activator in the second culture medium is activator A; The phosphatidylinositol 3-kinase inhibitor in the second culture medium is LY294002; The EZH2 inhibitor in the second culture medium is EPZ011989; The histone deacetylation inhibitor in the second culture medium is sodium butyrate; The concentration of the DNA methyltransferase inhibitor in the second culture medium is 0.05–5 μM; The concentration of the histone demethylation inhibitor in the second culture medium is 0.2–10 μM; The concentration of the TGF-β activator in the second culture medium is 10–150 ng / mL; The concentration of the phosphatidylinositol 3-kinase inhibitor in the second culture medium is 0.2–15 μM; The concentration of the EZH2 inhibitor in the second culture medium is 0.05–8 μM; The concentration of the histone deacetylation inhibitor in the second culture medium is 10–180 μM.

2. The reagent combination or kit according to claim 1, characterized in that: The second culture medium is a basal medium containing glutamine, non-essential amino acids, B27 additive, N2 additive and β-mercaptoethanol.

3. The reagent combination or kit according to claim 1, characterized in that: The reagent combination or kit also includes a first culture medium; The first culture medium is a basal culture medium containing GSK3β inhibitor, growth factors, and DOT1L inhibitor; The GSK3β inhibitor in the first culture medium was CHIR99021; The growth factors in the first culture medium are epidermal growth factor and bFGF; The DOT1L inhibitor in the first culture medium is EPZ5676; The concentration of the GSK3β inhibitor in the first culture medium is 0.3–20 μM; The concentration of the growth factor in the first culture medium is 3–130 ng / mL; The concentration of the DOT1L inhibitor in the first culture medium is 0.05–10 μM.

4. The reagent combination or kit according to claim 1, characterized in that: The reagent combination or kit also includes a third culture medium; The third culture medium is a basal culture medium containing BMP4 inhibitor, TGFβ / ALK inhibitor, growth factors, GSK3β inhibitor, and SHH agonist. The BMP4 inhibitor in the third culture medium is Noggin; The TGFβ / ALK inhibitor in the third culture medium is SB431542; The growth factor in the third culture medium is FGF4; The GSK3β inhibitor in the third culture medium is CHIR99021; The SHH agonist in the third culture medium is one or more of SAG and SAG 21K; The concentration of the BMP4 inhibitor in the third culture medium is 80–300 ng / mL; The concentration of the TGFβ / ALK inhibitor in the third culture medium was 1–20 μM. The concentration of the growth factor in the third culture medium is 100–600 ng / mL; The concentration of the GSK3β inhibitor in the third culture medium was 0.2–100 μM; The concentration of the SHH agonist in the third culture medium is 0.05–10 μM.

5. The reagent combination or kit according to claim 4, characterized in that: The basal medium of the third culture medium is a basal medium containing glutamine, B27 additive, N2 additive, vitamin C and thioglycerol.

6. The reagent combination or kit according to claim 1, characterized in that: The reagent combination or kit also includes a fourth culture medium; The fourth culture medium is a basal culture medium containing GSK3β inhibitors, BMP signaling pathway activators, and nuclear receptor ligands; The GSK3β inhibitor in the fourth culture medium is CHIR99021; The BMP signaling pathway activator in the fourth culture medium is BMP4; The nuclear acceptor ligand in the fourth culture medium is retinoic acid; The concentration of the GSK3β inhibitor in the fourth culture medium was 0.3–13.5 μM; The concentration of the BMP signaling pathway activator in the fourth culture medium was 2–30 ng / mL; The concentration of the nuclear receptor ligand in the fourth culture medium is 0.05–8.5 μM.

7. The reagent combination or kit according to claim 6, characterized in that: The basal medium of the fourth culture medium is a basal medium containing glutamine, B27 additive, N2 additive, vitamin C and thioglycerol.

8. The reagent combination or kit according to claim 1, characterized in that: The reagent combination or kit also includes a fifth culture medium; The fifth culture medium is a basal culture medium containing growth factors and GSK3β inhibitors; The growth factors in the fifth culture medium are FGF7 and FGF10; The GSK3β inhibitor in the fifth culture medium was CHIR99021; The concentration of the growth factor in the fifth culture medium is 2–200 ng / mL; The concentration of the GSK3β inhibitor in the fifth culture medium was 0.2–15 μM.

9. The reagent combination or kit according to claim 8, characterized in that: The fifth culture medium is a basal medium containing glutamine, B27 additive, N2 additive, thioglycerol, and vitamin C.

10. The reagent combination or kit according to claim 1, characterized in that: The reagent combination or kit also includes a sixth culture medium; The sixth culture medium is a basal medium for GSK3β inhibitors and growth factors; The GSK3β inhibitor in the sixth culture medium is CHIR99021; The growth factors in the sixth culture medium are FGF10, FGF7, hepatocyte growth factor, and tumor suppressor M. The concentration of the GSK3β inhibitor in the sixth culture medium was 0.5–30 μM; The concentration of the growth factor in the sixth culture medium is 4.5–400 ng / mL.

11. The reagent combination or kit according to claim 10, characterized in that: The basal medium of the sixth culture medium is a basal medium containing glutamine, B27 additive, N2 additive, and vitamin C.

12. The reagent combination or kit according to claim 1, characterized in that: The reagent combination or kit also includes a seventh culture medium; The seventh culture medium is a basal culture medium containing GSK3β inhibitor, serum, growth factors, and TGFβ / ALK inhibitor; The GSK3β inhibitor in the seventh culture medium is CHIR99021; The serum in the seventh culture medium is fetal bovine serum; The growth factors in the seventh culture medium are FGF10, FGF7, hepatocyte growth factor, and tumor suppressor M; The TGFβ / ALK inhibitor in the seventh culture medium is A8301; The concentration of the GSK3β inhibitor in the seventh culture medium was 1–8 μM; The concentration of the serum in the seventh culture medium was 5–15% v / v; The concentration of the growth factor in the seventh culture medium is 7.5–260 ng / mL; The concentration of the TGFβ / ALK inhibitor in the seventh culture medium was 0.05–5 μM.

13. The reagent combination or kit according to claim 12, characterized in that: The basal medium of the seventh culture medium is a basal medium containing glutamine, B27 additive, N2 additive, and vitamin C.

14. The reagent combination or kit according to any one of claims 1 to 13, characterized in that: The basal media of the first, second, third, fourth, fifth, sixth and seventh media are each independently selected from one or more of the following: IMDM medium, Eagle's Basal Medium, MEM medium, DMEM medium, Ham's F-12 medium, RPMI 1640 medium, Advanced RPMI 1640 medium, Advanced DF-12 medium, and DMEM / F12 medium.

15. The use of the reagent combination or kit according to any one of claims 1 to 14 in any one of (1) to (8); (1) Preparation of endoderm progenitor cells; (2) Preparation of hindgut endoderm cells; (3) Preparation of intestinal progenitor cells; (4) Preparation of intestinal organoids; (5) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce endoderm progenitor cells; (6) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce hindgut endoderm cells; (7) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce intestinal progenitor cells; (8) Preparation of products that induce epithelial cells or pre-somitral mesodermal progenitor cells to produce intestinal organoids; The epithelial cells are derived from urine or vagina.

16. The application according to claim 15, characterized in that: The epithelial cells are derived from mammals.

17. c1)-c2) Any one of the following methods: c1) A method for inducing epithelial cells to produce endoderm progenitor cells, comprising the step of using the reagent combination or kit according to any one of claims 1 to 3; c2) A method for inducing epithelial cells to produce intestinal organoids, comprising the step of using the reagent combination or kit according to any one of claims 1 to 14; The epithelial cells are derived from urine or vagina.

18. The method according to claim 17, characterized in that: c1) The method comprises the following steps: S1: Induces epithelial cells to produce presegmental mesodermal progenitor cells; S2: Inducing pre-segmental mesodermal progenitor cells to generate endoderm progenitor cells: culturing pre-segmental mesodermal progenitor cells in the second culture medium described in any one of claims 1-2; or c2) The method includes the following steps: S1: Induces epithelial cells to produce presegmental mesodermal progenitor cells; S2: Inducing presegmental mesodermal progenitor cells to generate endoderm progenitor cells: Presegmental mesodermal progenitor cells are cultured in the second culture medium as described in any one of claims 1 to 2; S3: Induces endoderm progenitor cells to differentiate into hindgut endoderm cells; S4: Induces hindgut endoderm cells to differentiate into intestinal progenitor cells; S5: Induces intestinal precursor cells to differentiate into intestinal organoids.

19. The method according to claim 18, characterized in that: The presegmental mesodermal progenitor cells described in c1) and c2) are cultured in the second culture medium for 8 to 12 days.

20. The method according to claim 19, characterized in that: The induction of presegmental mesodermal progenitor cells from epithelial cells as described in c1) and c2) specifically involves culturing epithelial cells in the first culture medium described in claim 3.

21. The method according to claim 20, characterized in that: The epithelial cells described in c1) and c2) are cultured in the first culture medium for 8 to 12 days.

22. The method according to claim 18, characterized in that: The induction of endoderm progenitor cells to differentiate into hindgut endoderm cells as described in c2) specifically involves culturing endoderm progenitor cells in the third culture medium described in any one of claims 4 to 5.

23. The method according to claim 22, characterized in that: The endoderm progenitor cells described in c2) are cultured in the third culture medium for 3 to 5 days.

24. The method according to claim 18, characterized in that: The induction of hindgut endoderm cells to differentiate into intestinal progenitor cells as described in c2) specifically involves culturing hindgut endoderm cells in the fourth culture medium described in any one of claims 6 to 7.

25. The method according to claim 24, characterized in that: The hindgut endoderm cells described in c2) are cultured in the fourth culture medium for 6 to 11 days.

26. The method according to claim 18, characterized in that: The induction of intestinal precursor cells to differentiate into intestinal organoids as described in c2) specifically involves culturing intestinal precursor cells in the fifth culture medium as described in any one of claims 8 to 9. The intestinal progenitor cells described in c2) are cultured in the fifth culture medium for 5 to 9 days.

27. The method according to claim 17, characterized in that: The epithelial cells are derived from mammals.

28. The method according to claim 27, characterized in that: The method for preparing the epithelial cells is as follows: urine cells are cultured in urine cell culture medium for the first time to obtain epithelial cells, which are then digested and cultured in urine cell culture medium for the second time.

29. The method according to claim 28, characterized in that: The first culture period is 10 to 14 days.

30. The method according to claim 29, characterized in that: The second culture period is 8 to 12 days.

Citation Information

Patent Citations

  • a CONNECTOR FOR FEEDING ELECTRICAL CURRENT IN A TOOL LOCATED IN A DRILLING OR OIL WELL

    AR014418A1

  • Human urine-derived induced progenitor cells of promesoderm of body segment and uses thereof

    CN117280021A