Use of amifostine to improve efficiency of targeted genome insertion

Abstract

The application discloses application of amifostine in improving genome site-directed insertion efficiency and belongs to the field of biological medicines. Specifically, the application proposes that amifostine can significantly increase the efficiency of CRISPR gene editing, and can be used for preparing non-viral site-directed integration CAR T cells. It is found through cell experiments that amifostine has a significant promoting effect on the positive rate of CAR T cells after electrotransformation, and greatly improves the tumor killing function of T cells.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and relates to application of amifostine in improving the efficiency of genome site-specific insertion, in particular to use of amifostine in preparation of CAR T drugs for treating cancer-related diseases. BACKGROUND

[0002] CAR T (chimeric antigen receptor T) immune cell therapy is a T cell activated by gene engineering technology, which is equipped with a navigation device CAR to specifically recognize disease cells with a specific target antigen. Compared with traditional chemotherapy or targeted therapy, CAR T therapy avoids long-term drug treatment, and is customized according to the patient's own cells, reducing the risk of immune rejection. However, so far, CAR T cell therapy is still limited to the dependence on viral vectors to introduce CAR into T cells. Although the viral vector is effective, it may cause gene insertion mutations and increase the risk of tumorigenesis, which limits the treatment of autoimmune diseases (Deyle, Russell, 2009). In addition, the manufacturing process of clinical-grade viral vectors is complex and the yield is low, which greatly limits the accessibility of CAR T cell treatment drugs.

[0003] Non-viral CAR T cell engineering, such as CRISPR / Cas9 gene editing and the use of Sleeping Beauty transposon, provides a promising alternative that can improve the accessibility and efficiency of CAR T cell therapy. In particular, the CRISPR / Cas9 gene editing technology has the characteristics of precision, high efficiency and flexibility, which not only can reduce the risk of random insertion, but also can knock out the interested genes at the same time. The Cas9 / sgRNA complex (RNP) and donor DNA are introduced into T cells by electroporation, and the cell genome is modified by homologous directed repair (HDR). Compared with double-stranded DNA and single-stranded DNA, plasmid DNA is easy to prepare and low in price, and is suitable for GMP (Good Manufacturing Practice, drug production quality management standard) production for large-scale clinical application. However, the plasmid structure is complex and the molecular weight is large, which has high toxicity to T cells. The activity of T cells after plasmid electroporation is less than 20%, and due to the low HDR efficiency, the final CAR positive rate is only about 10%, which is difficult to meet the standard of batch production for clinical treatment (Jing, Jiao et al. 2021, Zhang, Hu et al. 2022, An, Zhang et al. 2024). Therefore, it is of great significance to find a compound that can improve the activity and CAR positive rate of CAR T cells after plasmid electroporation for non-viral site-specific integration of CAR T cells.

[0004] Amifostine (AF), also known as 2-(3-aminopropylamino)ethanethiol phosphate, is a normal cell protective agent, which is widely used in the adjuvant therapy of cancer in clinic, and is often used before chemotherapy to reduce drug toxicity. Studies have found that amifostine may have the potential to inhibit the expression of DNA-dependent kinase catalytic subunit (DNA-PKcs) gene (Nikolai, Khodarevet al. 2004), which is a core component of the non-homologous end joining of another DNA double-strand break repair pathway; in addition, amifostine can make cells arrest in the G2 / M phase of the cell cycle (Luo, Wu et al. 2010), which may promote DNA repair by the HDR pathway. SUMMARY

[0005] The purpose of the present application is to overcome the shortcomings of the prior art, provide the application of amifostine in improving the efficiency of genomic site-specific insertion, and solve the problems of low cell yield and low integration efficiency caused by plasmid DNA electroporation into T cells in the preparation of CAR T cells.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is:

[0007] In a first aspect, the present application provides the application of amifostine in improving the efficiency of genomic site-specific insertion, wherein the genomic site-specific insertion adopts CRISPR gene editing.

[0008] The CAS number of the compound is 20537-88-6, and its chemical structural formula is as follows:

[0009] .

[0010] Further, the genomic site-specific insertion acts on eukaryotic cells, preferably immune cells, and more preferably human peripheral blood-derived T cells.

[0011] Further, the present application also finds that the expression efficiency of CAR gene of electroporation transfected cells can be improved by using amifostine, and is compared with AZD7648, a high-efficiency DNA-PK inhibitor reported to enhance the efficiency of CAR gene knock-in.

[0012] In a second aspect, the present application provides a method for preparing a non-viral site-specific integration CAR T cell, comprising: a CAR expression element is co-transfected by a plasmid and an RNP to knock in a T cell by homologous recombination, wherein after the plasmid and the RNP are introduced into the T cell, amifostine is added for treatment.

[0013] As a preferred embodiment of the present application, the final concentration of amifostine is 1-100 μM.

[0014] As a preferred embodiment of the present application, the method comprises the following steps:

[0015] (1) Prepare 10 mM of amifostine stock solution;

[0016] (2) Resuscitate, activate and culture PBMC cells to obtain expanded T cells;

[0017] (3) Incubate Cas9 protein and sgRNA to form RNP complex, add plasmid mixture, and then add T cells resuspended in P3 electroporation buffer;

[0018] (4) Transfer the cell suspension to an electroporation cup, use Lonza 4D electroporation equipment to perform electroporation with EO115 program, and culture in medium with a final concentration of 100 μM amifostine;

[0019] (5) After 24 h of amifostine treatment, replace the fresh medium for continuous culture.

[0020] In one embodiment, the AAVS1 site of the CAR T cell genome is knocked in with an anti-HER2 CAR expression element, which can express an anti-HER2 chimeric antigen receptor.

[0021] In a third aspect, the present application provides a CAR T cell prepared by the method of the second aspect.

[0022] In a fourth aspect, the present application provides use of the CAR T cell of the third aspect in the preparation of an anti-tumor therapeutic drug.

[0023] The present application has the following beneficial effects: the donor plasmid and the RNP complex are co-electroporated into T cells in the present application, avoiding the use of viral vectors, simplifying the preparation process of CAR T cells, and improving the safety of CAR T cells. Research has found that amifostine can improve the efficiency of genome site-specific insertion and increase the efficiency of CRISPR gene editing, especially through cell experiments, it is found that amifostine can significantly promote the positive rate of CAR T cells after electroporation, and can improve the tumor killing and cytokine secretion functions of T cells. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 A result graph for flow cytometry detection of CAR positive rates in each group in Example 1;

[0025] Figure 2 A result graph for PCR amplification electrophoresis detection of CAR positive rates in each group in Example 1;

[0026] Figure 3 A result graph for chemiluminescence detection of luciferase intensity and calculation of killing efficiency in each group in Example 3; wherein * indicates a significant difference and p<0.05, and *** indicates a significant difference and p<0.001;

[0027] Figure 4 Figure 6 is a graph showing the results of ELISA method for determining the concentration of each group of cytokine IFN-γ in Example 4; wherein *** indicates significant difference and p<0.001. DETAILED DESCRIPTION

[0028] The technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work, fall within the protection scope of the present application.

[0029] It should be noted that the features in the following embodiments and implementation manners can be combined with each other without conflict.

[0030] The experimental materials and methods used in the following examples are all conventional materials and methods unless otherwise specified.

[0031] Example 1: Effect of amifostine on CAR knock-in T cell efficiency.

[0032] Peripheral blood mononuclear cells (PBMCs) cultured in X-VIVO15 medium were activated by adding CD3 / CD28 Dynabeads magnetic beads (Thermo, Cat No. 11131D) at a ratio of 1:1, and T cells were collected after 2-3 days. 0.25 μg of Cas9 protein (Thermo, Cat No. A36499) and 50 pmol of AAVS1 sgRNA: AGAGCTAGCACAGACTAGAG (SEQ ID NO. 1) were incubated at room temperature for 10 min, and then 2 μg of constructed anti-Her2 CAR plasmid was added and mixed. 20 μL of nucleofector solution was used to resuspend 1×10 6 T cells, and the RNP-plasmid mixture was added. The Lonza 4D-Nucleofector electroporator was used to perform electroporation by selecting the EO115 program. The T cells were treated with 1% w / v PBS (PBS group), 0.5 μM AZD7648 (AZD7648 group), or 100 μM amifostine (amifostine group) for 24 h, and the concentration was the final concentration. The T cells without RNP and plasmid were set as the untreated control group.

[0033] After 5-7 days of electroporation, the cells were washed once with FACS buffer and incubated with PE-anti-G4S Linker antibody (diluted 1:20 v / v, Saili Biotechnology, catalog number XY-Ab001-100T-PE) for 30 minutes. After washing twice with FACS buffer, the fluorescence intensity was detected by flow cytometry to obtain the CAR positivity rate, as shown in Table 1.

[0034] Take 5×10 after 5-7 days of electrolysis. 5 T cells were centrifuged to remove the culture medium, and genomic DNA was extracted using a DNA extraction kit (Sangon Biotech, catalog number B518251). The specific procedures were performed according to the manufacturer's instructions. The specific upstream primer sequence for detecting the efficiency of Her2-CAR expression element knock-in at the AAVS1 site was AGAAAGGTGAAGAGCCAAAGTTAG (SEQ ID NO.2), and the downstream primer sequence was GGAACTCTGCCCTCTAACGCTG (SEQ ID NO.3). The reaction system included primers (0.4 μM), 50 ng DNA, and a 1×Phanta DNA polymerase mixture (Novizan, catalog number P525) at the final concentration. The mixture was denatured at 95°C for 3 minutes, followed by 35 cycles of 95°C for 30 seconds, annealing at 64°C for 15 seconds, extension at 72°C for 3 minutes, and a final extension at 72°C for 5 minutes to obtain the PCR product. 200 ng / well was added to a 1% (w / v) agarose gel, and electrophoresis was performed at 100V for 45 minutes. The gel was photographed and the bands analyzed to detect the Her2-CAR gene level, as shown in Table 2.

[0035] Table 1: Statistical table of the effects of amifostine on T cell Her2 antibody expression

[0036]

[0037] Table 2: Statistical table of the effects of amifostine on Her2-CAR gene levels in T cells

[0038]

[0039] The results showed that amifostine treatment significantly increased the CAR positivity rate, with antibody expression nearly twice that of the PBS-treated group, while the positive control AZD7648 group showed 2.5 times that of the PBS-treated group. Figure 1 The Her2-CAR gene level in the amifostine group was 2.7 times that in the PBS group, while the level in the AZD7648 group was approximately 3.4 times that in the PBS group. (See...) Figure 2 .

[0040] Example 2: Effects of amifostine on T cell viability and proliferation.

[0041] After T cells were electroporated with CAR plasmid as step in example 1, 1% w / v PBS or 0.5 mM AZD7648 or 100 mM amifostine was added for 24 h, and the number of viable cells was counted by trypan blue staining, and the viability of T cells was calculated, as shown in Table 3. The medium was changed every two days, and after 6 days, the number of viable cells was counted by trypan blue staining, as shown in Table 4.

[0042] Table 3: Statistical table of the effect of amifostine treatment on T cell viability for 24 h

[0043]

[0044] Table 4: Statistical table of T cell number after amifostine treatment for 6 days

[0045]

[0046] The results showed that the number of T cells after amifostine treatment was not reduced relative to the PBS group, while AZD7648 treatment reduced the number of viable cells. The number of CAR-positive viable cells after 6 days of amifostine treatment was about 2 times that of the AZD7648 group; the number of CAR-positive viable cells after 6 days of amifostine treatment was about 2.1 times that of the PBS group, as shown in Table 4.

[0047] Example 3: Effect of amifostine on the function of CAR T cells in killing human ovarian cancer cells SK-OV-3.

[0048] SK-OV-3 cells were transfected with 3 pg of pGL6-CMV-Luc plasmid using jetPRIME transfection reagent (Polyplus, Cat No. 101000046) into SK-OV-3 cells plated 1 day in advance. 20000 SK-OV-3 cells were seeded into a 96-well plate per well, and SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid for 2 days were added to the co-culture of untreated control group, PBS group and amifostine group T cells after electroporation for 10-14 days at the ratios of 1:3, 1:1 and 3:1 of effector cells to target cells (E:T) for 16 h, and then substrate reagent (Admas, Cat No. RA-GL05) was added for 5 min at room temperature. Chemiluminescence detection of luciferase intensity was performed using a microplate reader. The following controls were also prepared: only SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid were seeded without T cells as a positive control for fluorescence intensity; SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid were seeded with the addition of 2% w / v Tween-20 as a negative control for fluorescence intensity. The killing efficiency of T cells was calculated, as shown in Table 5, and the calculation formula was: [(fluorescence intensity of positive control - fluorescence intensity of negative control) - (fluorescence intensity of experimental group - fluorescence intensity of negative control)] / (fluorescence intensity of positive control - fluorescence intensity of negative control) x 100%.

[0049] Table 5: Statistics of the effect of amifostine on CAR T cell killing efficiency of SK-OV-3 cells

[0050]

[0051] The results show that the CAR T cells treated by amifostine have 100% and 33% increase in killing efficiency of tumor cells SK-OV-3 at the effector: target cell ratio of 1:1 and 3:1, respectively, compared with the PBS group, see Figure 3 .

[0052] Example 4: Effect of amifostine on CAR T cell secretion of cytokines.

[0053] The unprocessed control group, PBS group and amifostine group T cells cultured for 10-14 days after electrotransformation were co-cultured with SK-OV-3 cells at the ratio of effector: target cell of 1:1, and the cell culture supernatant was collected by centrifugation after 16 h, and the content of cytokine IFN-γ (BioLegend, item number 430104) was detected by ELISA (Enzyme-Linked Immunosorbent Assay). The specific operation steps were completed according to the kit instructions.

[0054] Table 6: Statistics of the effect of amifostine on CAR T cell secretion of cytokines

[0055]

[0056] The results show that, as shown in Table 6, the secretion level of IFN-γ is significantly increased (about 4 times of the PBS group) after co-culturing CAR T cells treated by amifostine with SK-OV-3, see Figure 4 .

[0057] Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are considered exemplary only. The application is intended to cover any variations, uses or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice in the art to which the application pertains or can relate. The specification and examples are to be regarded as illustrative only.

Claims

1. The application of amifostine in improving the efficiency of site-specific genomic insertion, characterized in that, The application is not for disease diagnosis or treatment purposes. The site-directed genomic insertion is performed using CRISPR / Cas9 gene editing, and acts on human peripheral blood-derived T cells through homologous recombination.

2. A method for preparing non-viral site-specific integration CAR T cells, characterized in that, The CAR expression element was co-transfected with plasmid and RNP and knocked into T cells via homologous recombination. After the plasmid and RNP were introduced into the T cells, amifostine was added for treatment. The RNP is a complex formed by incubating Cas9 protein and sgRNA.

3. The method according to claim 2, characterized in that, The final concentration of amifostine is 1-100 μM.

4. The method according to claim 2, characterized in that, The method includes the following steps: Cas9 protein and sgRNA are incubated to form an RNP complex, plasmids are added and mixed, and T cells resuspended in electroporation buffer are added; the cell suspension is electroporated, and amifostine is added to the culture medium at a final concentration of 1-100 μM; after amifostine treatment for 22-26 h, the culture medium is changed and culture continues.

Images