Prostate cancer marker combination and application thereof in preparation of detection reagent and treatment medicine

Abstract

The invention provides a group of marker combinations related to the prostatic cancer, wherein the marker combinations comprise hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903, and the application of the marker combinations in preparation of a prostatic cancer detection reagent and a prostatic cancer treatment medicine is researched and developed at the same time. The prostate cancer detection reagent provided by the invention comprises specific primers designed for the four markers, has high sensitivity and specificity, and improves the accuracy of prostate cancer diagnosis by jointly detecting and diagnosing the prostate cancer through the four markers. The medicine for treating the prostatic cancer, provided by the invention, comprises an hsa-miR-12125 inhibitor, an hsa-miR-21 inhibitor, an hsa-miR-103 analogue and an hsa-miR-9903 analogue, and can be used for effectively inhibiting the occurrence and development of the prostatic cancer.

Description

Technical Field

[0001] The present invention belongs to the technical fields of biomedicine and molecular biology, and specifically relates to a marker combination for diagnosing human prostate cancer and its application in preparing prostate cancer detection reagents and therapeutic drugs. Technical Background

[0002] Prostate cancer is one of the most common malignancies worldwide, and its incidence increases significantly with age. According to the 2020 World Cancer Report, prostate cancer ranks sixth in incidence and ninth in mortality among male malignancies worldwide. Currently, clinical screening and diagnosis of prostate cancer rely primarily on serum prostate-specific antigen (PSA) testing, digital rectal examination, and tissue biopsy. However, these methods have drawbacks such as large diagnostic bias and overtreatment. For example, although PSA testing is widely used in prostate cancer screening, its low specificity leads to many patients with benign prostatic hyperplasia being misdiagnosed as having prostate cancer and subsequently receiving unnecessary treatment. Therefore, the discovery of new markers for the early diagnosis of prostate cancer is particularly important. This will help promote early intervention and treatment of prostate cancer and prolong patient survival.

[0003] MicroRNA (miRNA) is a class of small non-coding RNA molecules of approximately 22 nucleotides in length that are widely present in the cells of eukaryotes. miRNA binds to target mRNA through post-transcriptional regulatory mechanisms, leading to mRNA degradation or inhibition of its translation, thus playing an important role in the regulation of gene expression. The expression of miRNA is highly tissue-specific and developmental-stage-specific, and its expression levels in different disease states also vary significantly. Therefore, miRNA is regarded as a potential disease biomarker, especially in the diagnosis and treatment of tumors, and has broad application prospects. Compared with traditional protein markers, miRNA has several advantages: Good stability: miRNA exists stably in body fluids such as blood, saliva, and urine, making it easy to detect non-invasively.

[0004] Convenient detection: miRNA detection technologies are mature, such as qPCR and microarray, which are easy to operate and low in cost.

[0005] Strong specificity: miRNA expression is highly tissue and disease specific and can more accurately reflect disease status.

[0006] Studies have shown that the expression levels of some miRNAs are significantly upregulated or downregulated in prostate cancer tissue. These abnormally expressed miRNAs play a key role in the development and progression of prostate cancer, potentially participating in tumorigenesis, cell proliferation, invasion, and metastasis. Therefore, identifying and validating miRNA markers for early diagnosis of prostate cancer is crucial for improving the diagnostic accuracy and treatment efficacy of prostate cancer. Summary of the Invention

[0007] The core purpose of this invention is to provide a set of miRNA marker combinations that meet the needs of prostate cancer diagnosis by screening and verifying miRNA markers related to the occurrence and development of prostate cancer, and to develop the application of miRNA marker combinations in the preparation of prostate cancer detection reagents and therapeutic drugs, thereby improving the accuracy of early diagnosis and treatment of prostate cancer.

[0008] To achieve the above object, the technical solution provided by the present invention is as follows: (1) The present invention provides a set of prostate cancer marker combinations, consisting of four miRNA markers associated with prostate cancer, hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903, wherein the nucleotide sequence of hsa-miR-12125 is shown in SEQ ID NO.1, the nucleotide sequence of hsa-miR-21 is shown in SEQ ID NO.2, the nucleotide sequence of hsa-miR-103 is shown in SEQ ID NO.3, and the nucleotide sequence of hsa-miR-9903 is shown in SEQ ID NO.4.

[0009] The expression levels of the four markers hsa-miR-12125, hsa-miR-21, hsa-miR-103, and hsa-miR-9903 in the serum of prostate cancer patients were significantly different from those in healthy controls, making them suitable for use as specific markers for prostate cancer diagnosis. The nucleotide sequences of the prostate cancer marker combination of the present invention are shown in Table 1 below.

[0010] Table 1: Nucleotide sequences of the prostate cancer marker combination of the present invention name Gene ID Nucleotide sequence serial number hsa-miR-12125 113219458 tctctcacctggcataagcaat SEQ ID No. 1 hsa-miR-21 406991 tagcttatcagactgatgttga SEQ ID No. 2 hsa-miR-103 406895 ggcttctttacagtgctgccttg SEQ ID No. 3 hsa-miR-9903 113218497 ttatcctccagtagactaggga SEQ ID No. 4 (2) The present invention also provides the use of hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 in the preparation of prostate cancer detection reagents.

[0011] The present invention provides a prostate cancer detection reagent, comprising the following reagents: Reagents for specifically detecting the expression level of hsa-miR-12125 are primers for the nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 9; Reagents for specifically detecting hsa-miR-21 expression, comprising primers with the nucleotide sequences shown in SEQ ID NO. 6 and SEQ ID NO. 9; Reagents for specifically detecting hsa-miR-103 expression, comprising primers with the nucleotide sequences shown in SEQ ID NO. 7 and SEQ ID NO. 9; Reagents for specifically detecting the expression of hsa-miR-9903, comprising primers for the nucleotide sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9; The primers exist independently or are mixed to form a mixture.

[0012] The prostate cancer detection reagent further includes reagents selected from the following group: internal reference primers, Taq enzyme, dNTPs, PCR buffer, MgCl2, TagMan probe, and fluorescent quantitative PCR reference dye.

[0013] The detection sample targeted by the prostate cancer detection reagent is a cDNA sample prepared from human peripheral blood.

[0014] The primer sequences involved in the present invention are shown in Table 2 below.

[0015] Table 2. Primer sequences Primer name Nucleotide sequence serial number hsa-miR-12125-F tctctcacctggcataag SEQ ID No. 5 hsa-miR-21-F tagcttatcagactgatg SEQ ID No. 6 hsa-miR-103-F ggcttctttacagtgctgc SEQ ID No. 7 hsa-miR-9903-F ttatcctccagtagacta SEQ ID No. 8 Universal Rp cagtgcagggtccgaggt SEQ ID No. 9 RNU6-1-F aacaagcgcaaggatgacacg SEQ ID No. 10 Universal RT primer cagtgcagggtccgaggtcagagccacctgggcaattttttttttttvn SEQ ID No. 11 Universal Taqman Probe FAM-tgcccaggtggct-MGBNFQ SEQ ID No. 12 (3) Use of the prostate cancer marker combination and prostate cancer detection reagent of the present invention in the diagnosis of prostate cancer specifically comprises the following steps: Step S1: extracting human peripheral blood and obtaining a serum sample by centrifugation; Step S2: extracting total RNA from the spare serum sample obtained in S1 to prepare a serum sample to be tested containing total RNA; Step S3: Reverse transcription of the serum sample containing total RNA to obtain a cDNA sample; Step S4: qPCR detection A qPCR reaction system was prepared using the prostate cancer detection reagent for specific detection markers provided by the present invention and the cDNA sample to be tested. The relative expression levels of the four markers hsa-miR-12125, hsa-miR-21, hsa-miR-103, and hsa-miR-9903 in serum were detected using the real-time PCR method. Step S5: Detection result judgment The relative expression levels of the four prostate cancer markers measured in step S4, i.e., the ΔCt values, are input into the following comprehensive discrimination formula for judgment: Comprehensive judgment value = -1.953 + 0.473*ΔCt hsa-miR-12125 + 0.476*ΔCt hsa-miR-21 -0.320* ΔCt hsa-miR-103 -0.226*ΔCt hsa-miR-9903; A comprehensive judgment value ≥ 0 is positive, indicating a higher risk of prostate cancer; The comprehensive judgment value is <0, which is negative and the risk of prostate cancer is low.

[0016] (IV) The present invention also provides the use of hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 in the preparation of drugs for treating prostate cancer.

[0017] The present invention provides a drug for treating prostate cancer, comprising: inhibitors of hsa-miR-12125 and hsa-miR-21 genes, and mimics of hsa-miR-103 and hsa-miR-9903 genes; the nucleotide sequence of the hsa-miR-12125 inhibitor is shown in SEQ ID NO.13; the nucleotide sequence of the hsa-miR-21 inhibitor is shown in SEQ ID NO.14; the nucleotide sequence of the hsa-miR-103 mimic is shown in SEQ ID NO.15; and the nucleotide sequence of the hsa-miR-9903 mimic is shown in SEQ ID NO.16; the drug for treating prostate cancer inhibits the expression of hsa-miR-12125 and hsa-miR-21 genes, and increases the expression of hsa-miR-103 and hsa-miR-9903 genes, thereby inhibiting the occurrence and development of prostate cancer.

[0018] The specific nucleotide sequences of the inhibitors and mimics involved in the prostate cancer treatment drugs of the present invention are shown in Table 3 below.

[0019] Table 3: Nucleotide sequences of inhibitors and mimetics name Nucleotide sequence serial number hsa-miR-12125 inhibitor attgcttatgccaggtgagaga SEQ ID No. 13 hsa-miR-21 inhibitor tcaacatcagtctgataagcta SEQ ID No. 14 hsa-miR-103 mimics ggcttctttacagtgctgccttg SEQ ID No. 15 hsa-miR-9903 mimics ttatcctccagtagactaggga SEQ ID No. 16 Beneficial effects of the present invention

[0020] The present invention provides a set of prostate cancer miRNA marker combinations. Based on this, the application of these miRNA marker combinations in the preparation of prostate cancer detection reagents and therapeutic drugs has been developed. Furthermore, prostate cancer detection reagents, diagnostic methods, and prostate cancer therapeutic drugs are provided. The present invention has the following advantages in the diagnosis and treatment of prostate cancer: Fast and convenient detection: Using qPCR technology, the operation is simple and the detection time is short.

[0021] High detection sensitivity: Able to detect trace differences in miRNA expression, improving diagnostic accuracy.

[0022] Good specificity: Detection of specific miRNA markers can reduce misdiagnosis and missed diagnosis.

[0023] Low cost: The reagents and diagnostic methods are simple and easy to use, which reduces the cost of testing and meets the needs of the majority of patients.

[0024] Wide range of applications: It can be used for early screening, diagnosis and treatment monitoring of prostate cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The present invention illustrates the diagnostic efficacy of combined marker detection using a training set, verifies the diagnostic efficacy of combined marker detection using a validation set, and provides an experimental flow chart for verifying drug efficacy; Figure 2 A comparison chart of marker expression levels in serum samples of healthy controls and prostate cancer patients when the present invention uses a training set to illustrate the diagnostic efficacy of combined marker detection; Figure 3 The receiver operating characteristic (ROC) curve was established when the training set was used to illustrate the diagnostic efficacy of the combined detection of markers in the present invention.

[0026] Figure 4 This is the receiver operating characteristic (ROC) curve established when the diagnostic efficacy of the combined detection of markers was verified using the validation set in the present invention. DETAILED DESCRIPTION Example 1

[0027] The present invention provides a combination of prostate cancer markers, which are composed of four miRNA markers significantly associated with the occurrence and development of prostate cancer, namely hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903, wherein the nucleotide sequence of hsa-miR-12125 is shown in SEQ ID NO.1, the nucleotide sequence of hsa-miR-21 is shown in SEQ ID NO.2, the nucleotide sequence of hsa-miR-103 is shown in SEQ ID NO.3, and the nucleotide sequence of hsa-miR-9903 is shown in SEQ ID NO.4.

[0028] The nucleotide sequence of the prostate cancer marker combination of the present invention is shown in Table 1.

[0029] The present invention provides use of a prostate cancer marker combination of hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 in preparing a prostate cancer detection reagent.

[0030] The present invention provides a prostate cancer detection reagent, comprising: a reagent for specifically detecting the expression level of hsa-miR-12125, which is a primer for the nucleotide sequence shown in SEQ ID NO.5 and SEQ ID NO.9; a reagent for specifically detecting the expression level of hsa-miR-21, which is a primer for the nucleotide sequence shown in SEQ ID NO.6 and SEQ ID NO.9; a reagent for specifically detecting the expression level of hsa-miR-103, which is a primer for the nucleotide sequence shown in SEQ ID NO.7 and SEQ ID NO.9; and a reagent for specifically detecting the expression level of hsa-miR-9903, which is a primer for the nucleotide sequence shown in SEQ ID NO.8 and SEQ ID NO.9; the primers each exist independently or are mixed to form a mixed solution.

[0031] The prostate cancer detection reagent further includes reagents selected from the following group: internal reference primers, Taq enzyme, dNTPs, PCR buffer, MgCl2, TagMan probe, and fluorescent quantitative PCR reference dye.

[0032] The detection sample targeted by the prostate cancer detection reagent is a cDNA sample prepared from human peripheral blood.

[0033] The nucleotide sequences of the specific primers designed for the four markers of the prostate cancer detection reagent provided by the present invention are shown in Table 2.

[0034] The present invention also provides the use of a prostate cancer marker combination and a prostate cancer detection reagent in the diagnosis of prostate cancer, which specifically comprises the following steps: Step S1: extracting human peripheral blood and obtaining a serum sample by centrifugation; Draw 2 ml of peripheral blood from the person being tested and place it into a separation gel blood collection tube. Gently invert the tube 180° to mix evenly for 5-6 times. Gently shake the separation gel blood collection tube. Within 12 hours, centrifuge the separation gel blood collection tube at 3,000×g for 10 minutes. Then transfer the supernatant to a clean tube to obtain a spare serum sample and store it at -80°C.

[0035] Step S2: extracting total RNA from the spare serum sample obtained in S1 to prepare a serum sample to be tested containing total RNA; Total RNA was extracted using the miRNeasy Serum / Plasma Advanced Kit according to the manufacturer's instructions (Qiagen). The concentration of RNA was quantified using a Qubit 4.0 fluorometer to prepare serum samples containing total RNA.

[0036] Step S3: Reverse transcription of the serum sample containing total RNA to obtain a cDNA sample; A serum sample containing total RNA to be tested is taken, and a tailing and reverse transcription reaction system is prepared. The tailing reagent in the reaction system tails the small RNA, and the reverse transcription reagent reverse transcribes the tailed small RNA to obtain a cDNA sample to be tested.

[0037] Step S4: qPCR detection A qPCR reaction system was prepared using the prostate cancer detection reagent for specific detection markers provided by the present invention and the cDNA sample to be tested. The reaction system included the cDNA sample, specific primers, and probes. Real-time PCR was used to detect the relative expression levels, i.e., ΔCt values, of the four markers hsa-miR-12125, hsa-miR-21, hsa-miR-103, and hsa-miR-9903 in serum.

[0038] Step S5: Detection result judgment The ΔCt values ​​of the four prostate cancer markers measured in step S4 are input into the following comprehensive discrimination formula for judgment: Comprehensive judgment value = -1.953 + 0.473*ΔCt hsa-miR-12125 + 0.476*ΔCt hsa-miR-21 -0.320* ΔCt hsa-miR-103 -0.226*ΔCt hsa-miR-9903; A comprehensive judgment value ≥ 0 is positive, indicating a higher risk of prostate cancer; The comprehensive judgment value is <0, which is negative and the risk of prostate cancer is low.

[0039] Example 2. The training set samples were used to experimentally demonstrate the diagnostic efficacy of the prostate cancer detection reagent of the present invention for the combined detection of four markers for diagnosing prostate cancer, and the validation set samples were used to verify the diagnostic efficacy of the combined detection of markers. For the specific process, see Figure 1 .

[0040] The methods used in the above experiments refer to the application method of the prostate cancer marker combination and prostate cancer detection reagent in the diagnosis of prostate cancer provided in Example 1.

[0041] (I) Diagnostic efficacy of the combined detection of prostate cancer marker combinations of the present invention Training set samples: cDNA samples from 43 prostate cancer patients and 42 healthy controls.

[0042] Detection reagent: The prostate cancer detection reagent provided by the present invention is used.

[0043] Detection objective: Detect the expression levels of markers hsa-miR-12125, hsa-miR-21, hsa-miR-103, and hsa-miR-9903 in the cDNA samples to be tested in the training set.

[0044] The specific experimental steps for the experiment using the training set to demonstrate the efficacy of the marker combination of the present invention in combined detection and diagnosis of prostate cancer are as follows: (1) Sample collection: 170 blood samples were collected from Qilu Hospital of Shandong University and Shandong Provincial Hospital, including samples from 84 healthy donors and 86 prostate cancer patients. All samples were collected between May 2021 and June 2024. All prostate cancer patients were first-time patients with no history of surgery or medication. They were pathologically confirmed to have prostate cancer after hospitalization. Among the 170 blood samples, 43 prostate cancer patients and 42 healthy controls were used to construct the training set samples, and 43 prostate cancer patients and 42 healthy controls were used to construct the validation set samples.

[0045] (2) RNA extraction: Total RNA was extracted using the miRNeasy Serum / Plasma Advanced Kit (Qiagen), and its concentration was quantified using a Qubit 4.0 fluorescence quantifier.

[0046] (3) cDNA synthesis: A serum sample containing total RNA is prepared and a tailing and reverse transcription reaction system is prepared. The tailing reagent in the reaction system is used to tail the small RNA, and the reverse transcription reagent is used to reverse transcribe the tailed small RNA to obtain a cDNA sample. The reverse transcription reagent used includes a reverse transcription primer having a nucleotide sequence as shown in SEQ ID No. 11.

[0047] (4) qPCR detection: A qPCR reaction system was prepared using the prostate cancer detection reagent provided by the present invention and the prepared cDNA sample. The reaction system included a cDNA sample, specific primers, and a probe. The relative expression levels (ΔCt values) of the four markers hsa-miR-12125, hsa-miR-21, hsa-miR-103, and hsa-miR-9903 in serum were detected using the real-time PCR method.

[0048] (5) Detection result judgment: In the training set, the Real-time PCR method was used to detect the differential expression of the four markers in the serum of the control group (42 healthy subjects) and prostate cancer patients (43 cases). The training set detection results are as follows Figure 2 As shown, Figure 2 When the present invention uses the training set to illustrate the diagnostic efficacy of the combined detection of markers, the comparison chart of the marker expression levels in the serum samples of the healthy control group and prostate cancer patients is shown as follows: Figure 2 As shown, the copy numbers of hsa-miR-12125 and hsa-miR-21 in prostate cancer patients were significantly higher than those in the control group, while the copy numbers of hsa-miR-103 and hsa-miR-9903 in prostate cancer patients were significantly lower than those in the control group. The test results showed that the expression levels of the four markers hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 in the serum of prostate cancer patients were significantly different from those in healthy people. The prostate cancer detection reagent provided by the present invention was used to detect the four markers in human peripheral blood serum samples, which can clearly distinguish between prostate cancer patients and healthy people. The four markers hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 can be used as specific markers for the diagnosis of prostate cancer.

[0049] Figure 3 This receiver operating characteristic (ROC) curve was constructed to demonstrate the diagnostic efficacy of the combined marker detection method using a training set. The results showed that this miRNA combination performed well in diagnosing prostate cancer, with an area under the ROC curve (AUC) of 0.937, indicating high accuracy in distinguishing prostate cancer patients from non-patients (P < 0.001).

[0050] (II) Verification of the diagnostic efficacy of combined marker detection using a validation set Validation set samples: cDNA samples from 43 prostate cancer patients and 42 healthy controls.

[0051] Detection reagent: The prostate cancer detection reagent provided by the present invention is used.

[0052] Detection objective: Detect the expression levels of markers hsa-miR-12125, hsa-miR-21, hsa-miR-103, and hsa-miR-9903 in the cDNA samples to be tested in the validation set.

[0053] The diagnostic performance of the prostate cancer detection reagent provided by the present invention in detecting the miRNA marker combination of the present invention was evaluated in the validation set. The experimental steps used in this validation experiment refer to the experimental steps used in the training set to demonstrate the diagnostic efficacy of the marker combination of the present invention in combined detection of prostate cancer.

[0054] The test results of 85 independent clinical samples in the validation set are shown in Figure 4 , Figure 4 The receiver operating characteristic (ROC) curve is established when the present invention uses the validation set to illustrate the diagnostic efficacy of the combined detection of markers. Figure 4 It shows that the area under the ROC curve (AUC) of the prostate cancer miRNA detection model provided by the present invention reaches 0.951, which indicates that the miRNA combination has potential clinical application value in the diagnosis of prostate cancer and can be used as an effective biomarker combination for the diagnosis of prostate cancer.

[0055] The comparison of the test results of 85 independent clinical samples in the validation set with the clinical results is shown in Table 4 below.

[0056] Table 4. Comparison of validation set test results and clinical results Prostate cancer patients Healthy people total Positive miRNA combination test 39 2 41 Negative miRNA panel test 4 40 44 total 43 42 85 As can be seen from Table 4: Among the 43 prostate cancer patient samples provided by clinical testing, this validation experiment detected 39 cases of prostate cancer as positive; among the 42 healthy control samples provided by clinical testing, this validation experiment detected 40 cases as negative, with an overall accuracy rate of 92.94%.

[0057] Therefore, the prostate cancer detection reagent provided by the present invention is used to jointly detect the four markers hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 to diagnose prostate cancer. The detection results are highly accurate and the diagnostic efficiency has high sensitivity and high specificity.

[0058] 3. Further testing of the sensitivity and specificity of prostate cancer detection reagents (1) Sensitivity test: qPCR detection was performed using standard solutions of target miRNAs hsa-miR-12125, hsa-miR-21, hsa-miR-103, and hsa-miR-9903 at different concentrations (10 nmol / L-1 fmol / L). The test results are shown in Table 5 below.

[0059] Table 5. Sensitivity test results Standard solution concentration 10nmoL / L 1nmoL / L 100pmoL / L 10pmoL / L 1pmoL / L 100fmoL / L 10fmoL / L 1fmoL / L Theoretical Ct value 20.2 23.5 26.8 30.1 33.4 36.7 40.0 43.3 Actual Ct value 20.2 23.6 26.7 30.4 33.7 36.8 39.8 42.4 From the sensitivity test results provided in Table 5, it can be concluded that the prostate cancer detection reagent of the present invention can detect the expression level of the target miRNA as low as 1 fM, and has high sensitivity.

[0060] (2) Specificity test: Cross-validation was performed using other non-prostate cancer-related miRNAs. The test results are shown in Table 6 below.

[0061] Table 6. Specificity test results Cancer type Gastric cancer Liver cancer pancreatic cancer Cervical cancer lung cancer Colorectal cancer Bladder cancer Prostate cancer Comprehensive judgment value -0.49 -0.56 -1.23 -0.17 -0.66 -1.02 -0.77 1.012 The specificity test results show that the prostate cancer detection reagent of the present invention has high specificity for prostate cancer, and all other cancer types are negative. Example 3

[0062] Preparation and validation of drugs for the treatment of prostate cancer 3.1 Preparation of drugs for the treatment of prostate cancer The present invention provides a drug for treating prostate cancer, comprising: inhibitors of hsa-miR-12125 and hsa-miR-21 genes, and mimics of hsa-miR-103 and hsa-miR-9903 genes; the nucleotide sequence of the hsa-miR-12125 inhibitor is shown in SEQ ID NO.13; the nucleotide sequence of the hsa-miR-21 inhibitor is shown in SEQ ID NO.14; the nucleotide sequence of the hsa-miR-103 mimic is shown in SEQ ID NO.15; and the nucleotide sequence of the hsa-miR-9903 mimic is shown in SEQ ID NO.16; the drug for treating prostate cancer inhibits the expression of hsa-miR-12125 and hsa-miR-21 genes, and increases the expression of hsa-miR-103 and hsa-miR-9903 genes, thereby inhibiting the occurrence and development of prostate cancer.

[0063] The nucleotide sequences of the inhibitors and mimics involved in the prostate cancer treatment drugs of the present invention are shown in Table 3.

[0064] 3.2 Validation Experiments of Prostate Cancer Therapeutic Drugs (1) Animal model validation: 5×10 6 A prostate cancer model was established by subcutaneously inoculating 6-week-old NSG mice with the human prostate cancer LNCaP cell line to evaluate the efficacy of the therapeutic agent of the present invention. The experimental groups were as follows: Blank control group: no drug combination was injected Experimental group 1: intravenous injection of miR-12125 inhibitor Experimental group 2: intravenous injection of miR-21 inhibitor Experimental group 3: intravenous injection of miR-103 mimics Experimental group 4: intravenous injection of miR-9903 mimics Experimental group 5: Simultaneous intravenous injection of miR-12125 inhibitor and miR-21 inhibitor Experimental group 6: simultaneous intravenous injection of miR-12125 inhibitor and miR-103 mimics Experimental group 7: simultaneous intravenous injection of miR-12125 inhibitor and miR-9903 mimics Experimental group 8: Simultaneous intravenous injection of miR-21 inhibitor and miR-103 mimics Experimental group 9: simultaneous intravenous injection of miR-21 inhibitor and miR-9903 mimics Experimental group 10: simultaneous intravenous injection of miR-103 mimics and miR-9903 mimics Experimental group 11: Simultaneous intravenous injection of miR-12125 inhibitor, miR-21 inhibitor and miR-103 mimics Experimental group 12: Simultaneous intravenous injection of miR-12125 inhibitor, miR-21 inhibitor and miR-9903 mimics Experimental group 13: Simultaneous intravenous injection of miR-12125 inhibitor, miR-103 mimics, and miR-9903 mimics Experimental group 14: Simultaneous intravenous injection of miR-21 inhibitor, miR-103 mimics, and miR-9903 mimics Experimental group 15: Simultaneous intravenous injection of miR-12125 inhibitor, miR-21 inhibitor, miR-103 mimics, and miR-9903 mimics (2) Efficacy evaluation: The volume changes of nude mouse transplanted tumors were measured and recorded in real time. The tumor volume was calculated using the formula V = A × B² / 2 (mm³), where A is the maximum diameter and B is the vertical diameter. When the tumor volume reached 1000 mm³, the mice were sacrificed, and the tumors were excised and weighed. The results are shown in Table 7 below: Table 7. Tumor size and weight of each group Group <![CDATA[Tumor volume at sacrifice (mm 3 )]]> Tumor weight at sacrifice (g) Blank control group 1000.00 0.98 Experimental Group 1 812.65 0.79 Experimental Group 2 796.31 0.77 Experimental Group 3 782.84 0.76 Experimental Group 4 801.69 0.78 Experimental Group 5 610.38 0.59 Experimental Group 6 623.51 0.60 Experimental Group 7 598.41 0.47 Experimental Group 8 534.55 0.51 Experimental Group 9 496.30 0.47 Experimental group 10 516.21 0.49 Experimental Group 11 426.42 0.40 Experimental group 12 414.72 0.38 Experimental Group 13 460.64 0.44 Experimental group 14 432.69 0.41 Experimental group 15 206.44 0.18 The experiments demonstrated that the combination of a miR-12125 inhibitor, a miR-21 inhibitor, miR-103 mimics, and miR-9903 mimics (experimental group 15) was the most effective in treating prostate cancer, followed by any combination of the three (experimental groups 11 to 14), followed by any combination of two (experimental groups 5 to 10), and finally by any single treatment (experimental groups 1 to 4). However, all treatment groups showed superior therapeutic effects compared to the blank control group. This demonstrates that the prostate cancer treatment drug provided by the present invention can effectively inhibit the occurrence and progression of prostate cancer.

[0065] In summary, the prostate cancer marker combination hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 provided by the present invention can be used as a specific marker for the diagnosis of prostate cancer.

[0066] The prostate cancer detection reagent provided by the present invention has high sensitivity and high specificity, and can specifically detect the expression of markers hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 in samples. It has excellent diagnostic performance, improves the accuracy of prostate cancer detection, and is beneficial to the early screening and treatment of prostate cancer.

[0067] The prostate cancer treatment drug provided by the present invention can effectively inhibit the occurrence and development of prostate cancer by inhibiting the expression of hsa-miR-12125 and hsa-miR-21 genes and increasing the expression of hsa-miR-103 and hsa-miR-9903 genes, and has important clinical application value.

[0068] The prostate cancer marker combination, prostate cancer detection reagent, and prostate cancer treatment drug provided by the present invention have all been fully verified through experiments, ensuring their effectiveness and reliability in the diagnosis and treatment of prostate cancer.

[0069] The embodiments of the present invention are intended only to illustrate specific embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art may make various improvements, modifications, and substitutions to the present invention within the spirit and scope of the present invention, and such improvements, modifications, and substitutions shall all be included within the scope of protection of the present invention.

Claims

1. A prostate cancer marker combination, characterized in that: The present invention is composed of four miRNA markers associated with prostate cancer, namely hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903, wherein the nucleotide sequence of hsa-miR-12125 is shown in SEQ ID NO.1, the nucleotide sequence of hsa-miR-21 is shown in SEQ ID NO.2, the nucleotide sequence of hsa-miR-103 is shown in SEQ ID NO.3, and the nucleotide sequence of hsa-miR-9903 is shown in SEQ ID NO.

4.

2. Application of the prostate cancer marker combination hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 in the preparation of prostate cancer detection reagents.

3. The use according to claim 2, characterized in that The prostate cancer detection reagent includes the following reagents: Reagents for specifically detecting the expression level of hsa-miR-12125 are primers for the nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 9; Reagents for specifically detecting hsa-miR-21 expression, comprising primers with the nucleotide sequences shown in SEQ ID NO. 6 and SEQ ID NO. 9; Reagents for specifically detecting hsa-miR-103 expression, comprising primers with the nucleotide sequences shown in SEQ ID NO. 7 and SEQ ID NO. 9; Reagents for specifically detecting the expression of hsa-miR-9903, comprising primers for the nucleotide sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9; The primers exist independently or are mixed to form a mixture.

4. The use according to claim 3, characterized in that The prostate cancer detection reagent further includes reagents selected from the following group: internal reference primers, Taq enzyme, dNTPs, PCR buffer, MgCl2, TagMan probe, and fluorescent quantitative PCR reference dye.

5. The use according to any one of claims 2 to 4, characterized in that: The detection sample targeted by the prostate cancer detection reagent is a cDNA sample prepared from human peripheral blood.

6. Application of the prostate cancer marker combination hsa-miR-12125, hsa-miR-21, hsa-miR-103 and hsa-miR-9903 in the preparation of prostate cancer therapeutic drugs.

7. The use according to claim 6, characterized in that The prostate cancer treatment drug includes: inhibitors of hsa-miR-12125 and hsa-miR-21 genes, and mimics of hsa-miR-103 and hsa-miR-9903 genes; the nucleotide sequence of the hsa-miR-12125 inhibitor is shown in SEQ ID NO.13; the nucleotide sequence of the hsa-miR-21 inhibitor is shown in SEQ ID NO.14; the nucleotide sequence of the hsa-miR-103 mimic is shown in SEQ ID NO.15; and the nucleotide sequence of the hsa-miR-9903 mimic is shown in SEQ ID NO.16; the prostate cancer treatment drug inhibits the expression of hsa-miR-12125 and hsa-miR-21 genes, and increases the expression of hsa-miR-103 and hsa-miR-9903 genes, thereby inhibiting the occurrence and development of prostate cancer.

Images