Primer pair, probe and kit for detecting Nipah virus and Hendea virus and application of primer pair, probe and kit

Through the combination of RT-RAA-nfo primer pair and single-strand DNA probe with CRISPR/Cas13a system, rapid visual detection of Nipah virus and Hendra virus is achieved, solving the cumbersome and time-consuming detection in the prior art, with high sensitivity and specificity, and is suitable for epidemic sites and grassroots laboratories.

CN120555657APending Publication Date: 2025-08-29JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510737386.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-08-29

AI Technical Summary

Technical Problem

The methods for detecting Nipah virus and Hendra virus in the prior art have cumbersome detection processes, long time-consuming, high requirements for testing personnel and equipment, and it is difficult to achieve rapid identification and testing at the site of the epidemic.

Method used

Using RT-RAA-nfo primer pairs and single-stranded DNA probes, combined with the CRISPR/Cas13a system, rapid visual detection of Nipah virus and Hendra virus was achieved in a fully enclosed centrifuge tube through RT-RAA-nfo amplification and CRISPR/Cas13a reaction, and the detection results were judged using a blue light meter.

Benefits of technology

It realizes rapid, simple and visual identification and detection of Nipah virus and Hendra virus in the epidemic site or in grassroots laboratories, with high sensitivity and specificity, avoids aerosol contamination and reduces the requirements for equipment and personnel.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555657A_ABST
    Figure CN120555657A_ABST
Patent Text Reader

Abstract

The invention discloses a primer pair, a probe and a kit for detecting Nipah virus and Hendea virus and application of the primer pair, the probe and the kit, and belongs to the technical field of molecular biology. The invention provides a primer pair and a probe for detecting a Nipah virus and a Hendea virus in order to solve the technical problems that a method for detecting the Nipah virus and the Hendea virus in the prior art is tedious in detection process, long in time consumption and relatively high in requirements on detection personnel and equipment, and provides a primer pair and a probe for detecting the Nipah virus and the Hendea virus. The invention also provides a single probe kit and a multi-probe kit containing the primer pair and the probe. The kit provided by the invention has relatively high specificity and sensitivity on detection of the Nipah virus and the Hendea virus, and can realize rapid visual identification and detection of the Nipah virus and the Hendea virus on an epidemic disease site.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and in particular relates to a primer pair, a probe, a kit and applications thereof for detecting Nipah virus and Hendra virus. Background Art

[0002] Nipah virus (NiV) and Hendra virus (HeV) both belong to the Paramyxoviridae family, Henipavirus genus, and are single-stranded, negative-sense RNA viruses. Laboratory detection methods for NiV and HeV include etiological testing, serological testing, immunofluorescence staining, and nucleic acid testing. Virus isolation and culture is the gold standard for virological testing, which is highly specific but cumbersome and time-consuming. Serological testing, such as the enzyme-linked immunosorbent assay (ELISA), is also available. While immunofluorescence staining is feasible, samples infected with NiV and HeV must be handled in a BSL-4 laboratory, which carries a high risk of infection for the operator.

[0003] Currently, nucleic acid testing is the most widely used laboratory diagnostic method. However, traditional nucleic acid testing methods, such as RT-PCR and real-time RT-PCR, are complex, require specialized personnel and equipment, and are time-consuming, making them unsuitable for rapid on-site testing. Furthermore, NiV and HeV have a high degree of cross-host interaction, infecting humans, fruit bats, pigs, horses, and dogs. NiV and HeV often present with similar neurological and respiratory symptoms when infecting humans and animals. Due to the non-specificity of these symptoms, accurate differentiation between the two viruses based solely on clinical presentation is difficult.

[0004] Therefore, those skilled in the art are eager to develop an efficient, specific and rapid on-site identification and detection method for NiV and HeV, so as to achieve rapid identification and detection of NiV and HeV at the epidemic site or grassroots laboratories. Summary of the Invention

[0005] The present invention aims to solve the technical problems in the existing methods for detecting Nipah virus and Hendra virus, such as the complicated detection process, long time consumption, and high requirements on detection personnel and equipment. A primer pair, probe, kit and application thereof for detecting Nipah virus and Hendra virus are provided.

[0006] One of the objects of the present invention is to provide a primer pair for detecting Nipah virus and Hendra virus, the primer pair comprising an RT-RAA-nfo forward primer and an RT-RAA-nfo reverse primer, the nucleotide sequence of the RT-RAA-nfo forward primer being shown in SEQ ID NO.1, and the nucleotide sequence of the RT-RAA-nfo reverse primer being shown in SEQ ID NO.2.

[0007] A second object of the present invention is to provide a probe for detecting Nipah virus and Hendra virus, wherein the probe is a single-stranded DNA probe P1, and the nucleotide sequence of the single-stranded DNA probe P1 is shown in SEQ ID NO.5.

[0008] A third object of the present invention is to provide a probe combination for detecting Nipah virus and Hendra virus, wherein the probe combination comprises a single-stranded DNA probe P1 and a single-stranded DNA probe P3, wherein the nucleotide sequence of the single-stranded DNA probe P1 is shown in SEQ ID NO.5, and the nucleotide sequence of the single-stranded DNA probe P3 is shown in SEQ ID NO.17.

[0009] A fourth object of the present invention is to provide a single probe kit for detecting Nipah virus and Hendra virus, wherein the single probe kit contains the above-mentioned primer pair and probe.

[0010] A fifth object of the present invention is to provide a multiplex probe kit for detecting Nipah virus and Hendra virus, wherein the multiplex probe kit contains the above-mentioned primer pair and probe combination.

[0011] A sixth object of the present invention is to provide a method for using the above-mentioned single probe kit for non-diagnostic purposes, the method comprising the following steps: Prepare an RT-RAA-nfo amplification system containing the target to be tested and place it at the bottom of a centrifuge tube; prepare a CRISPR / Cas13a reaction system and place it at the bottom of a cannula; invert the cannula into the centrifuge tube containing the RT-RAA-nfo reaction system, seal it, and place it in a thermal cycler or water bath at 37°C to first perform the RT-RAA-nfo amplification reaction and then the CRISPR / Cas13a reaction to obtain a reactant; use a blue light analyzer to visually detect the reactants and judge the results.

[0012] In a preferred embodiment of the present invention, the RT-RAA-nfo amplification system is as follows: 5 μL of target to be detected, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM single-stranded DNA probe, 25 μL of rehydration buffer, 12.9 μL of RNase-free ddH2O, mixed, and then added 2.5 μL of 280 mM magnesium acetate solution; The CRISPR / Cas13a reaction system is as follows: 0.8 μL of 5 μM LbuCas13a, 1 μL of 2 μM crRNA, 1.6 μL of 50,000 units / mL T7 RNA polymerase, 1.6 μL of 100 mM rNTP, 2 μL of 10 μM ssRNA reporter, 2 μL of 10× Buffer, and RNase-free ddH2O to 20 μL. The crRNA nucleotide sequence is shown in SEQ ID NO.12; The RT-RAA-nfo amplification reaction was performed at a temperature of 37°C and for 40 min; The temperature of the CRISPR / Cas13a reaction was 37° C. and the reaction time was 20 min.

[0013] A seventh object of the present invention is to provide a method for using the multiple probe kit for non-diagnostic purposes, the method comprising the following steps: Prepare an RT-RAA-nfo amplification system containing the target to be detected, place it in a thermal cycler or water bath at 37°C to perform the RT-RAA-nfo amplification reaction to obtain a reactant; use a blue light analyzer to visually detect the reactant and determine the results; The RT-RAA-nfo amplification system is as follows: 5 μL of target to be detected, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM single-stranded DNA probe P1, 0.6 μL of 10 μM single-stranded DNA probe P3, 25 μL of rehydration buffer, 12.3 μL of RNase-free ddH2O, mix well, and add 2.5 μL of 280 mM magnesium acetate solution; The temperature of the RT-RAA-nfo amplification reaction is 37° C. and the time is 20 min.

[0014] In a preferred embodiment of the present invention, the visual detection result judgment standard is: If green fluorescence appears when observed under a blue light instrument, it indicates that the sample contains Nipah virus; If red fluorescence appears under a blue light analyzer, it indicates that the sample contains Hendra virus; If orange fluorescence appears when observed under a blue light analyzer, it indicates that the sample contains both Nipah virus and Hendra virus; If no fluorescence is observed under a blue light analyzer, it indicates that the sample does not contain Nipah virus or Hendra virus.

[0015] An eighth object of the present invention is to provide the use of the above-mentioned single probe kit and the above-mentioned multiple probe kit in the visual detection of Nipah virus and Hendra virus.

[0016] Beneficial effects of the present invention: The present invention provides a primer pair and probe for detecting Nipah virus and Hendra virus. The primer pair comprises an RT-RAA-nfo forward primer and an RT-RAA-nfo reverse primer, wherein the nucleotide sequence of the RT-RAA-nfo forward primer is shown in SEQ ID NO. 1, and the nucleotide sequence of the RT-RAA-nfo reverse primer is shown in SEQ ID NO. 2. The probes are single-stranded DNA probe P1 having a nucleotide sequence shown in SEQ ID NO. 5, and a probe combination (single-stranded DNA probe P1 and single-stranded DNA probe P3) having nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 17. The present invention also provides a single probe kit comprising the primer pair and single-stranded DNA probe P1, and a multiple probe kit comprising the primer pair, single-stranded DNA probe P1, and single-stranded DNA probe P3.

[0017] 1) The present invention compared the gene sequences of 10 NiV strains and 10 HeV strains, screening and identifying conserved regions of the P genes of both strains as targets. The final detection targets were nucleotides 2471-2688 of the NiV base sequence and nucleotides 2453-2670 of the HeV base sequence, ensuring primer specificity. Universal primers suitable for RT-RAA-nfo visualization detection and probes specifically recognizing NiV were designed for target sequences in the P protein genes of NiV and HeV. The target sequences are highly conserved in the NiV and HeV P genes. Specificity tests verified that the primers and probes provided by the present invention did not cross-react with other viruses (JEV, RABV, HSV-1, and Streptococcus suis) that have similar clinical symptoms to Nipah and Hendra virus infections. This demonstrates that the detection kit provided by the present invention has high specificity.

[0018] 2) The present invention provides a kit for detecting Nipah virus and Hendra virus; First, the single probe kit provided by the present invention is targeted at a single sample, and the detection sensitivity can reach 5.2×10 3 copies / μL NiV RNA transcripts, 5.2×10 2 copies / μL HeV RNA transcripts; in the case of coexistence of NiV and HeV RNA transcripts, the single probe kit can detect as low as 5.2×10 2copies / μL of mixed samples. It can be seen that the single probe kit provided by the present invention has a high sensitivity for the detection of Nipah virus and Hendra virus. Secondly, the multiple probe kit provided by the present invention has a detection sensitivity of 5.2×10 4 copies / μL NiV RNA transcripts, 5.2×10 3 It can be seen that the multiplex probe kit provided by the present invention has high sensitivity for the detection of Nipah virus and Hendra virus.

[0019] 3) The kit for detecting Nipah virus and Hendra virus provided by the present invention; first, the single probe kit provided by the present invention combines RT-RAA-nfo technology with the CRISPR / Cas13a system, does not require precise temperature-changing equipment, and can obtain effective amplification of NiV or HeV target genes under constant temperature conditions; the primer probe provided by the present invention is used to realize simultaneous amplification of NiV and HeV nucleic acid samples in one reaction system, and the RAA fluorescent probe that specifically recognizes NiV and the crRNA that recognizes HeV in the detection system are used to realize the identification and detection of NiV and HeV; the whole process is carried out in a fully enclosed centrifuge tube, which not only realizes the visualization of the results, but also avoids false positive results caused by aerosols, and realizes rapid visualization and identification detection at the epidemic site. Secondly, the multiple probe kit provided by the present invention only uses RT-RAA-nfo technology to realize the detection of Nipah virus and Hedra virus, realizing rapid visualization and identification detection at the epidemic site.

[0020] In summary, the detection method provided by the present invention does not require professional instruments and experimental personnel, and can realize rapid identification and detection of NiV and HeV at the epidemic site or grassroots laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : is the screening result diagram of the primer probe for the RT-RAA-nfo reaction in Example 1; : is the screening result diagram of the primer A, and : is the screening result diagram of the probe B; Figure 2 This is a diagram showing the results of temperature optimization for the RT-RAA-nfo reaction in Example 3; Figure 3 This is a graph showing the sensitivity test results of the RT-RAA-nfo detection method in Example 3; Figure 4 This is a graph showing the results of crRNA screening in the CRISPR / Cas13a reaction in Example 3; Figure 5 This is a graph showing the optimization results of Cas13a protein concentration in the CRISPR / Cas13a reaction in Example 3; Figure 6 This is a graph showing the results of crRNA concentration optimization in the CRISPR / Cas13a reaction in Example 3; Figure 7 This is a graph showing the probe concentration optimization results in the CRISPR / Cas13a reaction in Example 3; Figure 8 This is a graph showing the optimization results of T7 RNA polymerase concentration in the CRISPR / Cas13a reaction in Example 3; Figure 9 This is a graph showing the optimization results of rNTP concentration in the CRISPR / Cas13a reaction in Example 3; Figure 10 This is a graph showing the sensitivity test results of the single probe kit in Example 3; Figure 11 Graph showing the specificity detection results of the single probe kit in Example 3; Figure 12 Figures 1 and 2 are the clinical sample detection results of the single probe kit in Example 3; Figure A is the NiV sample detection result, Figure B is the HeV sample detection result, and Figure C is the NiV and HeV mixed sample detection result; Figure 13 Figures 1 and 2 are sensitivity test results of the multiple probe kit in Example 5; Figure A is the HeV sample test result, and Figure B is the NiV sample test result; Figure 14 This is a diagram showing the specificity detection results of the multiple probe kit in Example 5. DETAILED DESCRIPTION

[0022] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is obvious that relevant persons can modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0023] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments. The experimental methods used in the following examples are all conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained from commercial channels by those skilled in the art.

[0024] The Nipah virus (NiV) RNA transcripts and Hendra virus (HeV) RNA transcripts used in the following examples were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; RT-RAA-nfo was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; and the viral RNA / DNA extraction kit was purchased from Takara Biotechnology (Dalian) Co., Ltd.

[0025] NiV RNA transcripts and HeV RNA transcripts were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; RT-RAA-nfo was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; and the viral RNA / DNA extraction kit was purchased from Takara Biotechnology (Dalian) Co., Ltd.

[0026] Example 1: Preparation of primer pairs and probes for detecting Nipah virus and Hendra virus 1. Preparation of Primers for Detection of Nipah and Hendra Viruses In this example, the MEGA7 software was used to compare the gene sequences of 10 NiV strains, including existing variants, isolated from different countries, regions, and at different times, published in the GeneBank and GISAID databases, as well as 10 HeV strain gene sequences from different times and locations. The strain information is shown in Table 1. Based on the sequence alignment results, the P protein gene was selected as the detection target gene for this example. The conserved regions screened were analyzed and compared with members of the MojV, LayV, and CedV Henipavirus genera, and the nucleotide sequence at positions 2471-2688 of the NiV base sequence and the nucleotide sequence at positions 2453-2670 of the HeV base sequence were ultimately determined as the final detection target.

[0027] RT-RAA-nfo primers were designed for the target sequences on the P protein genes of the above-mentioned NiV and HeV, as shown in Table 2.

[0028] Table 1

[0029] Table 2

[0030] 2. Preparation of a single-stranded DNA probe specific for Nipah virus RT-RAA-nfo Based on the NiV detection target and HeV detection target obtained in this example, a single-stranded DNA probe that can specifically identify NiV was designed. The probes have more than 10 mismatched bases with the HeV gene sequence, so they will not cross-recognize HeV. The single-stranded DNA probes P1 and P2 are respectively composed of 58 bases, wherein the 41st base is replaced by tetrahydrofuran (THF), and a pair of thymine T bases are designed on both sides of the THF site at an interval of ≤5 bases, wherein one of the T residues is replaced by a dT-FAM fluorescent group and the other T base is replaced by a dT-BHQ1 quenching group. The 3' end is modified with C3-Spacer, and the nucleotide sequence is shown in SEQ ID NO.5-6. Based on the NiV detection target and HeV detection target obtained in this example, a single-stranded DNA probe that can specifically identify HeV was designed. The above probe has more than 10 mismatched bases with the NiV gene sequence, so it will not cross-recognize NiV; the single-stranded DNA probe P3 consists of 56 bases, of which the 35th base is replaced by tetrahydrofuran THF, and a pair of thymine T bases are designed on both sides of the THF site with an interval of ≤5 bases, one of the T residues is replaced by a dT-ROX fluorescent group, and the other T base is replaced by a dT-BHQ2 quenching group, and the 3' end is modified with C3-Spacer. The nucleotide sequence is shown in SEQ ID NO.17, as shown in Table 3.

[0031] Table 3

[0032] Note: FAM is carboxyfluorescein; BHQ1 is black hole quencher-1; ROX is 6-carboxy-X-rhodamine succinimidyl ester; BHQ2 is black hole quencher-2; THF is tetrahydrofuran; C3-spacer is polymer extension blocker.

[0033] 3. Screening of primer pairs for RT-RAA-nfo reaction The RT-RAA-nfo primers (nucleotide sequences shown in SEQ ID NO. 1-4) prepared in this example were screened, and the RT-RAA-nfo amplification system (as shown in Table 4) was prepared on ice at a concentration of 5.2×10 4 RT-RAA-nfo reaction was performed using 10 copies / μL of NiV RNA transcripts (nucleotide sequence shown in SEQ ID NO.7) as targets. A negative control group was set up in which RNase-Free ddH2O was used instead of the target. The reaction tubes were placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 35 minutes. The fluorescence signal was collected once every minute and quantitatively analyzed.

[0034] The results are as follows Figure 1 As shown in part A, the fluorescence signal performance of the primer pair FⅠ and RI was better than that of the primer pair FⅡ and RI, so the primers FⅠ and RI were selected for the detection of Nipah virus and Hendra virus.

[0035] 4. Screening of RT-RAA-nfo Reactive Probes Based on the above-identified FⅠ and RI primer pairs (nucleotide sequences are shown in SEQ ID NOs. 1-2), single-stranded DNA probes P1 and P2 were further screened. The RT-RAA-nfo amplification system was prepared on ice. The single-stranded DNA probes with nucleotide sequences shown in SEQ ID NOs. 5-6 were added to the RT-RAA-nfo amplification system, and NiV RNA transcripts were serially diluted tenfold (5.2×10 4 -5.2×10 0 The optimal single-stranded DNA probe was evaluated using different concentrations of NiV RNA transcripts as the target. At the same time, a negative control group was set up with RNase-Free ddH2O as the target. The reaction system was placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 20 min. The fluorescence signal was collected every minute and quantitatively analyzed.

[0036] The results are as follows Figure 1 As shown in part B, the fluorescence signal of the P1 single-stranded DNA probe is significantly stronger than that of the P2 single-stranded DNA probe. Therefore, the P1 single-stranded DNA probe was selected for the detection of Nipah virus and Hendra virus.

[0037] Table 4

[0038] Example 2: Preparation of a single probe kit for detecting Nipah virus and Hendra virus The kit described in this embodiment includes an RT-RAA-nfo primer pair and a single-stranded DNA probe P1; the primer pair includes an RT-RAA-nfo forward primer and an RT-RAA-nfo reverse primer, the nucleotide sequence of the RT-RAA-nfo forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the RT-RAA-nfo reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the single-stranded DNA probe P1 is shown in SEQ ID NO.5.

[0039] The RT-RAA-nfo amplification system in the single probe kit is as follows: 5 μL of the target to be detected, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM single-stranded DNA probe, 25 μL of rehydration buffer, 12.9 μL of RNase-free ddH2O, mix well, and then add 2.5 μL of 280 mM magnesium acetate solution; The CRISPR / Cas13a reaction system in the single probe kit is: 0.8 μL of 5 μM LbuCas13a, 1 μL of 2 μM crRNA, 1.6 μL of 50,000 units / mL T7 RNA polymerase, 1.6 μL of 100 mM rNTP, 2 μL of 10 μM ssRNA reporter, 4 μL of 10× Buffer, and RNase-free ddH2O to 20 μL.

[0040] Example 3: Application of a kit for detecting Nipah virus and Hendra virus in visual detection of Nipah virus and Hendra virus 1. The single probe kit prepared in Example 2 was used to detect Nipah virus and Hendra virus, comprising the following steps: Take 45 µL of the premixed solution of the RT-RAA-nfo amplification system and transfer it to the bottom of a new centrifuge tube, add 5 µL of the target to be tested for RT-RAA-nfo amplification reaction; prepare the CRISPR / Cas13a reaction system according to Table 5 and place it at the bottom of the sleeve; then invert the sleeve into the centrifuge tube containing the RT-RAA-nfo reaction system, seal the centrifuge tube, and place it in a thermal cycler or water bath at 37°C to first perform the RT-RAA-nfo amplification reaction and then the CRISPR / Cas13a reaction to obtain the reactants. In a sealed reaction tube, aerosol contamination can be avoided; use a blue light instrument to visualize the detection results of the above reactants, and all detection reactions are repeated 3 times; the temperature of the RT-RAA-nfo reaction is 37°C and the time is 40 min; the temperature of the CRISPR / Cas13a reaction is 37°C and the time is 20 min.

[0041] The judgment standard of the visual detection result is: using a mobile phone or naked eye to observe, if green fluorescence appears under a blue light meter, it indicates that the sample contains Nipah virus; if red fluorescence appears under a blue light meter, it indicates that the sample contains Hendra virus; if orange fluorescence appears under a blue light meter, it indicates that the sample contains Nipah virus and Hendra virus coexisting; if no fluorescence appears under a blue light meter, it indicates that the sample does not contain Nipah virus and Hendra virus.

[0042] Table 5

[0043] 2. Optimization of the RT-RAA-nfo Detection Method (1) Optimization of the RT-RAA-nfo amplification reaction procedure; In this embodiment, 5.2×10 4 Copies / μL of NiV RNA transcripts (nucleotide sequence shown in SEQ ID NO. 7) were used as the target, and a negative control group was set up in which RNase-Free ddH2O was used instead of the target. The RT-RAA-nfo primer amplification system was as follows: 2 μL each of 10 μM upstream and downstream primers, 0.6 μL of 10 μM single-stranded DNA probe, 25 μL of rehydration buffer, 5 μL of the sample RNA template to be tested, and 12.9 μL of ddH2O. After mixing, 2.5 μL of 280 mM magnesium acetate solution was added. The reaction was incubated in a fluorescence quantitative PCR instrument at constant temperatures of 37°C, 39°C, and 42°C for 20 min.

[0044] The results are as follows Figure 2 As shown, the fluorescence signal detected at 37°C was significantly better than that at 39°C and 42°C, indicating that 37°C is the optimal temperature for RT-RAA-nfo amplification reaction.

[0045] In this example, a ten-fold serial dilution of NiV RNA transcript (nucleotide sequence shown in SEQ ID NO.7) was used as the target (5.2×10 3 -5.2×10 0 The sensitivity of the NiV RT-RAA-nfo detection method was evaluated by PCR (1000 copies / μL); the cells were incubated at 37°C in a fluorescence quantitative PCR instrument for 20 min.

[0046] The results are as follows Figure 3 As shown in Figure 2, the sensitivity of the RT-RAA-nfo detection method reached 5.2×10 2 copies / μL.

[0047] 3. Design and Screening of CRISPR / Cas13a Reaction Systems (1) Design of CRISPR / Cas13a reaction system: Within the highly conserved region of the P gene of NiV and HeV, eight CRISPR / Cas13a crRNAs (nucleotide sequences shown in SEQ ID NOs. 8-15) that specifically recognize HeV were designed using the online tool CRISPR RGEN Tools (http: / / www.rgenome.net / ) based on the PFS (protospacer short palindromic repeat) site requirements of the Cas13a system. The specific sequence information is shown in Table 6.

[0048] Based on the online design results, eight double-stranded DNA (dsDNA) templates with a T7 promoter were synthesized. Their sequence structures were as follows: T7 promoter sequence (gaaattaatacgactcactataggg) + Cas13a crRNA backbone sequence (GACCACCCCAAAAATGAAGGGGACTAAAAC) + target sequence. The dsDNA templates were incubated with T7 RNA polymerase overnight at 37°C using the HiScribe™ T7 High-Yield RNA Synthesis Kit (NEB, Beijing) to transcribe crRNA. The crRNA obtained above was purified using the Monarch® RNA Cleanup Kit (NEB, Beijing), and its concentration was measured using an Implen N60 UV-visible spectrophotometer.

[0049] Table 6

[0050] (2) Screening of crRNA in CRISPR / Cas13a reaction system: In this example, the optimal crRNA was screened in a 20 μL CRISPR / Cas13a reaction system. The system contained the following components: 200 nM Cas13a protein, 25 nM crRNA, 500 nM ssRNA reporter, 2 U T7 polymerase, 1 mM rNTP, 100 ng HeV RNA transcript, and 2 μL 10× Borealis buffer. The system was made up to 20 μL with RNase-Free ddH2O.

[0051] The above eight crRNAs were added to the system separately, and three replicate wells were set up for each crRNA. To ensure that the method specifically recognized only HeV and that subsequent experiments were not interfered with by NiV, HeV RNA transcripts (nucleotide sequence shown in SEQ ID NO.16) were used as positive controls, and NiV RNA transcripts (nucleotide sequence shown in SEQ ID NO.7) were used as negative controls. The reaction system was placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 40 minutes. The fluorescence signal was collected every 1 minute. The optimal crRNA in the CRISPR / Cas13a system was screened by comparing the fluorescence reaction time and fluorescence signal intensity.

[0052] The results are as follows Figure 4 As shown, only crRNA5 represented by nucleotide sequence 1612 can produce a strong fluorescent signal in the CRISPR / Cas13a reaction system. Therefore, crRNA5 was selected for detecting Nipah virus and Hendra virus CRISPR / Cas13a reaction systems.

[0053] 4. Optimization of CRISPR / Cas13a Reaction System (1) Optimization of Cas13a protein concentration in the CRISPR / Cas13a reaction system: In this example, the optimal Cas13a protein concentration was determined. The Cas13a protein concentrations were set to 25 nM, 50 nM, and 100 nM, respectively. A negative control group (NTC) was set, and RNase-Free ddH2O was used instead of the target. A total of four groups were tested. The CRISPR / Cas13a reaction system was placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 40 min. The fluorescence signal was collected every 1 min. The optimal Cas13a protein concentration was screened by comparing the fluorescence reaction time and the fluorescence signal intensity.

[0054] The results are as follows Figure 5 As shown in the figure, as the concentration of Cas13a protein increases, the trans-cleavage activity of Cas13a gradually increases, but the baseline value of the negative control group also increases. Therefore, a 50 nM concentration of Cas13a protein is optimal for the CRISPR / Cas13a reaction system.

[0055] (2) Optimization of crRNA concentration in CRISPR / Cas13a reaction system: In this example, to determine the optimal crRNA concentration, crRNA concentrations were set at 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM, respectively. A negative control group (NTC) was also set up, and RNase-free ddH2O was used instead of the target. Three replicates were set for each condition. The CRISPR / Cas13a reaction system was placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 40 min. The fluorescence signal was collected every 1 min. The optimal crRNA concentration was screened by comparing the fluorescence reaction time and the fluorescence signal intensity.

[0056] The results are as follows Figure 6 As shown, 25 nM crRNA concentration is the best choice for CRISPR / Cas13a reaction system.

[0057] (3) Optimization of probe concentration in CRISPR / Cas13a reaction system In this example, to determine the optimal probe concentration, probe concentrations were set at 300 nM, 400 nM, 500 nM, 600 nM, and 700 nM, respectively. A negative control group was also established, and RNase-free ddH2O was used instead of the target. Three replicates were set for each condition. The reaction system was placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 40 min. The fluorescence signal was collected every 1 min. The optimal probe concentration was screened by comparing the fluorescence reaction time and the fluorescence signal intensity.

[0058] The results are as follows Figure 7 As shown in the figure, as the probe concentration increases, the fluorescence signal becomes better, and the negative background value is within an acceptable range. Considering the effect and cost, a 600 nM concentration of probe is the best choice for the CRISPR / Cas13a reaction system.

[0059] (4) Optimization of T7 RNA polymerase concentration in the CRISPR / Cas13a reaction system: Based on the above optimization results of Cas13a protein and crRNA concentrations, the concentration of T7 RNA polymerase was further optimized; the T7 RNA polymerase concentrations were set to 1 U, 2 U, 3 U, 4 U, and 5 U, respectively. A negative control group was set up, and RNase-FreeddH2O was used instead of the target. Three replicates were set for each condition. The CRISPR / Cas13a reaction system was placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 40 min. The fluorescence signal was collected every 1 min. The optimal T7 RNA polymerase concentration was screened by comparing the fluorescence reaction time and the fluorescence signal intensity.

[0060] The results are as follows Figure 8As shown in the figure, as the concentration of T7 RNA polymerase increases, the fluorescence signal becomes better, and the negative background value does not increase. However, considering the cost issue, 1 U T7 RNA polymerase is the best choice for the CRISPR / Cas13a reaction system.

[0061] (5) Optimization of rNTP concentration in CRISPR / Cas13a reaction system: Based on the above optimization results of Cas13a protein, crRNA, and T7 RNA polymerase concentrations, the rNTP concentration was further optimized; the rNTP concentrations were set to 1 mM, 2 mM, 3 mM, 4 mM, and 5 mM, respectively. A negative control group was set up, and RNase-FreeddH2O was used instead of the target. Three replicates were set for each condition. The CRISPR / Cas13a reaction system was placed in a fluorescence quantitative PCR instrument and incubated at 37°C for 40 min. The fluorescence signal was collected every 1 min. The optimal rNTP concentration was screened by comparing the fluorescence reaction time and the fluorescence signal intensity.

[0062] The results are as follows Figure 9 As shown in the figure, as the rNTP concentration increases, the fluorescence signal decreases, and the fluorescence signal is best when the rNTP concentration is 2 mM; therefore, 2 mM rNTP concentration is the best choice for the CRISPR / Cas13a reaction system.

[0063] Effect experiment: In this example, in order to evaluate the detection effect of the single probe kit prepared in Example 2 on Nipah virus and Hendra virus, sensitivity detection, specificity detection and clinical sample evaluation were performed.

[0064] 1. Sensitivity test To evaluate the sensitivity of the above detection method, NiV RNA and HeV RNA transcripts were diluted tenfold (5.2×10 5 -5.2×10 1 The sensitivity of the detection method was evaluated using different concentrations of NiV RNA and HeV RNA transcripts as targets. RT-RAA-nfo reactions were performed at 37°C for 40 min, followed by CRISPR / Cas13a reactions at 37°C for 20 min.

[0065] The results are as follows Figure 10 As shown, green fluorescence appeared when NiV RNA transcripts were present, and the sensitivity could reach 5.2×10 3 copies / μL, red fluorescence appears when HeV RNA transcripts are present, and the sensitivity can reach 5.2×10 2When both HeV and NiV RNA transcripts are present, orange fluorescence appears, and the sensitivity can reach 5.2×10 2 It can be seen that the single probe kit provided by the present invention has high sensitivity for the detection of Nipah virus and Hendra virus.

[0066] 2. Specificity Detection To evaluate the specificity of the above-mentioned detection method, nucleic acids of pathogens that can cause similar neurological symptoms, including RABV, JEV, HSV-1, and S. suis, were tested. These pathogen nucleic acids were placed in the reaction system of the kit respectively. At the same time, a negative control group was set up in which RNase-free ddH2O was used instead of the target. The RT-RAA-nfo reaction was carried out at a constant temperature of 37°C for 40 minutes, followed by instantaneous centrifugation, and the CRISPR / Cas13a reaction was carried out at a constant temperature of 37°C for 20 minutes. After the reaction, the reaction tube was placed under a blue light analyzer, and the results were observed by the naked eye or with a mobile phone. Images were captured using a smartphone to collect and analyze the pixel intensities of the green and red light channels.

[0067] The results are as follows Figure 11 As shown, the NiV group produced green fluorescence, the HeV group produced red fluorescence, and the NiV+HeV group produced orange fluorescence, while the RABV, JEV, HSV-1, and S. suis experimental groups and the negative control did not produce any fluorescence signals. This shows that the single probe kit provided by the present invention has certain specificity for the detection of Nipah virus and Hendra virus.

[0068] 3. Evaluation of Clinical Simulation Samples Total RNA was extracted and purified from Vero E6 cells infected with NiV and HeV (performed in the BSL-4 laboratory of the Wuhan Institute of Virology). The purified RNA was mixed with RNA extracted from saliva samples of healthy subjects to prepare NiV clinical simulation infection samples, HeV clinical simulation infection samples, and NiV and HeV mixed infection samples. Among them, 6 of the 11 NiV test samples were healthy human RNA samples spiked with NiV RNA; 10 of the 14 HeV test samples were healthy human RNA samples spiked with HeV RNA; and 11 of the 16 HeV and NiV mixed test samples were healthy human RNA samples spiked with both HeV and NiV RNA. These samples were evaluated using both the kit provided by the present invention and the standard real-time RT-PCR method for NiV and HeV detection recommended by WOAH.

[0069] Structure such as Figure 12As shown, the detection results using the single probe kit provided by the present invention are completely consistent with the detection results of the Real-time RT-PCR method, indicating that the detection kit for Nipah virus and Hendra virus provided by the present invention is feasible in the clinical screening and identification of suspected NiV-positive samples or HeV-positive samples, and can meet the needs of clinical detection.

[0070] Example 4: Preparation of a Multiplex Probe Kit for Detecting Nipah Virus and Hendra Virus The kit described in this embodiment includes a primer pair and a probe combination; the primer pair includes an RT-RAA-nfo forward primer and an RT-RAA-nfo reverse primer, the nucleotide sequence of the RT-RAA-nfo forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the RT-RAA-nfo reverse primer is shown in SEQ ID NO.2; the probe combination includes a single-stranded DNA probe P1 and a single-stranded DNA probe P3, the nucleotide sequence of the single-stranded DNA probe P1 is shown in SEQ ID NO.5, and the nucleotide sequence of the single-stranded DNA probe P3 is shown in SEQ ID NO.17; The RT-RAA-nfo amplification system in the multiplex probe kit is as follows: 5 μL of target to be detected, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM single-stranded DNA probe P1, 0.6 μL of 10 μM single-stranded DNA probe P3, 25 μL of rehydration buffer, 12.3 μL of RNase-free ddH2O, mix well, and add 2.5 μL of 280 mM magnesium acetate solution; Example 5: Application of a Multiplex Probe Kit for Detecting Nipah Virus and Hendra Virus in Visual Detection of Nipah Virus and Hendra Virus 1. The multiplex probe kit prepared in Example 4 was used to detect Nipah virus and Hendra virus, comprising the following steps: Take 45 µL of the premixed solution of the RT-RAA-nfo amplification system and transfer it to the bottom of a new centrifuge tube, add 5 µL of the target to be tested for RT-RAA-nfo amplification reaction; place the RT-RAA-nfo amplification reaction in a thermal cycler or water bath at 37°C to obtain reactants. A closed reaction tube can avoid aerosol contamination; use a blue light instrument to visualize the detection results of the above reactants, and all detection reactions are repeated 3 times; the temperature of the RT-RAA-nfo reaction is 37°C and the time is 20 min.

[0071] The judgment standard of the visual detection result is: using a mobile phone or naked eye to observe, if green fluorescence appears under a blue light meter, it indicates that the sample contains Nipah virus; if red fluorescence appears under a blue light meter, it indicates that the sample contains Hendra virus; if orange fluorescence appears under a blue light meter, it indicates that the sample contains Nipah virus and Hendra virus coexisting; if no fluorescence appears under a blue light meter, it indicates that the sample does not contain Nipah virus and Hendra virus.

[0072] Effect experiment: In this example, in order to evaluate the detection effect of the multiplex probe kit prepared in Example 4 on Nipah virus and Hendra virus, sensitivity detection and specificity detection were performed.

[0073] 1. Sensitivity test To evaluate the sensitivity of the above detection method, NiV RNA and HeV RNA transcripts were diluted tenfold (5.2×10 5 -5.2×10 2 The sensitivity of the detection method was evaluated using different concentrations of NiV RNA and HeV RNA transcripts as targets. RT-RAA-nfo reactions were performed at 37°C for 20 min.

[0074] like Figure 13 As shown, green fluorescence appeared when NiV RNA transcripts were present, and the sensitivity could reach 5.2×10 4 copies / μL; red fluorescence appears when HeV RNA transcripts are present, and the sensitivity can reach 5.2×10 3 It can be seen that the multiplex probe kit provided by the present invention has high sensitivity for the detection of Nipah virus and Hendra virus.

[0075] 2. Specificity Detection To evaluate the specificity of the detection method, RT-RAA-nfo amplification systems containing NiV RNA and HeV RNA transcripts, respectively, were placed in a metal bath and reacted at 37°C for 20 min. A negative control group was also established, in which RNase-free ddH2O was used instead of the target. The sensitivity of the detection method was evaluated. After the reaction, the reaction tubes were placed under a blue light analyzer, and the results were observed visually or with a mobile phone. Images were captured using a smartphone to collect and analyze pixel intensities in the green and red light channels.

[0076] The results are as follows Figure 14As shown in , when the test sample is NiV RNA transcript, the test result shows green fluorescence; when the test sample is HeV RNA transcript, the test result shows red fluorescence; when the test sample is NiV RNA transcript and HeV RNA transcript coexisting, the test result shows orange fluorescence; the negative control group in which RNase-Free ddH2O is used instead of the target, and the experimental group in which no corresponding RNA transcript-specific probe is added do not produce fluorescent signals. It can be seen that the multiple probe kit provided by the present invention can specifically identify NiV RNA transcripts, HeV RNA transcripts, and the coexistence of NiV RNA transcripts and HeV RNA transcripts within 20 minutes; it has certain specificity for the detection of Nipah virus and Hendra virus.

[0077] Any matters not described in detail in this specification are well known to those skilled in the art. Although the present invention has been disclosed above with reference to preferred embodiments, these are not intended to limit the present invention. Anyone skilled in the art may make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention shall be determined by the claims.

Claims

1. A primer pair for detecting Nipah virus and Hendra virus, characterized in that: The primer pair includes an RT-RAA-nfo forward primer and an RT-RAA-nfo reverse primer. The nucleotide sequence of the RT-RAA-nfo forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the RT-RAA-nfo reverse primer is shown in SEQ ID NO.

2.

2. A probe for detecting Nipah virus and Hendra virus, characterized in that: The probe is a single-stranded DNA probe P1, and the nucleotide sequence of the single-stranded DNA probe P1 is shown in SEQ ID NO.

5.

3. A probe combination for detecting Nipah virus and Hendra virus, characterized in that: The probe combination includes a single-stranded DNA probe P1 and a single-stranded DNA probe P3. The nucleotide sequence of the single-stranded DNA probe P1 is shown in SEQ ID NO.5, and the nucleotide sequence of the single-stranded DNA probe P3 is shown in SEQ ID NO.

17.

4. A single probe kit for detecting Nipah virus and Hendra virus, characterized in that: The single probe kit contains the primer pair of claim 1 and the probe of claim 2.

5. A multiplex probe kit for detecting Nipah virus and Hendra virus, characterized in that: The multiplex probe kit contains the primer pair according to claim 1 and the probe combination according to claim 3.

6. A method for using the single probe kit according to claim 4 for non-diagnostic purposes, characterized in that: The method of use comprises the following steps: Prepare an RT-RAA-nfo amplification system containing the target to be tested and place it at the bottom of a centrifuge tube; prepare a CRISPR / Cas13a reaction system and place it at the bottom of a cannula; invert the cannula into the centrifuge tube containing the RT-RAA-nfo reaction system, seal it, and place it in a thermal cycler or water bath at 37°C to first perform the RT-RAA-nfo amplification reaction and then the CRISPR / Cas13a reaction to obtain a reactant; use a blue light analyzer to visually detect the reactants and judge the results.

7. The method of use according to claim 6, wherein: The RT-RAA-nfo amplification system is as follows: 5 μL of target to be detected, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM single-stranded DNA probe, 25 μL of rehydration buffer, 12.9 μL of RNase-free ddH2O, mix well, and then add 2.5 μL of 280 mM magnesium acetate solution; The CRISPR / Cas13a reaction system is as follows: 0.8 μL of 5 μM LbuCas13a, 1 μL of 2 μM crRNA, 1.6 μL of 50,000 units / mL T7 RNA polymerase, 1.6 μL of 100 mM rNTP, 2 μL of 10 μM ssRNA reporter, 2 μL of 10× Buffer, and RNase-free ddH2O to 20 μL. The crRNA nucleotide sequence is shown in SEQ ID NO.12; The RT-RAA-nfo amplification reaction was performed at a temperature of 37°C and for 40 min; The temperature of the CRISPR / Cas13a reaction was 37° C. and the reaction time was 20 min.

8. A method for using the multiple probe kit according to claim 5 for non-diagnostic purposes, characterized in that: The method of use comprises the following steps: Prepare an RT-RAA-nfo amplification system containing the target to be detected, place it in a thermal cycler or water bath at 37°C to perform the RT-RAA-nfo amplification reaction to obtain a reactant; use a blue light analyzer to visually detect the reactant and determine the results; The RT-RAA-nfo amplification system is as follows: 5 μL of target to be detected, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM single-stranded DNA probe P1, 0.6 μL of 10 μM single-stranded DNA probe P3, 25 μL of rehydration buffer, 12.3 μL of RNase-free ddH2O, mix well, and add 2.5 μL of 280 mM magnesium acetate solution; The temperature of the RT-RAA-nfo amplification reaction is 37° C. and the time is 20 min.

9. The method of use according to any one of claims 6 to 8, characterized in that: The visual detection result judgment criteria are: If green fluorescence appears when observed under a blue light instrument, it indicates that the sample contains Nipah virus; If red fluorescence appears under a blue light analyzer, it indicates that the sample contains Hendra virus; If orange fluorescence appears when observed under a blue light analyzer, it indicates that the sample contains both Nipah virus and Hendra virus; If no fluorescence is observed under a blue light analyzer, it indicates that the sample does not contain Nipah virus or Hendra virus.

10. Use of the single probe kit according to claim 4 and the multiple probe kit according to claim 5 in visual detection of Nipah virus and Hendra virus.