A PCR chip for monitoring nipah virus and products and applications thereof

Abstract

The application discloses a PCR chip for monitoring Nipah virus and products and applications thereof, and relates to the technical field of biological detection. The application provides a PCR chip for monitoring Nipah virus, which comprises the following primers and probes: primers and probes for detecting Nipah virus M subtype; and primers and probes for detecting Nipah virus B subtype. The kit has excellent detection capability for Nipah virus M subtype, Nipah virus B subtype and Hendra virus, is high in sensitivity, good in specificity, accurate and reliable in detection result, strong in repeatability, simple in operation and short in time consumption. The kit can simultaneously realize the differentiation of Nipah virus M / B subtypes and the identification of Hendra virus in a single sample, and provides technical support for the rapid identification of Nipah virus and Hendra virus.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a PCR chip for monitoring Nipah virus, its products, and applications. Background Technology

[0002] Nipah virus (NiV) is a highly pathogenic zoonotic RNA virus belonging to the genus Hendravirus of the family Paramyxoviridae. Nipah virus has a wide host range, primarily using fruit bats as its natural reservoir host. It can be transmitted to humans through direct contact with the secretions and excrement of infected animals, or by consuming food contaminated with the virus or through contact with the bodily fluids of infected individuals. Infection can cause severe respiratory illness, encephalitis, and other symptoms. Currently, there is no specific vaccine or targeted treatment. Therefore, rapid, accurate, and efficient monitoring of the prevalence and genotype distribution of Nipah virus is crucial for controlling its spread.

[0003] Nipah virus has multiple subtypes, among which subtype M (Malaysian subtype) and subtype B (Bangladesh subtype) are the most prevalent. The two subtypes differ significantly in nucleotide sequence, pathogenicity, and transmission characteristics: subtype M is mainly transmitted through contact with infected pigs, and the symptoms are mainly respiratory; subtype B can be transmitted from person to person, is more pathogenic, and is prone to causing large-scale outbreaks. Therefore, in the process of Nipah virus surveillance, it is not only necessary to achieve rapid detection of the virus, but also to accurately distinguish between different subtypes to provide a scientific basis for tracing the source of the epidemic, assessing the risk of transmission, and formulating prevention and control strategies.

[0004] Currently, the main methods for detecting Nipah virus include virus isolation and culture, serological testing, conventional PCR testing, and real-time quantitative PCR testing. Among these, virus isolation and culture is complex and time-consuming (usually requiring several days to weeks), and has extremely high requirements for laboratory biosafety levels, making it difficult to meet the needs of rapid on-site monitoring. Serological testing is mainly used for retrospective diagnosis of past infections, and cannot achieve rapid screening for early infections. It also carries the risk of cross-reactivity and has limited detection specificity. While conventional PCR testing can achieve rapid amplification of viral nucleic acid, its detection sensitivity is low, and it cannot simultaneously perform viral typing. It requires designing primers for different subtypes and performing multiple tests, which is cumbersome, inefficient, and difficult to adapt to the needs of large-scale sample screening and simultaneous monitoring of multiple subtypes.

[0005] Real-time quantitative PCR (qPCR) has become the mainstream method for Nipah virus detection due to its high sensitivity, specificity, and speed. However, current technologies typically require different reaction systems for detecting different Nipah virus subtypes, necessitating separate detection. This not only increases testing costs but also prolongs the detection cycle, hindering rapid response to outbreaks. Furthermore, existing detection methods are mostly single-target detections, making them susceptible to viral mutations and leading to missed diagnoses, thus failing to meet the practical needs for accurate Nipah virus monitoring and early warning.

[0006] PCR chip technology, as a high-throughput detection technology, integrates multiple primers and probes onto a single chip, enabling the simultaneous detection of multiple targets in a single test. It boasts advantages such as high throughput, speed, efficiency, and low cost, and has been widely used for the simultaneous detection and typing of various viruses. However, there are currently no dedicated PCR chips for Nipah virus subtypes M and B. Existing detection technologies struggle to balance detection efficiency, sensitivity, specificity, and subtype differentiation capabilities, failing to meet the practical needs of routine Nipah virus monitoring and rapid epidemic response.

[0007] Given the shortcomings of the existing technologies, developing a PCR chip capable of rapidly, accurately, and with high throughput simultaneously detecting Nipah virus subtypes M and B, thereby achieving rapid virus detection and accurate subtype differentiation, reducing detection costs, improving detection efficiency, and providing technical support for the prevention and control of Nipah virus, has become a pressing technical problem for those skilled in the art. Summary of the Invention

[0008] The purpose of this invention is to provide a PCR chip for monitoring Nipah virus, as well as its products and applications.

[0009] To achieve the above-mentioned objectives, the technical solution of the present invention is as follows: On one hand, the present invention provides a PCR chip for monitoring Nipah virus, the PCR chip comprising the following primers and probes: For Nipah virus subtype M: forward primer as shown in SEQ ID NO:1, reverse primer as shown in SEQ ID NO:2, probe as shown in SEQ ID NO:3; For Nipah virus subtype B: forward primer as shown in SEQ ID NO:4, reverse primer as shown in SEQ ID NO:5, and probe as shown in SEQ ID NO:6.

[0010] Specifically, the PCR chip also includes primer pairs and probes for specifically amplifying internal reference genes, with the forward primer having the nucleotide sequence shown in SEQ ID NO:7, the reverse primer having the nucleotide sequence shown in SEQ ID NO:8, and the probe having the nucleotide sequence shown in SEQ ID NO:9.

[0011] Nipah virus M subtype primers and probes: NiVM-F-969: SEQ ID NO: 1: 5'CCCCTGGAGGTTACCCATT3'; NiVM-R-1091: SEQ ID NO: 2: 5'GGCCTAGTCTGAAATACATAGGTTC3'; NiVM-PR-1060: SEQ ID NO: 3: 5'AACCACGATTGATATTCAATGCCCC3'.

[0012] Nipah virus subtype B primers and probes: NiVB-F-969: SEQ ID NO: 4: 5'CCCTGGAGGTTACCCGCT3'; NiVB-R-1091: SEQ ID NO:5:5'GGCCTAGTCTGAAATACATAGGTTC3'; NiVB-PR-1061: SEQ ID NO:6: 5'AACCACGATTGATGTTTAATGCCCCCA3'.

[0013] SEQ ID NO:7: 5'AGTTGCAGTGTAACCGTCATGTA3'; SEQ ID NO:8: 5'TCGACGAGACTCTGCTGTTAA3'; SEQ ID NO:9: 5'CAGTAATCTGCGTCGCACGTGTGCA3'.

[0014] In another aspect, the present invention provides a Nipah virus typing kit, wherein the kit includes the aforementioned PCR chip.

[0015] Specifically, the PCR chip includes a sample loading layer and a tubing layer, which are arranged sequentially from top to bottom. The sample loading layer includes a sample loading well and a reagent tube. The sample loading well is used to add samples, and the reagent tube is used to deliver buffer solutions. The tubing layer includes a reaction chamber, in which lyophilized reagents are pre-embedded.

[0016] Specifically, the kit also includes one or more of the following: lyophilized reagents, sample extraction reagents, negative control products, and positive control products.

[0017] Furthermore, the lyophilization reagent comprises a primer-probe composition, a PCR amplification system, and a composite lyophilization protectant.

[0018] Furthermore, the composite freeze-drying protectant is composed of 0.5-2% (v / v) dimethyl sulfoxide, 2-5% (w / v) dextran 40, 20-50 mmol / L L-arginine, 1-3% (w / v) PEG-8000, 80-120 mmol / L trehalose, and 0.1-0.3% (w / v) BSA.

[0019] According to some embodiments of the present invention, the concentration of dimethyl sulfoxide in the composite lyophilization protectant is selected as 0.5% (v / v), 0.6% (v / v), 0.7% (v / v), 0.8% (v / v), 0.9% (v / v), 1.0% (v / v), 1.1% (v / v), 1.2% (v / v), 1.3% (v / v), 1.4% (v / v), 1.5% (v / v), 1.6% (v / v), 1.7% (v / v), 1.8% (v / v), 1.9% (v / v), 2.0% (v / v), and any intermediate value or a range between two values.

[0020] According to some embodiments of the present invention, the concentration of dextran 40 in the composite freeze-drying protectant is selected as 2% (w / v), 2.5% (w / v), 3% (w / v), 3.5% (w / v), 4% (w / v), 4.5% (w / v), 5% (w / v), and any intermediate value or a range between two values.

[0021] According to some embodiments of the present invention, the concentration of L-arginine in the composite lyophilization protectant is selected as 20 mmol / L, 25 mmol / L, 30 mmol / L, 35 mmol / L, 40 mmol / L, 45 mmol / L, 50 mmol / L, or any intermediate value or a range between two values.

[0022] According to some embodiments of the present invention, the composite freeze-drying protectant includes PEG-8000 at concentrations of 1% (w / v), 1.5% (w / v), 2% (w / v), 2.5% (w / v), and 3% (w / v), and any intermediate value or a range between two values ​​can be selected.

[0023] According to some embodiments of the present invention, the concentration of trehalose in the composite freeze-drying protectant is selected from 80 mmol / L, 85 mmol / L, 90 mmol / L, 95 mmol / L, 100 mmol / L, 105 mmol / L, 110 mmol / L, 115 mmol / L, 120 mmol / L, and any intermediate value or a range between two values.

[0024] According to some embodiments of the present invention, the concentration of BSA in the composite freeze-drying protectant is 0.1% (w / v), 0.15% (w / v), 0.2% (w / v), 0.25% (w / v), 0.3% (w / v), and any intermediate value or a range between two values ​​can be selected.

[0025] Preferably, the composite freeze-drying protectant is composed of 0.8% (v / v) dimethyl sulfoxide, 3% (w / v) dextran 40, 40 mmol / L L-arginine, 2.5% (w / v) PEG-8000, 100 mmol / L trehalose, and 0.2% (w / v) BSA.

[0026] Furthermore, the negative control product is physiological saline.

[0027] Furthermore, the positive control sample can be a plasmid or a pseudovirus.

[0028] Furthermore, the positive control sample can be a positive plasmid of two Nipah virus subtypes or a mixture of pseudoviruses. The preparation method for the pseudovirus can refer to the preparation method in patent CN202110669475.X.

[0029] The specific application of the kit of the present invention can be realized through the reaction device in the published patent CN112782395A.

[0030] Furthermore, the concentration of primers and probes in the kit is 0.1-5 μM; Furthermore, the concentration of primers and probes in the kit is 0.5 μM.

[0031] As is generally understood by those skilled in the art, the probe described in this invention should also include a fluorescent reporter group and a quencher group. The fluorescent reporter group and quencher group can be in forms currently disclosed or not disclosed in the art, and their function is as a label for PCR detection. For example, the fluorescent reporter group can be any one or more of CY3, CY5, CY5.5, FAM, HEX, VIC, JOE, ROX, and ATTO425.

[0032] According to some embodiments of the present invention, NiVM-PR-1060 is labeled with FAM, NiVB-PR-1061 is labeled with HEX, and the probe for the internal reference gene is labeled with Cy5.5.

[0033] Specifically, the detection method of the kit includes the following steps: (1) Extract nucleic acid from the sample to be tested; (2) Perform real-time PCR on the nucleic acid obtained in step (1) using the PCR chip described above; (3) Obtain and analyze the results.

[0034] Furthermore, the conditions for quantitative real-time PCR were: 95℃ pre-denaturation for 30s; 95℃ denaturation for 3s, 60℃ annealing extension for 10s, for 40 cycles.

[0035] According to some embodiments of the present invention, based on the above-mentioned Nipah virus typing kit, the present invention also provides a Nipah virus identification and typing kit, wherein the kit includes all the reagents of the above-mentioned Nipah virus typing kit, and further includes primers and probes for Nipah virus identification, having a forward primer as shown in SEQ ID NO:10, a reverse primer as shown in SEQ ID NO:11, and a probe as shown in SEQ ID NO:12.

[0036] NiV-F-822: SEQ ID NO: 10: 5'GTTGGAGACAAGGTATCCAGCA3'; NiV-R-960: SEQ ID NO: 11: 5'AGTCTGAATTGATTCTTCAAGAAGCA3'; NiV-P-864: SEQ ID NO: 12: 5'GAGTGACCTCAACACCATCAAAAGCTTG3'.

[0037] NiV-P-864 is marked with Cy5.

[0038] According to some embodiments of the present invention, based on the above-mentioned Nipah virus typing kit, the present invention also provides a Hendra virus identification kit, the kit comprising all the reagents of the above-mentioned Nipah virus typing kit, and further comprising primers and probes for the identification of Hendra virus, having a forward primer as shown in SEQ ID NO:13, a reverse primer as shown in SEQ ID NO:14, and a probe as shown in SEQ ID NO:15.

[0039] HeV-F-822: SEQ ID NO: 13: 5'GAAACTCGGTCGAGATGGGC3'; HeV-R-960: SEQ ID NO: 14: 5'TTGATTCTGCTGCACTTGGTG3'; HeV-P-864: SEQ ID NO: 15: 5'CTGAGATGGGAGTTGACyTTGTTyGCTCT3'.

[0040] HeV-P-864 is marked ATTO 425.

[0041] Furthermore, the present invention provides applications of the above-described PCR chip or the above-described reagent kit, wherein the applications include any one or more of the following: (1) Used for quality control of Nipah virus drugs; (2) Used for the identification of Nipah virus; (3) Used for Nipah virus typing; (4) Used for the identification of Hendraviruses.

[0042] The beneficial effects of this invention are as follows: (1) The kit of the present invention has excellent detection capabilities for Nipah virus M subtype, B subtype and Hendra virus, with a detection limit of up to 10 copies / reaction, which can meet the needs of early screening and accurate monitoring of low viral load in clinical, animal and environmental samples.

[0043] (2) The present invention designs specific primers and probes for Nipah virus M subtype, B subtype and Hendra virus. There is no cross-reaction and non-specific amplification between channels. It only generates specific amplification signals for the target pathogen. There is no cross-amplification for common pathogens such as Langya virus, Cedar virus, human parainfluenza virus and respiratory syncytial virus. The subtypes are clearly distinguished and the species are accurately identified, effectively avoiding missed detection and misjudgment.

[0044] (3) The present invention uses a composite freeze-drying protectant to keep the active components such as enzymes, primers, and probes highly stable during freeze-drying and storage. The coefficient of variation (CV) of repeated detection is less than 3.0%, and the detection results are accurate, reliable, and highly repeatable, making it suitable for batch sample detection and long-term storage.

[0045] (4) The present invention integrates primers, probes, enzymes, dNTPs, buffers and protectants into a PCR chip reaction chamber. When using it, only the sample and buffer need to be added for direct amplification and detection. There is no need to prepare the reaction system on site. The operation is simple and time-saving, reducing human error and pollution risk. It is especially suitable for on-site rapid detection and high-throughput screening scenarios.

[0046] (5) The present invention can simultaneously distinguish Nipah virus M / B subtypes and identify Hendra virus genus in a single sample, and obtain multiple detection results in one reaction. It has high throughput and high efficiency, and provides efficient technical support for the rapid identification of Nipah virus and Hendra virus. Detailed Implementation

[0047] To make the technical means, creative features, and achieved objectives and effects of this invention easier to understand, the invention is further illustrated below with specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the protection scope of this invention. Unless otherwise specified, the operating methods and equipment used in the following embodiments are conventional operating methods, and the materials and equipment used in each embodiment are the same.

[0048] The overall equipment used in this invention is the equipment disclosed in patent CN112782395A.

[0049] Example 1: Nipah virus typing kit The kit includes the following components: (1) Primer and probe composition Nipah virus M subtype primers and probes: NiVM-F-969: SEQ ID NO: 1: 5'CCCCTGGAGGTTACCCATT3'; NiVM-R-1091: SEQ ID NO: 2: 5'GGCCTAGTCTGAAATACATAGGTTC3'; NiVM-PR-1060: SEQ ID NO: 3: 5'AACCACGATTGATATTCAATGCCCC3'.

[0050] Nipah virus subtype B primers and probes: NiVB-F-969: SEQ ID NO: 4: 5'CCCTGGAGGTTACCCGCT3'; NiVB-R-1091: SEQ ID NO:5:5'GGCCTAGTCTGAAATACATAGGTTC3'; NiVB-PR-1061: SEQ ID NO:6: 5'AACCACGATTGATGTTTAATGCCCCCA3'.

[0051] Primer pairs and probes for the internal reference gene: SEQ ID NO:7: 5'AGTTGCAGTGTAACCGTCATGTA3'; SEQ ID NO:8: 5'TCGACGAGACTCTGCTGTTAA3'; SEQ ID NO:9: 5'CAGTAATCTGCGTCGCACGTGTGCA3'.

[0052] The concentrations of both primers and probes were 0.5 μM.

[0053] Of the probes listed above, NiVM-PR-1060 is labeled with FAM, NiVB-PR-1061 is labeled with HEX, and the probe for the internal reference gene is labeled with Cy5.5.

[0054] (2) Buffer components The PCR amplification system used was the commercially available Air-Dryable 1-Step RT-qPCR Mix, which included buffer, dNTP Mix, and DNA polymerase.

[0055] (3) Lyophilized reagents The lyophilized reagent is prepared by mixing, dispensing, and vacuum freeze-drying primer and probe composition, PCR amplification system, and composite lyophilization protectant.

[0056] The compound lyophilization protectant consists of 0.8% (v / v) dimethyl sulfoxide, 3% (w / v) dextran 40, 40 mmol / L L-arginine, 2.5% (w / v) PEG-8000, 100 mmol / L trehalose, and 0.2% (w / v) BSA.

[0057] The primer and probe composition, PCR amplification system, and composite lyophilization protectant are lyophilized together to form an integrated dry powder, which is pre-embedded in the reaction chamber of the PCR chip.

[0058] The kit also includes a positive control (1×10⁶ pseudoviruses). 6 (Copies / mL, including target genes of two Nipah virus subtypes), and negative control samples.

[0059] Example 2: Nipah virus identification and typing kit The difference from Example 1 is as follows: (1) The primer composition includes, in addition to typing primers, primers and probes for Nipah virus identification: NiV-F-822: SEQ ID NO: 10: 5'GTTGGAGACAAGGTATCCAGCA3'; NiV-R-960: SEQ ID NO: 11: 5'AGTCTGAATTGATTCTTCAAGAAGCA3'; NiV-P-864: SEQ ID NO: 12: 5'GAGTGACCTCAACACCATCAAAAGCTTG3'.

[0060] NiV-P-864 is marked with Cy5.

[0061] Everything else is the same as in Example 1.

[0062] Example 3: Nipah virus typing combined with Hendra virus identification and detection kit The difference from Example 1 is as follows: (1) The primer composition includes, in addition to typing primers, primers and probes for detecting Hendraviruses: HeV-F-822: SEQ ID NO: 13: 5'GAAACTCGGTCGAGATGGGC3'; HeV-R-960: SEQ ID NO: 14: 5'TTGATTCTGCTGCACTTGGTG3'; HeV-P-864: SEQ ID NO:15: 5'CTGAGATGGGAGTTGACyTTGTTyGCTCT3' (y is a degenerate base, representing that the site is cytosine (C) or thymine (T)).

[0063] Everything else is the same as in Example 1.

[0064] HeV-P-864 is marked ATTO 425.

[0065] Comparative Example 1 The only difference from Example 1 is that the primers and probes for Nipah virus subtype M are different. The primers and probes for Nipah virus subtype M in Comparative Example 1 are: NiVM-F2: SEQ ID NO: 16: GGTCTATGGGGGCATTGAATATC; NiVM-R2: SEQ ID NO: 17: CCTCCAGCATGGTGACGTG.

[0066] NiVM-P2: SEQ ID NO: 18: GTGGTTATTCTTGAGCCTATGTATTTCAGACTAGG.

[0067] Comparative Example 2 The only difference from Example 1 is that the primers and probes for Nipah virus subtype B are different. The primers and probes for Nipah virus subtype B in Comparative Example 2 are: NiVB-F2: SEQ ID NO: 19: GGTCTATGGGGGCATTAAACATC; NiVB-R2: SEQ ID NO:20: CCTCCAGCATGGTGACGTG; NiVB-P2: SEQ ID NO: 21: GTGGTTATCTTGAACCTATGTATTTCAGACTAGG.

[0068] Comparative Example 3 The only difference from Example 1 is the composite lyophilization protectant. In Comparative Example 3, the composite lyophilization protectant consists of 5% (v / v) dimethyl sulfoxide, 1% (w / v) dextran 40, 0 mmol / L L-arginine, 0.5% (w / v) PEG-8000, 60 mmol / L trehalose, and 0.5% (w / v) BSA.

[0069] Comparative Example 4 The only difference from Example 1 is the composite freeze-drying protectant. In Comparative Example 4, the composite freeze-drying protectant consists of 10% mannitol, 10% trehalose, 0.1% 2-hydroxypropyl-β-cyclodextrin HP-β-CD, 0.5 mg / mL bovine serum albumin (BSA), 0.009% defoamer SE-15, 10 mM Tris-HCl (pH 8.0), 50 mM NaCl, and 0.05% Tween20.

[0070] Experimental Example 1: Reagent Kit Sensitivity Detection The positive control samples were tested using the kits from Examples 1-3, respectively. Following the pseudovirus preparation method described in Example 1 of patent CN202110669475.X, a pseudovirus containing the N gene fragment of the Nipah virus genome (Genbank: NC_002728: 400-900bp) was constructed. The positive control samples were diluted to 1×10⁻⁶. 5 copies, 1×10 4 copies, 1×10 3 copies, 1×10 2 copies, 1×10 1 The copies were used as the test samples, and the test results are shown in the table below.

[0071] Table 1

[0072] Experimental Example 2: Stability Testing of the Reagent Kit According to the pseudovirus preparation method described in Example 1 of patent CN202110669475.X, a pseudovirus containing the N gene fragment of the Nipah virus genome (Genbank: NC_002728:400-900bp) was constructed. The concentration was adjusted to 10 copies per reaction. The extracted nucleic acid samples were tested according to the methods of Examples 1-3 and Comparative Examples 1-4 above. The tests were repeated 10 times. The coefficient of variation CV = (standard deviation SD / mean) × 100%. The test results are shown in the table below.

[0073] Table 2

[0074] Experimental Example 3: Specificity Detection of the Reagent Kit The quality control samples were tested using the kits from Example 1 and Comparative Example 1. The positive quality control samples were diluted to 1×10⁻⁶. 2 The results, measured in copies / mL, are shown in the table below. Table 3

[0075] As can be seen from the results in the table above, Example 1 of this application can identify positive control samples, but the comparative sample cannot be amplified.

[0076] The technical solution of Example 3 was used to detect positive control samples for other pathogens.

[0077] The specific amplification results (Ct values) are shown in Table 4 below: Table 4

[0078] As can be seen from the above results, the kit of the present invention has good specificity.

[0079] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A PCR chip for monitoring Nipah virus, characterized in that, The PCR chip includes the following primers and probes: For Nipah virus subtype M: forward primer as shown in SEQ ID NO:1, reverse primer as shown in SEQ ID NO:2, probe as shown in SEQ ID NO:3; For Nipah virus subtype B: forward primer as shown in SEQ ID NO:4, reverse primer as shown in SEQ ID NO:5, and probe as shown in SEQ ID NO:

6.

2. The PCR chip according to claim 1, characterized in that, The PCR chip also includes primer pairs and probes for specifically amplifying internal reference genes, with the forward primer having the nucleotide sequence shown in SEQ ID NO:7, the reverse primer having the nucleotide sequence shown in SEQ ID NO:8, and the probe having the nucleotide sequence shown in SEQ ID NO:

9.

3. A Nipah virus typing kit, characterized in that, The kit includes the PCR chip as described in any one of claims 1-2.

4. The Nipah virus typing kit according to claim 3, characterized in that, The kit also includes one or more of the following: lyophilized reagents, sample extraction reagents, negative control products, and positive control products; The lyophilization reagent comprises a primer-probe composition, a PCR amplification system, and a composite lyophilization protectant.

5. The Nipah virus typing kit according to claim 3, characterized in that, The composite freeze-drying protectant is composed of 0.5-2% (v / v) dimethyl sulfoxide, 2-5% (w / v) dextran 40, 20-50 mmol / L L-arginine, 1-3% (w / v) PEG-8000, 80-120 mmol / L trehalose, and 0.1-0.3% (w / v) BSA.

6. The Nipah virus typing kit according to claim 3, characterized in that, The negative control is physiological saline, and the positive control is plasmid or pseudovirus.

7. The Nipah virus typing kit according to any one of claims 3-6, characterized in that, The detection method of the aforementioned kit includes the following steps: (1) Extract nucleic acid from the sample to be tested; (2) Perform quantitative real-time PCR on the nucleic acid obtained in step (1) using the PCR chip according to any one of claims 1-2; (3) Obtain and analyze the results.

8. A Nipah virus identification and typing kit, characterized in that, The kit includes all the reagents of the Nipah virus typing kit according to any one of claims 3-7, and also includes primers and probes for Nipah virus identification, such as the forward primer shown in SEQ ID NO:10, the reverse primer shown in SEQ ID NO:11, and the probe shown in SEQ ID NO:

12.

9. A kit for identifying Hendraviruses, characterized in that, The kit comprises all the reagents of the Nipah virus typing kit according to any one of claims 3-7, and further comprises primers and probes for the identification of Hendra virus genus, such as the forward primer shown in SEQ ID NO:13, the reverse primer shown in SEQ ID NO:14, and the probe shown in SEQ ID NO:

15.

10. The application of the PCR chip according to any one of claims 1-2, or the Nipah virus typing kit according to any one of claims 3-7, or the Nipah virus identification and typing kit according to claim 8, or the Hendra virus identification kit according to claim 9, characterized in that, The applications include any one or more of the following: (1) Used for quality control of Nipah virus drugs; (2) Used for the identification of Nipah virus; (3) Used for Nipah virus typing; (4) Used for the identification of Hendraviruses.

Images