Application of fermentation liquor of premispora pirastris

Abstract

The invention relates to an application of a pelagic fermentation broth, and the pelagic fermentation broth is prepared by the following steps: inoculating pelagic HE39 into a culture medium, carrying out fermentation culture, centrifuging, and taking the supernatant; the preservation number of the Phlebiopsis pilaris HE39 is CGMCC (China General Microbiological Culture Collection Center) No.41168, and the preservation number of the Phlebiopsis pilaris HE39 is CGMCC No.41168. The fermentation liquor can be used for degrading lignin and cellulose, has good degradation capacity on lignin in ground cover combustible materials, has good laccase activity, lignin peroxidase activity and manganese peroxidase activity, and can improve the weight loss rate of the combustible materials in forest land.

Description

[0001] This invention is a divisional application. The original Chinese patent application number is: 202411792677.3, the application date is: December 7, 2024, and the patent name at the time of application is: A strain of Pseudomonas aeruginosa and its application. Technical Field

[0002] The invention belongs to the technical field of microorganisms, and in particular relates to an application of a fermentation broth of Pseudomonas pilatus. Background Art

[0003] Surface litter is the primary forest floor fuel, and lignin is the primary component of this fuel. The degradation of forest floor fuels relies on the catalysis of a complex lignin-degrading enzyme system, secreted by lignin-degrading fungi and consisting of extracellular oxidoreductases such as laccase (Lac), lignin peroxidase (LiP), and manganese peroxidase (MnP). Basidiomycetes, such as white rot fungi, are particularly capable of degrading lignin. The lignin-degrading abilities of different strains vary significantly, and are closely related to their growth conditions.

[0004] Kang Yue et al. screened out a strain of Aspergillus nidulans from garden waste. Through solid-state fermentation experiments, they found that the strain had a good effect on degrading lignin from the branches and leaves of common garden waste in Beijing, such as Euonymus ilex, Juniperus chinensis, and Forsythia suspensa. The lignin degradation rate was 15.77%-29.90% higher than that of the control (Kang Yue, Li Suyan, Sun Xiangyang, et al. Screening, identification and ability study of lignin-degrading fungi from garden waste [J]. Journal of Forestry Science, 2019, 32(3):80-87.). Zhang Fangfang et al. screened out one strain of Betula birchii and one strain of Subfusomyces nigricans from 16 white-rot fungi. The degradation rates of lignin in corn straw reached 13.60% and 21.87% respectively (Zhang Fangfang, Zhang Tong, Dai Dan, et al. Screening of efficient lignin-degrading bacteria and their degradation effect on corn straw [J]. Journal of Mycology, 2021, 40(7):1869-1880.). Yang Li et al. studied the liquid fermentation of the dark green Trichoderma atroviride Z-1 strain with significant lignin-degrading enzyme activity and determined the optimal culture conditions for enzyme production, including culture time, temperature, dissolved oxygen, inoculation amount, and pH (Yang Li, Sun Xiaodong, Li Linlin, et al. Screening of Trichoderma strains producing lignin-degrading enzymes and their enzyme production characteristics [J / OL]. Journal of Mycology, 1-9 [2024-08-02]. https: / / doi.org / 10.13346 / j.mycosystema.240032.).

[0005] The use of lignin-degrading fungi can increase lignin degradation rates, and optimizing the culture conditions of the strains can further enhance their enzyme activity, thereby promoting lignin degradation. However, obtaining suitable strains and preparing fermentation broths from them is a key issue. Currently, there are no reports on the degradation of lignin or cellulose by Pseudomonas pirate and its fermentation broth. Research on lignin biodegradation, both domestically and internationally, has primarily focused on the papermaking industry, biocomposting, environmental protection, and the feed and food industries, with relatively little research on forest fire prevention. In the forestry sector, lignin-degrading strains have varying lignin-degrading abilities for different tree species, depending on their specific type. Summary of the Invention

[0006] In view of the problems existing in the prior art, the present invention provides an application of the fermentation liquid of Pseudomonas pilatus. The fermentation liquid provided by the present invention can be used to degrade lignin, cellulose, prepare preparations for degrading lignin and / or cellulose, etc. It has a good degradation ability for lignin / cellulose in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activity, and can increase the weight loss rate of forest combustibles.

[0007] The technical solution of the present invention to solve the above technical problems is as follows:

[0008] The present invention provides a strain of Phlebiopsis pilatii, the strain name is Phlebiopsis pilatii HE39, the preservation number is CGMCC No. 41168, and it was deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC) on February 5, 2024. The preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China.

[0009] This study screened fungi capable of degrading lignin in forest floor fuels and conducted preliminary optimization of their culture medium components, providing a basis for using lignin-degrading strains to explore new approaches for reducing floor fuel loads. The study found that the HE39 strain provided by the present invention has excellent degradation capabilities for lignin and cellulose in floor fuels, exhibits high laccase, lignin peroxidase, and manganese peroxidase activities, and can increase the weight loss rate of forest floor fuels.

[0010] The invention provides a method for preparing a fermentation broth of Phlebiopsis pilatii, comprising the following steps: inoculating a culture medium with the above-mentioned Phlebiopsis pilatii HE39, fermenting and culturing the culture medium, centrifuging the culture medium, and collecting the supernatant.

[0011] Furthermore, the culture medium is PDB culture medium or fermentation culture medium.

[0012] Furthermore, in the fermentation medium, the carbon source is selected from any one or more of sucrose, corn flour, soluble starch and glucose.

[0013] Furthermore, in the fermentation medium, the nitrogen source is selected from any one or more of tryptone, soybean powder, yeast powder and malt extract powder.

[0014] Furthermore, in the fermentation medium, the inorganic salt is selected from any one or more of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.

[0015] Furthermore, in the fermentation medium, the carbon source content was 10.0 g / L, the nitrogen source content was 20.0 g / L, and the inorganic salt content was 3.0 g / L.

[0016] The use of the above culture medium is beneficial to improving the enzyme production activity of strain HE39.

[0017] Furthermore, the culture time is 5-7 days.

[0018] Furthermore, the culture was shaken at a rotation speed of 160 rpm.

[0019] Furthermore, the centrifugation condition was 4000 rpm for 10 min.

[0020] The fermentation liquid of Pseudomonas pilatus provided by the present invention can be used in any one of (1) to (5), and the fermentation liquid of Pseudomonas pilatus is prepared by the above method;

[0021] (1) Degradation of lignin and / or cellulose;

[0022] (2) preparing a preparation for degrading lignin and / or cellulose;

[0023] (3) Degradation of forest floor combustibles;

[0024] (4) producing lignin-degrading enzymes;

[0025] (5) Increase the weight loss rate of combustible materials in forests.

[0026] The fermentation liquid prepared by the invention has good degradation ability for lignin and cellulose in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activity, and can improve the weight loss rate of forestland combustibles.

[0027] The present invention provides a method for using the Pseudomonas pirate fermentation liquid, comprising the following steps: using the Pseudomonas pirate fermentation liquid to treat lignin or a substance containing lignin.

[0028] The above method can also be used as a method for degrading lignin / cellulose, a method for degrading ground cover combustibles, a method for increasing the activity of lignin-degrading enzymes, and a method for increasing the weight loss rate of forestland combustibles. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The proportion of each fungal genus.

[0030] Figure 2 The left picture shows the color development reaction of 2-1-24 colonies on guaiacol-PDA, and the right picture shows the decolorization reaction of HE-1-3-⑨ colonies on aniline blue-PDA plates.

[0031] Figure 3 This is a diagram showing the degradation effect of HE-1-3-⑨ strain on filter paper strips.

[0032] Figure 4 This is the result of changes in the indoor degradable cellulose content of ground cover combustibles.

[0033] Figure 5 This is the colony growth status of strain HE-1-3-⑨.

[0034] Figure 6 This is the phylogenetic tree of lignin-degrading bacteria HE39 based on rDNA-ITS sequences.

[0035] Figure 7 These are the experimental results on the changes in cellulose degradation rate of ground cover combustibles under different bacterial agent treatments. DETAILED DESCRIPTION

[0036] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0037] Lignin-degrading fungi are widely used in the biodegradation of lignin. To explore the degradation effect of lignin-degrading fungi on forest floor combustibles, ground combustibles from broad-leaved Korean pine forests, poplar-birch mixed forests, larch-birch mixed forests, and red spruce forests were used as sources of degradation fungi and degradation test samples. The mass loss of the combustibles and the lignin content after degradation were measured. The results showed that a strain with excellent lignin degradation ability in ground cover fuels was screened out and identified as Phlebiopsis pilatii HE39. This strain first showed strong lignin degradation ability. The lignin degradation rates of poplar-birch and spruce fuels were 19.69% and 16.01% after 10 days of treatment, respectively. The weight loss rates of larch-birch and spruce fuels were 23.00% and 22.00% after 60 days of treatment. Sucrose, soybean meal and calcium chloride were the optimal carbon source, nitrogen source and inorganic salt for enzyme production for strain HE39, respectively. The optimized fermentation medium formula (g / L) was determined as: sucrose 10.0%, soybean meal 20.0%, calcium chloride 3.0%, Tween 80 0.5, prepared in water.

[0038] Unless otherwise specified, the experimental methods used in the present invention are all conventional methods in the art; the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art, and those skilled in the art can obtain them through commercial channels or prepare them using conventional methods.

[0039] Study Area Overview: The study area is located at the Yitong Forest Pest Natural Enemy Breeding Demonstration Base of the Jilin Academy of Forestry Sciences, at 124°50′-125°46′E, 43°03′-43°38′N. It has a continental monsoon climate with an average annual temperature of 2.8°C, a frost-free period of 120-140 days, and an average annual precipitation of 723 mm. The experimental site has an average elevation of 300 m. The main forest stands include broad-leaved Korean pine (Pinuskoraiensis), Manchurian ash (Fraxinus mandshurica), Mongolian oak (Querus mongolica), white birch (Betula platyphylla), poplar (Populus davidiana), larch (Larix gmelinii), and mixed woods. The soil in the study area is primarily dark brown forest soil.

[0040] PDA medium was prepared according to the following proportions: 200 g potato, 20 g glucose, 20 g agar, 3 g KH2PO4, 1.5 g MgSO4·7H2O, 0.01 g VB1, and 1000 mL distilled water.

[0041] PDA-guaiacol medium: guaiacol was added to PDA medium, and the final concentration of guaiacol was 0.02% by volume.

[0042] PDA-aniline blue medium: Add aniline blue to PDA medium to a final concentration of 0.1 g / L.

[0043] PDB medium was prepared according to the following proportions: 200 g potato, 20 g glucose, 3 g KH2PO4, 1.5 g MgSO4·7H2O, 0.01 g VB1, and 1000 mL distilled water.

[0044] Hutcheson's medium was prepared according to the following proportions: KH2PO4 1.0 g, NaCl 0.1 g, MgSO4·7H2O 0.3 g, NaNO3 2.5 g, FeCl3 0.01 g, CaCl2 0.1 g, distilled water 1000 mL, pH 7.2.

[0045] Malt extract powder medium was prepared according to the following proportions: glucose 10.0 g, malt extract powder 20.0 g, Tween 80 0.5 g, KH2PO4 3.0 g, and distilled water 1000 mL.

[0046] The basal culture medium was prepared according to the following proportions: glucose 10.0 g, malt extract powder 20.0 g, KH2PO4 3.0 g, Tween 800.5 g, distilled water 1000 mL, natural pH.

[0047] CMC-Na medium was prepared according to the following proportions: sodium carboxymethyl cellulose 10.0 g, ammonium sulfate 4.0 g, potassium dihydrogen phosphate 2.0 g, magnesium sulfate heptahydrate 0.5 g, peptone 10.0 g, agar 15.0 g, and distilled water 1000 mL.

[0048] In the examples, primer ITS1 and primer ITS4 were both synthesized by Shanghai Sangon.

[0049] In the embodiments, if data statistics and analysis are involved, Excel and Origin software are used to perform statistical analysis on the data.

[0050] The following is an introduction through specific embodiments.

[0051] Example 1

[0052] Plot Setup and Sample Collection: Representative sites were selected as experimental plots from four forest types within the study area: broadleaved Korean pine forest, mixed poplar-birch forest, mixed birch-larch forest, and pure red spruce (Picea koraiensis) forest. These sites were selected based on altitude, aspect, slope, and slope position. Five 1m x 1m plots were randomly set within each forest type. In the summer of 2022, ground cover fuels from the undecomposed and semi-decomposed layers were collected as sources of degrading bacteria and samples for degradation testing.

[0053] Strain Isolation and Identification: Ground cover combustible samples collected from different decomposition layers were moderately pulverized and mixed thoroughly in sterile water by vortexing. The stock solution was diluted into a series of concentration gradients (i.e., 10-, 20-, and 30-fold dilutions). The dilutions were spread onto PDA plates containing 200 μg / L streptomycin and incubated at 28°C for 5 days. Single colonies with significantly different morphological characteristics were selected, repeatedly isolated and purified, and pure strains were obtained and numbered. Fungal genomic DNA was extracted and amplified by PCR using primers ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO: 1) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO: 2). After electrophoresis on a 1% agarose gel, the unpurified product was sequenced by Shanghai Sangon Biotechnology Co., Ltd. The ITS sequencing results were aligned using NCBI Blast. A phylogenetic tree was constructed using MEGA5.1 software, combined with relevant ITS sequences from GenBank.

[0054] A total of 62 fungal strains were isolated using the above method. Morphological observation and ITS-rDNA sequencing were combined to identify the isolates, which were classified into 21 species belonging to 18 genera: Aspergillus, Cerrena, Coniochaeta, Coniothyrium, Discosia, Fusarium, Phoma, Paraconiothyrium, Paramyrothecium, Peniophora, Pestalotiopsis, Phlebiopsis, Plectosphaerella, Trichoderma, Microdiplodia, Myrothecium, Schizophyllum, and Letendraea. Among them, the genus of Pseudomonas was the dominant genus, accounting for 55% of the total number of isolated strains. The next genus was Pseudomonas and Pseudomonas, accounting for 11% and 6% of the total number of isolated strains, respectively. Figure 1 ).

[0055] Example 2

[0056] 2.1 Screening for Lignin-Degrading Fungi: One representative strain from each of the 21 identified species was selected for screening of lignin-degrading fungi. The guaiacol plate colorimetric method and the aniline blue plate decolorization method were used to assess the ability of the strains to secrete extracellular lignin-degrading enzymes. A bacterial cake was prepared from the edge of a pure bacterial colony and inoculated onto the center of a PDA-guaiacol plate. The plate was incubated at 28°C. After 5 days of growth, colonies with a distinct color zone were selected. The colony size and the diameter of the color zone on the PDA-guaiacol plate were measured using a vernier caliper. Strains with a large color zone to colony diameter ratio were selected. The selected bacterial pellets were inoculated onto a PDA-aniline blue plate and incubated at 28°C. The time for the formation of the decolorization zone was observed and recorded. The colony size and the diameter of the decolorization zone on the PDA-aniline blue plate were measured using a vernier caliper.

[0057] The guaiacol colorimetric method can better reflect the laccase activity of the strain, while the decolorization of aniline blue is related to the production of lignin peroxidase and manganese peroxidase. Through observation and calculation, among the 18 genera, only strains of the genera Phlebiopsis, Cerrena, Paraconiothyrium, Coniothyrium, Letendraea, and Peniophora can oxidize guaiacol to produce a color circle ( Figure 2), among which 9 fungi, including HE-1-3-⑨, YM-1-3-①5, YM-3-4-⑥, 2-1-24, YM-1-4-⑤, 2-1-36, Red 1-3-4-⑥, YY-3-3-③ and 1-2-25, had larger color zone diameters, as shown in Table 1. Their φC / φF were all greater than 1, suggesting that they may be lignin-degrading fungi with high laccase activity. Among them, 4 fungi, including Red 1-3-4-⑥, HE-1-3-⑨, 2-1-24 and YM-1-4-⑤, could also decolorize aniline blue ( Figure 2 ), which can produce peroxidase, and preliminarily judged that the four strains are lignin-degrading fungi.

[0058] Table 1 Guaiacol plate color development and aniline blue plate decolorization results

[0059]

[0060]

[0061] Note: φF: colony diameter; φC: color development zone diameter; φD: decolorization zone diameter

[0062] 2.2 Screening of cellulose-degrading fungi

[0063] (1) Use Congo red staining to screen cellulose-degrading strains. The purified strains were inoculated in a triangular pattern on a CMC-Na culture medium plate and cultured at a constant temperature of 28°C. After the bacteria grew colonies on the plate, Congo red reagent was added to the culture medium for staining, and then 1 mol / L NaCl solution was added for decolorization. The colonies that produced hydrolysis circles were picked, and the diameters of the hydrolysis circles and colonies on the CMC-Na culture medium were measured with a vernier caliper. The ones with the larger ratio were selected for filter paper strip degradation tests to verify the actual degradation ability of the cellulose-degrading strains.

[0064] Experimental Results: The identified strains were inoculated onto CMC-Na plates. After staining and decolorization, six strains from the genera Coniochaeta, Pestalotiopsis, Aspergillus, Coniothyrium, Phlebiopsis, and Cerrena exhibited distinct hydrolysis zones with φH / φF ratios greater than 1. These six strains, HE-1-3-⑨, 1-1-41, 1-2-1, 2-1-24, YY-3-3-⑥, and 2-2-32, were preliminarily identified as cellulose-degrading fungi. The sizes of the colonies and their surrounding hydrolysis zones are shown in Table 2. Hydrolysis zone size correlates with the amount and activity of cellulase produced by the fungus; larger hydrolysis zones indicate a stronger cellulose-degrading ability. Among them, strain HE-1-3-⑨ exhibited a significantly higher φH / φF ratio than the other tested strains, indicating its greatest potential for cellulase production.

[0065] Table 2 CMC-Na plate staining results

[0066]

[0067]

[0068] Note: φH: diameter of hydrolysis circle

[0069] (2) Filter paper strip degradation test, including the following steps: preparing a bacterial cake at the edge of the colony of the screened strain, inoculating it into PDB medium, and incubating it at 28°C and 160 rpm for 5 days to obtain a strain seed solution, which was then centrifuged to obtain a bacterial suspension. Adding filter paper strips to Hutcheson's inorganic salt medium, inoculating 1 mL of bacterial solution, and incubating it at 28°C and 160 rpm, regularly observing the degradation of the filter paper strips. The degradation ability of the cellulose-degrading bacteria was determined based on the degree of breakage of the filter paper strips.

[0070] After 7-15 days of inoculation with each strain, the filter paper strips showed ulceration. The degradation effect of HE-1-3-⑨ strain on the filter paper strips is shown in the figure. Figure 3 As shown, it shows that strain HE-1-3-⑨ has the ability to degrade cellulose.

[0071] Based on the above results, it can be seen that strain HE-1-3-⑨ has the ability to degrade both lignin and cellulose.

[0072] Example 3

[0073] Ground cover combustible degradation test: The strain screened in Example 2 was inoculated onto a PDA plate and cultured at a constant temperature of 28°C for 7 days. A bacterial cake was prepared in the area where the mycelium grew vigorously using a puncher (φ = 6 mm). The bacterial cake was inoculated into a triangular flask containing 100 mL of PDB medium and cultured at a constant temperature of 28°C and 160 rpm for 7 days. The culture was centrifuged at 4000 rpm for 10 min, and the supernatant was taken as the suspension of the lignin-degrading strain.

[0074] The undecomposed surface combustible material sample from Example 1 was dried to constant weight and cut into pieces. 2 g of the piece was weighed and placed in a 50 mL Erlenmeyer flask containing 20 mL of malt extract medium. 600 μL of bacterial suspension (i.e., a suspension of the lignin-degrading strain prepared using the above method) was inoculated to measure combustible mass loss and lignin content during the degradation process. Separate Erlenmeyer flasks containing combustible material samples from different forest types were prepared, and sterile water equal to the bacterial suspension was added as a control. All of the above Erlenmeyer flasks were placed in an artificial incubator and incubated at 25°C and 80% humidity. Sampling began on the 10th day after inoculation. Three Erlenmeyer flasks treated with different bacterial suspensions were used each time to measure mass loss, lignin content, and cellulose content. Sampling was performed every 10 days, with the final sampling occurring on the 60th day.

[0075] Take out the degraded ground cover combustible material sample from the conical flask, remove the surface mycelium with tweezers, dry it to constant weight, and calculate the mass loss rate of the sample after degradation.

[0076]

[0077] Qingdao Stand Testing Group Co., Ltd. used the ELISA double-antibody sandwich method to determine the lignin content and cellulose content of ground cover combustible samples during the degradation process, and calculated the lignin degradation rate and cellulose degradation rate.

[0078]

[0079] The study found that YM-1-4-⑤ grew slowly, making it unsuitable for degradation. Therefore, based on their growth rates, three strains, Hong 1-3-4-⑥, HE-1-3-⑨, and 2-1-24, were selected for ground cover fuel degradation experiments. Table 3 shows that over the 60 days of degradation, the overall weight of ground cover fuels in all stand types showed a fluctuating downward trend, with significant weight loss in the first 10 days, reaching a maximum of 25.17%. Fuel weight loss rates varied across different stand types. Overall, weight loss rates for larch-birch, spruce, and poplar-birch fuels were higher than those for broad-leaved Korean pine forests. After 60 days of degradation, the highest weight loss rates for larch-birch, spruce, and poplar-birch fuels reached 23.00%, 22.00%, and 26.33%, respectively, compared to a maximum of 11.83% for broad-leaved Korean pine forests. Among them, the highest weight loss rates of larch-birch and spruce combustibles both occurred after degradation by the strain HE-1-3-⑨.

[0080] Table 3 Changes in fuel mass loss of different forest types during degradation

[0081]

[0082] During the degradation process, the lignin content in the ground cover fuels showed significant differences among the different strains (Table 4). Within the first 10 days, lignin content in fuels from all stand types, except for the broadleaved Korean pine forest, decreased rapidly. This is consistent with the mass loss of fuels during the same period. The weight loss of fuel samples may be partially attributed to lignin degradation. Strain HE-1-3-⑨ was the first to demonstrate strong lignin degradation. The highest lignin degradation rates in poplar-birch and spruce fuels, reaching 19.69% and 16.01%, respectively, occurred after degradation by strain HE-1-3-⑨. During the 10-20 day period, the lignin content in spruce fuels degraded by strains Hong 1-3-4-⑥ and HE-1-3-⑨ continued to decrease, while the lignin content in broadleaf Korean pine fuels treated with strain 2-1-24 increased, indicating an enrichment phenomenon. Overall, the degradation process showed that lignin degradation in spruce fuels and poplar-birch fuels was superior to that in larch-birch and broadleaf Korean pine fuels, with peak degradation rates of 23.42% and 23.28% after 60 days, respectively. Strain Hong 1-3-4-⑥ and HE-1-3-⑨ demonstrated strong lignin degradation capabilities. Based on the speed of their lignin degradation, strain HE-1-3-⑨ was identified as the target strain.

[0083] Table 4 Changes in lignin content in ground cover fuels of different forest types during degradation

[0084]

[0085] Changes in cellulose content in ground cover fuels of different forest types Figure 4 As shown in Figure 2 , cellulose content decreased significantly between 0 and 10 days, similar to lignin. The largest decrease occurred in fuels from broadleaved Korean pine forests, with degradation rates approximately 1.79-2.83 times those of other fuels. By the end of the indoor degradation period, strain HE-1-3-⑨ exhibited greater activity than other strains, achieving the best cellulose degradation, with degradation rates ranging from 16.79% to 21.90%. After 60 days of degradation, the cellulose content in fuels from broadleaved Korean pine forests decreased the most, demonstrating the highest degree of degradation among different forest types.

[0086] Based on the results of indoor tests on ground cover combustibles, strains Hong 1-3-4-⑥ and HE-1-3-⑨ demonstrated relatively high lignin degradation capabilities, while strain HE-1-3-⑨ exhibited relatively strong cellulose degradation capabilities. While strain 2-1-24, previously screened, possessed the ability to degrade both lignin and cellulose, it was less effective when using ground cover combustibles as substrates. Therefore, strains Hong 1-3-4-⑥ and HE-1-3-⑨ were ultimately selected as the source strains for the preparation of the inoculant and used in field degradation tests.

[0087] Example 4 Bacteria Identification

[0088] After the strain HE-1-3-⑨ was cultured on PDA medium at 28℃ for 7 days, the surface of the colony of the strain HE-1-3-⑨ was white and fluffy, with slender hyphae and a relatively uniform and loose distribution ( Figure 5 ).

[0089] Based on the ITS sequencing results, the ITS sequence of strain HE-1-3-⑨ was aligned with the model strain and closely related strains in GenBank, and a phylogenetic tree was constructed using MEGA 5.1 software. Figure 6 The strain HE-1-3-⑨ was identified as Phlebiopsis pilatii and named HE39.

[0090] On February 5, 2024, the strain HE-1-3-⑨ was deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC), and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China. The strain name is HE39, and the recommended classification name belongs to Phlebiopsis pilatii. The deposit number is CGMCC No. 41168.

[0091] Example 5

[0092] Optimization of culture medium components: The following ingredients were selected as carbon sources, nitrogen sources, and inorganic salts to replace glucose, malt extract powder, and potassium dihydrogen phosphate in the basal culture medium.

[0093] The specific experimental method includes the following steps:

[0094] Strain HE39 was inoculated onto PDA plates and cultured at 28°C for 7 days. A fungus cake was obtained from an area of ​​vigorous mycelial growth using a 6 mm borer. This cake was inoculated into 100 mL of PDB medium in a conical flask and cultured at 28°C and 160 rpm for 7 days. The culture was centrifuged at 4000 rpm for 10 minutes. The supernatant, representing the suspension of the lignin-degrading strain, was used as seed culture for subsequent experiments. The seed culture was inoculated into 250 mL of the corresponding culture medium at a 3% (volume percentage) inoculum. The culture was incubated at 28°C and 180 rpm for 3 days. After centrifugation, the supernatant was collected and assayed for LiP, MnP, and Lac enzyme activities. LiP enzyme activity was determined using an ELISA kit from Qingdao Kechuang Quality Testing Co., Ltd.; MnP enzyme activity was determined using an ELISA kit from Qingdao Kechuang Quality Testing Co., Ltd.; and Lac enzyme activity was determined using an ELISA kit from Qingdao Kechuang Quality Testing Co., Ltd.

[0095] Based on the results of multiple enzyme activity tests, the optimal carbon source, nitrogen source, and inorganic salt were selected as the new fermentation medium formula to provide a source of nutrients for the subsequent preparation of field degradation agents.

[0096] Different carbon sources: sucrose, corn flour, and soluble starch were used to replace glucose in the basal culture medium;

[0097] Different nitrogen sources: Yeast powder, tryptone, and soybean powder were used to replace the malt extract powder in the basal culture medium;

[0098] Different inorganic salts: replace potassium dihydrogen phosphate in the basal culture medium with calcium chloride, sodium chloride, and magnesium sulfate respectively.

[0099] By replacing the carbon source, nitrogen source, and inorganic salt components in the basal culture medium, we analyzed the effects of different components on the lignin-degrading enzyme production of strain HE39. The results are shown in Table 5. Enzyme activity assays showed that when sucrose was used as the carbon source, strain HE39's LiP and MnP reached their maximum values, at 568.27 U / L and 42.32 U / L, respectively. When soybean meal was used as the nitrogen source, strain HE39's Lac reached its maximum value, at 100.53 U / L. When calcium chloride was used as the inorganic salt, strain HE39's LiP activity reached its highest level. In summary, sucrose, soybean meal, and calcium chloride were the optimal carbon, nitrogen, and inorganic salt sources, respectively, for enzyme production in strain HE39. This optimized fermentation medium (g / L) was determined as follows: 10.0 g sucrose, 20.0 g soybean meal, 3.0 g calcium chloride, and 0.5 g Tween 80. This formulation will serve as the nutrient source for subsequent inoculant preparation.

[0100] Table 5 Enzyme production activity of strain HE39 under different culture medium components

[0101]

[0102]

[0103] In addition, the study found that the lignin degradation rate sometimes increased during the degradation process, showing an enrichment phenomenon. On the one hand, this may be because lignin, as a difficult-to-degrade substance, combines with other macromolecules in ground cover combustibles, such as cellulose, to form a barrier structure, which limits the entry of microorganisms and inhibits their physiological metabolic activities. On the other hand, the easily degradable components (soluble carbon, nitrogen, phosphorus, etc.) in ground cover combustibles are rapidly lost in the early stages of degradation, resulting in a rapid decrease in the proportion of easily degradable components in the combustibles, which increases the proportion of difficult-to-degrade components such as lignin, affecting their degradation rate. Therefore, research on the degradation of lignin in ground cover combustibles needs to comprehensively consider the influence of other components.

[0104] Lignin-degrading bacteria can be applied in multiple fields. In the agricultural field, by screening efficient lignin-degrading bacteria and optimizing enzyme production conditions, they can be applied to the degradation of agricultural production waste (straw) to improve degradation efficiency. In animal husbandry, lignin-degrading bacteria can be used to destroy the lignin structure in plant-based feed, improve the digestion and utilization of feed by animals, and thus reduce feed costs. In the industrial field, lignin-degrading fungi can be used to construct a co-culture system, perform biological pretreatment on straw, reduce the structural barrier of lignin biomass, and effectively improve the efficiency of biomass conversion to produce biofuels. In the forestry field, lignin-degrading bacteria can be used to improve soil quality and structure, improve plant growth efficiency, and thus promote the stability of the ecosystem.

[0105] Example 6 Field degradation bacterial agent and its preparation method

[0106] Fermentation medium (g / L): sucrose 10.0, soybean powder 20.0, calcium chloride 3.0, Tween 80 0.5, prepared with water.

[0107] The method for preparing a microbial agent comprises the following steps: selecting the screened fungus HE39 as a source strain for microbial agent preparation; opening a pure culture plate of the strain in a sterile operating chamber; using a sterilized borer (outer diameter 6 mm) to produce a bacterial cake from an area with vigorous mycelial growth; inoculating 40 bacterial cakes into a 1000-mL Erlenmeyer flask containing 400 mL of fermentation medium; incubating the mixture at 28°C and 160 rpm for 5 days with constant temperature shaking; and centrifuging at 4000 rpm for 10 minutes to obtain the supernatant to obtain the degradation strain microbial agent.

[0108] Example 7

[0109] Field degradation experiments were conducted in pure birch and Changbai Larix olgensis forests and mixed Quercus mongolica and Pinus sylvestris var. mongolica forests at the Yitong Base of the Jilin Academy of Forestry. A 10 m × 10 m standard plot was established for each forest type, with three 1 m × 1 m plots within each standard plot. Before field degradation began, ground cover combustibles were collected from the plots, dried to a constant weight, and placed in nylon mesh bags (10.0 g per bag). The bags were labeled with the forest type and sample number, weighed, and the initial mass recorded. The bags were then returned to the plots and secured with a metal mesh.

[0110] The selected degrading fungal strains were selected as source strains for the preparation of the inoculant. A plate of pure cultured degrading strains was opened in a sterile operating chamber, and a sterile hole punch (6 mm outer diameter) was used to extract a fungal cake from an area of ​​vigorous mycelial growth. Forty cakes were inoculated into a 1000-mL Erlenmeyer flask containing 400 mL of the optimized fermentation medium and 0.5 g of Tween 80. The culture was shaken at 28°C and 160 rpm for 5 days to obtain a suspension of the degrading strain, which was then bottled for later use. Three doses of the inoculant (50 mL, 100 mL, and 150 mL, respectively) were manually sprayed onto nylon mesh bags within the plots. The spraying was carried out as evenly as possible to ensure that all combustibles within the bags were exposed to the inoculant. Each standard plot of each of the three forest types was treated identically. Combustible samples were collected every 14 days, with five bags sampled each time for a total of six times. The cellulose content of the samples was determined. The method for detecting the cellulose degradation rate is as in Example 3.

[0111] The degradation effect of ground cover cellulose in the field Figure 7 As shown, cellulose degradation rates increased over time in ground cover fuels from different forest types after treatment with inoculants HE39 and H46 (prepared using red 1-3-4-⑥ according to the method of Example 6), and were significantly higher than those in the control group (no inoculant). By the end of the field degradation, cellulose degradation rates in the birch, larch, and Mongolian oak-Mongol pine forests were 15.29%-20.59%, 8.66%-12.68%, and 14.32%-18.66%, respectively, representing increases of 1.74-2.69 times, 1.79-3.08 times, and 4.01-5.53 times, respectively, compared to the control group. Throughout the degradation process, inoculant HE39 consistently outperformed inoculant H46; the cellulose degradation rates for both inoculants followed the order of high dose > medium dose > low dose > control group for each dose.

[0112] Example 8

[0113] The experimental method is as in Example 7. Field degradation effect: The degradation effect of lignin in the ground cover combustibles of birch, larch and Mongolian oak-Mongol pine forests treated with the microbial agent was better than that of the control group without microbial agent. After 84 days of field degradation, the lignin degradation rate reached a maximum of 23.48%.

[0114] The present invention qualitatively screened and obtained four strains of lignin-degrading fungi from ground cover combustible samples collected in the field. By measuring combustible mass loss and lignin degradation rates during ground cover combustible degradation experiments, strain HE39, which exhibits a strong comprehensive ability to degrade lignin, was ultimately obtained. Its degradation significantly increased both ground cover combustible mass loss and lignin degradation rates, demonstrating the feasibility and potential for further research and development of lignin-degrading fungi to reduce ground cover combustible loads. In the present invention, the poplar and birch combustible had the highest weight loss rate, reaching 26.33% after 60 days of degradation. After degradation by HE39, its lignin degradation rate reached 23.28%, exceeding that of treatments with other fungi.

[0115] The lignin-degrading strain HE39 screened in this invention promotes the degradation of lignin in ground cover combustibles. Therefore, to achieve efficient ground cover combustible degradation, other strains with degradation capabilities can be introduced in practical applications to prepare composite bacterial agents, exploring optimal enzyme production conditions to achieve a synergistic degradation effect. This invention can provide a basis for using microorganisms to reduce forest combustible loads, thereby lowering forest fire risk levels and fire losses.

[0116] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A use of a fermentation broth of Pseudomonas pilatus in any one of (1) to (5), characterized in that: The fermentation broth of Phlebiopsis pilatii was prepared by the following method: inoculating the culture medium with Phlebiopsis pilatii HE39, fermenting the culture medium, centrifuging the culture medium, and collecting the supernatant; The deposit number of Phlebiopsis pilatii HE39 is CGMCC No.41168; (1) Degradation of lignin and / or cellulose; (2) preparing a preparation for degrading lignin and / or cellulose; (3) Degradation of forest floor combustibles; (4) producing lignin-degrading enzymes; (5) Increase the weight loss rate of combustible materials in forests.

2. The application according to claim 1, characterized in that The culture medium is PDB culture medium or fermentation culture medium.

3. The application according to claim 2, characterized in that: In the fermentation medium, the carbon source is selected from any one or any combination of sucrose, corn flour, soluble starch and glucose; the nitrogen source is selected from any one or any combination of tryptone, soybean powder, yeast powder and malt extract powder; and the inorganic salt is selected from any one or any combination of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.

4. The application according to claim 3, characterized in that In the fermentation medium, the carbon source content was 10.0 g / L, the nitrogen source content was 20.0 g / L, and the inorganic salt content was 3.0 g / L.

5. The use according to any one of claims 1 to 4, characterized in that: The culture temperature is 28°C; the culture time is 5-7 days; the culture is shaken at a rotation speed of 160 rpm; and the centrifugation condition is 4000 rpm for 10 minutes.

6. A method for using a fermentation broth of Pseudomonas pilatus, characterized in that: The following steps are involved: treating lignin or a substance containing lignin with the fermentation liquid of Pseudomonas pilatus; The fermentation liquid of Phlebiopsis pilatii is prepared by the following method: inoculating the culture medium with HE39 of Phlebiopsis pilatii for fermentation, centrifuging, and collecting the supernatant; The deposit number of Phlebiopsis pilatii HE39 is CGMCC No.41168.

7. The method of use according to claim 6, characterized in that: The culture medium is PDB culture medium or fermentation culture medium.

8. The method of use according to claim 7, characterized in that: In the fermentation medium, the carbon source is selected from any one or any combination of sucrose, corn flour, soluble starch and glucose; the nitrogen source is selected from any one or any combination of tryptone, soybean powder, yeast powder and malt extract powder; and the inorganic salt is selected from any one or any combination of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.

9. The method of use according to claim 8, characterized in that: In the fermentation medium, the carbon source content was 10.0 g / L, the nitrogen source content was 20.0 g / L, and the inorganic salt content was 3.0 g / L.

10. The method of use according to any one of claims 6 to 9, characterized in that: The culture temperature is 28°C; the culture time is 5-7 days; the culture is shaken at a rotation speed of 160 rpm; and the centrifugation condition is 4000 rpm for 10 minutes.

Images