Recombinant engineering bacterium, preparation method and application of recombinant engineering bacterium in efficient production of citicoline

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a recombinant engineering bacterium, a preparation method and application of the recombinant engineering bacterium in efficient production of citicoline. According to the invention, a plurality of aspects such as choline metabolic pathway of bacillus subtilis, enhancement of CTP precursor supply, reconstruction of central carbon metabolism and the like are modified, the finally constructed engineering bacterium is fermented for 24 hours in a shake flask, and the yield of citicoline reaches 1640.2 + / -2.4 mg / L; and fed-batch fermentation is carried out in a 5 L fermentation tank, the highest yield reaches 4788.4 + / -239.1 mg / L (149.0 + / -5.8 mg / g DCW) within 32 hours, and about 93% of products are accumulated in cells. The bacillus subtilis engineering bacterium constructed through modular engineering does not secrete endotoxin and is high in safety; only a cheap substrate choline chloride needs to be added for fermentation, and expensive cytidine monophosphate does not need to be exogenously added, so that the method has a remarkable cost advantage; meanwhile, high-proportion intracellular accumulation of the product is beneficial to separation and purification of subsequent products, and the method has huge industrial application potential.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and specifically relates to a recombinant engineering bacterium, a preparation method and application thereof in the efficient production of citicoline. Background Art

[0002] Citicoline (cytidine-5′-diphosphate choline, CDP-choline), a precursor of phosphatidylcholine and acetylcholine, participates in the formation of the cell membrane phospholipid bilayer and can stabilize the neurotransmitter system. It is effective in treating functional and consciousness disorders caused by brain damage, Parkinson's disease, depression, and glaucoma, and has been widely used in clinical medicine and health care products.

[0003] The microbial fermentation method of citicoline has been widely studied. Among them, Bacillus subtilis has become an ideal host for the production of citicoline due to its advantages such as GRAS (Generally Recognized as Safe) status, clear genetic background, strong protein secretion ability and ease of large-scale fermentation.

[0004] Studies have shown that in recombinant Bacillus subtilis, the biosynthesis of citicoline is mainly completed through the CDP-choline pathway (Kennedy pathway), which mainly includes the steps of choline uptake, production of phosphocholine, synthesis of CDP-choline, and regeneration of cytidine triphosphate (CTP). Its working principle is as follows: Bacillus subtilis takes up choline from the culture medium through the choline transporter and transports it into the cell. Under the catalysis of choline kinase (CK), the intracellular choline consumes ATP to produce phosphocholine (phosphocholine). This step is one of the rate-limiting steps of the CDP-choline pathway. Then, under the action of phosphocholine cytidylyltransferase (CCT), phosphocholine reacts with CTP to produce citicoline, while releasing pyrophosphate (PPi). In addition, an adequate supply of CTP is also crucial for the synthesis of citicoline. Within the cell, CTP is produced by the amination reaction of UTP under the catalysis of CTP synthetase (CTPS).

[0005] It can be seen that the entire biosynthesis process of citicoline is regulated by multiple factors, including enzyme activity, substrate supply, and balance of metabolic pathways. If you want to significantly increase the production of citicoline, you must optimize it from multiple levels. Summary of the Invention

[0006] In order to solve the above technical problems, the present invention provides a recombinant engineered bacterium, a preparation method and its application in the efficient production of citicoline.

[0007] The present invention provides a recombinant engineered bacterium, which is based on Bacillus subtilis BSC1-4 as the starting strain, and its following metabolic network is modified: Step S1, modification of the choline metabolic pathway: inactivation / knockout of the gene encoding choline dehydrogenase gbsB , gene encoding glycine betaine aldehyde dehydrogenase gbsA , introduction / overexpression of transporter proteins opuD , a gene encoding the choline transporter transcriptional repressor opcR ; Step S2, strengthening of CTP precursor supply: introducing / overexpressing a gene encoding a cytidine triphosphate synthase without feedback inhibition, the gene being pyrG A gene mutant in which the glutamic acid at position 156 of the encoded PyrG protein is replaced by lysine, and at the same time, the transcriptional repressor gene encoding the pyrimidine nucleotide operon is inactivated / knocked out pyrR , genes encoding pyrimidine nucleotide phosphorylase pdp , genes encoding cytidine deaminase cdd ; Step S3, reconstruction of central carbon metabolism: inactivating / knocking out key node genes in the central carbon metabolism pathway, wherein the key node genes are selected from at least one of the following: Gene encoding fructose-1,6-bisphosphatase fbp ; Gene encoding phosphoenolpyruvate carboxykinase pckA ; Gene encoding pyruvate:quinone oxidoreductase ydaP ; Gene encoding malic enzyme ytsJ .

[0008] Among the above-mentioned recombinant engineered bacteria provided by the present invention, preferably, the Bacillus subtilis BSC1-4 is the strain disclosed in the inventor's patent CN116790466B.

[0009] In step S3, the gene encoding fructose-1,6-bisphosphatase is inactivated / knocked out fbp , genes encoding pyruvate:quinone oxidoreductase ydaP , genes encoding malic enzyme ytsJ .

[0010] Furthermore, the application of the recombinant engineered bacteria in the production of citicoline is also the key technical content protected by the present invention. The application specifically involves using the recombinant engineered bacteria as a fermentation strain and choline chloride as a substrate to ferment and produce citicoline.

[0011] Preferably, the present invention also provides a method for producing citicoline by fed-batch fermentation using the recombinant engineered bacteria, the specific operation of which is as follows: First, the engineered strain stored in the glycerol tube was inoculated into a 1 L Erlenmeyer flask containing 100-300 mL of LB medium and cultured at 37°C and 220 rpm for 10 h to prepare the seed solution. Subsequently, all the seed liquid was aseptically inoculated into a 5 L fermenter containing 1.8 L of initial fermentation medium for fermentation culture; the initial fermentation conditions were set as follows: temperature 37°C, initial stirring speed 200 rpm, ventilation volume 2 mL / min, tank pressure maintained at 0.05 MPa, and ammonia water was used to adjust the medium pH online and maintain it at 7.0.

[0012] In the above method, preferably, the components of the initial fermentation medium are: glucose 40 g / L, corn steep liquor powder 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, (NH4)2SO4 10 g / L, KH2PO4 3 g / L, K2HPO4 8 g / L, MgSO4·7H2O 1 g / L, and the pH of the initial fermentation medium is 7.2.

[0013] Preferably, during the fermentation process, the dissolved oxygen level is maintained above 30% by adjusting the stirring speed to 200-700 rpm and the dissolved oxygen linkage control strategy.

[0014] Preferably, during the fermentation process, when the dissolved oxygen level decreases due to rapid bacterial growth, the stirring speed is automatically increased. When the dissolved oxygen level begins to rise rapidly at the highest speed, the stirring speed is fixed at 700 rpm, and the batch feed medium and choline chloride solution are pumped in at the set flow rate.

[0015] Preferably, the feed medium is composed of 600 g / L glucose, 20 g / L MgSO4·7H2O, and 30 g / L choline chloride. The beneficial effects of the present invention are: (1) Significantly improved citicoline production: The present invention systematically and synergistically transforms the three core modules of choline utilization, CTP supply, and energy metabolism, opens up multiple rate-limiting steps in the citicoline synthesis pathway, and optimizes metabolic flow. Compared with the Bacillus subtilis (CN116790466B, yield 114.3 mg / L) reported in the prior art, the engineered bacteria constructed by the present invention has a yield of up to 4788.4±239.1 mg / L in a 5 L fermenter, an increase of about 42 times, reaching the potential level of industrial production. (2) Significantly reduced production costs: The recombinant engineered bacteria of the present invention can efficiently utilize inexpensive glucose and choline chloride as main raw materials and efficiently synthesize the key precursor CTP through endogenous metabolism. There is no need to add expensive intermediates such as CMP or choline phosphate during the fermentation process, which greatly reduces production costs. (3) Downstream processing friendly: When the recombinant engineered bacteria prepared by the present invention are used to prepare citicoline, about 93% of the product accumulates in the bacterial cells, forming a high-concentration product environment. Although the unit operation of cell disruption is added, the complex process of handling a large amount of fermentation clear liquid is avoided, which is conducive to the subsequent concentration, separation and purification of the product, and reduces the equipment and operating costs of downstream processing. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the metabolic pathway and systematic transformation strategy of the recombinant engineered bacteria in the present invention; Among them, PEP: phosphoenolpyruvate; TCA: tricarboxylic acid cycle (also known as citric acid cycle); UMP: uridine monophosphate; UTP: uridine triphosphate; CTP: cytidine triphosphate; CMP: cytidine monophosphate; ATP: adenosine triphosphate; ADP: adenosine diphosphate; PPi: pyrophosphate; ywjI , fbp : Encoding 1,6-bisphosphatase; pckA : Encoding phosphoenolpyruvate carboxykinase; ydaP : pyruvate:quinone oxidoreductase; ytsJ : encoding malic enzyme; pyrR : encoding pyrimidine nucleotide operon ( pyr operon) repressor protein; pyrG E156K : Encoding CTP synthetase without feedback inhibition; pdp : encoding pyrimidine nucleotide phosphorylase; cdd : encoding cytidine deaminase; gbsA : Glycine betaine aldehyde dehydrogenase; gbsB : encoding choline dehydrogenase; opcR : Encoding choline transporter OpuB and OpuC operons ( opuB operon and opuC operon) transcriptional repressor protein; gbsR :coding opuB OpuB, OpuC, OpuD: choline transporters; CKI : encoding choline kinase; CCT : encoding choline cytidylyltransferase; Figure 2This is a performance curve of the final engineered strain BSC10-6 of the present invention in a 5 L fermentor for fed-batch fermentation; Among them, A shows the changes in bacterial concentration and glucose concentration during the fermentation process, and B shows the changes in the intracellular, extracellular and total citicoline production during the fermentation process, as well as the citicoline specific production. DETAILED DESCRIPTION

[0017] In order to enable those skilled in the art to better understand the present invention, the present invention will be further explained in conjunction with specific embodiments.

[0018] 1. Preparation and Sources of the Strains, Plasmids, and Culture Media Involved in the Present Invention The information of all strains and plasmids involved in the present invention is shown in Table 1. The primers were synthesized by Qingke Biotechnology Co., Ltd.

[0019] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, for general culture of Bacillus subtilis. For solid culture, add 15 g / L agar powder and, if necessary, add 16 μg / mL neomycin or 8 μg / mL chloramphenicol.

[0020] Shake flask fermentation medium: glucose 40 g / L, corn steep liquor 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, (NH4)2SO4 10 g / L, KH2PO4 3 g / L, K2HPO4 8 g / L, MgSO4·7H2O 1 g / L, pH 7.2. After fermentation for 4 h, choline chloride was added to a final concentration of 1 g / L.

[0021] Fed-batch initial medium: the same as shake flask fermentation medium, feed medium consists of 600 g / L glucose, 20 g / L MgSO4·7H2O and 30 g / L choline chloride.

[0022] Table 1 Strains and plasmids involved in the experiment

[0023] 2. Primers and sequences involved in the present invention The primers used for PCR are shown in Table 2.

[0024] Table 2 PCR primer sequences Primer Sequence Name Sequence (5'→3') fbp-U1 SEQ ID No.1 GGTTGTTGAAGTTGGTGAA fbp-G2 SEQ ID No.2 TGTATAGCAGCGAGTAGC fbp-D2 SEQ ID No.3 GGCGGAAGTAAGATTGAGAA pckA-U1 SEQ ID No.4 GCACGCATAACCGAACAT pckA-G2 SEQ ID No.5 TGAGCCGAAGCAAGTAGA pckA-D2 SEQ ID No.6 AGGAGAAGGCTATGAGGATT ydaP-U1 SEQ ID No.7 CTATGTCATCCAAGGTGTCA ydaP-G2 SEQ ID No.8 GAGAGCCGAATCACAGAC ydaP-D2 SEQ ID No.9 TGGCTGATTGCTGTATTGA ytsJ-U1 SEQ ID No.10 AAGCGGACCTATTGAGAAG ytsJ-G2 SEQ ID No.11 GTCAGCATCAACGATAACAT ytsJ-D2 SEQ ID No.12 GTAGTCGGATGCGTCATT

[0025] 3. HPLC analysis conditions of citicoline in the present invention High performance liquid chromatography LC-2030 (Shimadzu); chromatographic column, PC HILIC column (250 mm × 4.6 mm, 5 μm); column temperature, 30°C; mobile phase A was 0.5% formic acid in water, and mobile phase B was acetonitrile / methanol (8:2, v / v ) solution, A:B in a ratio of 4:6 ( v / v ) ratio for isocratic elution; flow rate, 1.0 mL / min; detector, UV detector; detection wavelength, 280 nm; injection volume, 20 μL.

[0026] Example 1 In this example, in order to promote more carbon flux into TCA, the gluconeogenesis pathway genes were knocked out. fbp 、 pckA 、 ydaP , blocking the conversion of pyruvate to acetate, knocking out ytsJ , reducing the conversion of malate to phosphoenolpyruvate, respectively fbp Knockout strain BSC10-1, fbp and pckA Double knockout strain BSC10-2, fbp and ydaP Double knockout strain BSC10-3, fbp and ytsJ Double knockout strain BSC10-4, fbp 、 ytsJ and pckA Triple knockout strain BSC10-5, fbp 、 ytsJ and ydaP Triple knockout strain BSC10-6.

[0027] The specific operations of this embodiment are: Step S1, modification of the choline metabolic pathway: knocking out the gene encoding choline dehydrogenase gbsB , gene encoding glycine betaine aldehyde dehydrogenase gbsA , introduction / overexpression of transporter proteins opuD , a gene encoding a choline transporter transcriptional repressor opcR The obtained recombinant engineered bacteria were named BSC5-1; Step S2, strengthening of CTP precursor supply: introducing a gene encoding a cytidine triphosphate synthase that is free of feedback inhibition, the gene being pyrG The gene mutant, in which the glutamic acid at position 156 of the encoded PyrG protein is replaced by lysine; at the same time, the transcriptional repressor protein gene encoding the pyrimidine nucleotide operon is knocked out. pyrR , genes encoding pyrimidine nucleotide phosphorylase pdp, genes encoding cytidine deaminase cdd The obtained recombinant engineered bacteria were named BSC9-8; Step S3, reconstruction of central carbon metabolism, specifically the following operations: BS168N / Δ fbpm The genome of the strain was used as a template, and the primer pair fbp-U1 / fbp-G2 was used to amplify the fragment UDCRG (SEQ ID No. 13). The fragment UDCRG was transformed into competent cells of BSC9-8 to obtain fbp Knockout strain BSC10-1.

[0028] BS168N / Δ pckAm The genome of the strain was used as a template, and the primer pair pckA-U1 / pckA-G2 was used to amplify the fragment UDCRG (SEQ ID No. 14), which was then transformed into competent cells of BSC10-1 to obtain fbp and pckA Double knockout strain BSC10-2.

[0029] BS168N / Δ ydaPm The genome of the strain was used as a template, and the primer pair ydaP-U1 / ydaP-G2 was used to amplify the fragment UDCRG (SEQ ID No. 15), and then transformed into competent cells of BSC10-1 to obtain fbp and ydaP Double knockout strain BSC10-3.

[0030] BS168N / Δ ytsJm The genome of the gene was used as a template, and the primer pair ytsJ-U1 / ytsJ-G2 was used to amplify the fragment UDCRG (SEQ ID No. 16), which was then transformed into competent cells of BSC10-1 to obtain fbp and ytsJ Double knockout strain BSC10-4.

[0031] The same method as above was used to obtain fbp 、 ytsJ and pckA triple knockout strain 10-5 and fbp 、 ytsJ and ydaP triple knockout strain 10-6.

[0032] Test Example 1 The fermentation effects of various engineered bacteria prepared in Example 1 on producing citicoline were evaluated.

[0033] Each engineered strain stored in a glycerol tube was streaked on an LB agar plate for activation. A single colony was picked from the plate and inoculated into a test tube containing 5 mL of LB liquid medium. The culture was shaken at 37°C and 200 rpm for 12 h to prepare a seed solution. The seed solution was transferred to a 250 mL conical flask containing 30 mL of fermentation medium at a 1% (v / v) inoculation rate and shaken in a shaker at 37°C and 220 rpm. Choline chloride was added to a final concentration of 1 g / L after 4 h of fermentation, and the total fermentation time was 24 h.

[0034] During the shake flask fermentation process, 1 mL of fermentation liquid was taken at 4 h, 8 h, 12 h, 20 h, and 24 h, and the supernatant was discarded by centrifugation. The cell pellet was washed with deionized water, resuspended, and diluted appropriately. The OD value of the bacterial suspension was measured. 600 In addition, 2.5 mL of fermentation broth was taken at 12 h and 24 h for the determination of total citicoline production.

[0035] The control strain BSC9-8, fbp Knockout strain BSC10-1, [[ID=1→118]]fbp and pckA Double knockout strain BSC10-2, fbp and ydaP Double knockout strain BSC10-3, fbp and ytsJ Double knockout strain BSC10-4, and fbp 、 ytsJ and pckA Triple knockout strain 10-5, fbp 、 ytsJ and ydaP The triple knockout strain was fermented at 10-6, and the growth results of the strains are shown in Table 3.

[0036] Table 3 OD of strain growth 600 Time (h) BSC9-8 BSC_{10}-1 BSC_{10}-2 BSC_{10}-3 BSC_{10}-4 BSC_{10}-5 BSC_{10}-6 4 0.7±0.1 0.2±0.0 1.9±0.3 2.0±0.3 2.5±0.1 0.9±0.0 2.5±0.2 8 5.1±0.3 5.5±0.3 7.4±0.7 6.3±0.5 7.4±0.4 7.0±0.1 8.2±0.3 12 8.3±0.3 8.8±0.2 10.3±0.4 10.8±0.3 11.3±0.1 10.8±0.1 11.0±0.8 20 14.2±0.8 14.3±0.2 14.4±0.0 14.3±0.2 14.3±0.2 15.0±0.4 14.7±0.2 24 14.3±1.2 14.9±0.7 15.2±0.9 15.4±1.2 14.1±0.9 14.8±0.5 14.7±0.2

[0037] The results in Table 3 indicate that single or combined knockout of the central carbon metabolism-related genes involved in the present invention did not have a significant negative impact on the growth of the strain.

[0038] The citicoline production results of each strain at 12 h and 24 h of fermentation are shown in Table 4.

[0039] Table 4 Citicoline production (mg / L) of different strains after 12 h and 24 h of fermentation Strain 12 h 24 h BSC9-8 846.9 ± 17.2 1441.4 ± 15.7 BSC_{10}-1 855.1 ± 17.4 <![CDATA[1546.2 ## ± 25.8]]> BSC_{10}-2 <![CDATA[911.7 ## ± 9.9]]> <![CDATA[1495.6 # ± 21.1]]> BSC_{10}-3 <![CDATA[926.3 ## ± 11.4]]> <![CDATA[1543.2 ## ± 32.0]]> BSC_{10}-4 <![CDATA[947.3 ## ± 18.2]]> <![CDATA[1545.7 ## ± 13.2]]> BSC_{10}-5 <![CDATA[906.9 # ± 14.5]]> <![CDATA[1607.0 ## ± 19.2]]> BSC_{10}-6 <![CDATA[991.2 ## ± 14.7]]> <![CDATA[1640.2 ## ± 2.4]]>

[0040] Note: #The results showed that there were significant differences compared with the control strain BSC9-8 (P<0.05); ## The results showed that there was a very significant difference compared with the control strain BSC9-8 (P < 0.01).

[0041] The results in Table 4 show that the modification of the central carbon metabolic pathway can further significantly increase the production of citicoline. fbp The citicoline production of strain BSC10-1 after 24 h of fermentation was 1546.2±25.8 mg / L, which was 7.3% higher than that of the control strain BSC9-8 (production 1441.4±15.7 mg / L). pckA 、 ydaP and ytsJ The double knockout strains BSC10-2, 10-3 and 10-4 were obtained. Their 24 h citicoline production did not increase significantly, but their 12 h production increased by 6.6%, 8.3% and 10.8% respectively compared with BSC10-1. Finally, the triple knockout strain BSC10-5 (Δ fbp , Δ ytsJ ,Δ pckA ) and BSC10-6 (Δ fbp , Δ ytsJ , Δ ydaP ), with 24-hour citicoline production reaching 1607.0±19.2 mg / L and 1640.2±2.4 mg / L, respectively. In particular, the final engineered strain, BSC10-6, exhibited the best production performance, with a 13.8% increase in yield compared to the starting strain, BSC9-8, reaching the highest value in shake flasks.

[0042] The above results show that the present invention can block the gluconeogenesis pathway (knockout fbp 、 pckA ) and direct more carbon flux to the TCA cycle (knockout ydaP 、 ytsJ ), which can effectively enhance the cell's energy metabolism and the supply of key precursors, thereby ultimately achieving a significant increase in citicoline production.

[0043] Experimental Example 2: Fed-batch fermentation in a fermenter First, the engineered strain BSC10-6 stored in a glycerol tube was inoculated into a 1 L Erlenmeyer flask containing 200 mL of LB medium and cultured at 37°C and 220 rpm for 10 h to prepare a seed solution. Subsequently, all the seed liquid was aseptically added to a 5-L fermenter containing 1.8 L of initial fermentation medium. During the fermentation process, the stirring speed was adjusted between 200-700 rpm and the dissolved oxygen (DO) control strategy was linked to maintain the DO level above 30%. When the rapid growth of the bacteria caused the DO to decrease, the stirring speed was automatically increased. When the DO level began to rise rapidly at the highest speed (usually after about 9-10 hours of fermentation), indicating that the initial glucose had been exhausted, the stirring speed was fixed at 700 rpm, and the feed medium and choline chloride solution were pumped in at the set flow rate.

[0044] The initial fermentation conditions were set as follows: temperature 37 °C, initial stirring speed 200 rpm, ventilation volume 2 mL / min, tank pressure maintained at 0.05 MPa, and ammonia water was used to adjust and maintain the culture medium pH at 7.0 online.

[0045] Sample detection: Sampling was taken every 4 h from the start of fermentation.

[0046] Glucose concentration determination: The fermentation broth supernatant was taken and the residual glucose concentration was determined using a biosensor analyzer (SBA-40E).

[0047] Determination of dry cell weight (DCW): Take 1 mL of fermentation broth, collect the cells by centrifugation, wash twice with deionized water, and dry in an 80°C oven to constant weight. Calculate the DCW (g / L).

[0048] Citicoline concentration determination: The total production and extracellular production in the fermentation supernatant were measured respectively.

[0049] The total citicoline concentration was determined as follows: 2.5 mL of fermentation broth was added with 2.5 mL of deionized water and mixed, and the mixture was placed in an ice-water bath and treated with an ultrasonic cell disruptor. The disrupted suspension was centrifuged at 8000 rpm for 10 min, and the supernatant was collected. The supernatant was heat-treated at 100 ° C for 5 min, and then centrifuged again at 12000 rpm for 10 min to completely remove protein and cell debris. The final supernatant was taken and washed with 20% acetonitrile water ( v / v ) were diluted appropriately, filtered through a 0.22 μm filter, and then analyzed by HPLC.

[0050] Fermentation results and product characteristics analysis: The growth, substrate consumption and product synthesis curves of the final engineered strain BSC10-6 in a 5 L fermenter are shown in Figure 2. Figure 2 As shown in Table 5, the key performance parameters are summarized. Figure 2 A is the bacterial concentration during the fermentation process (OD 600) and glucose concentration; B is the production of intracellular, extracellular and total citicoline, as well as the changes in citicoline specific production (mg / g DCW) during fermentation.

[0051] Table 5 Citicoline production (mg / L) of different strains after 12 h and 24 h of fermentation Time (h) <![CDATA[OD 600 ]]> Glucose Content in Supernatant (g / L) Extracellular Content (mg / L) Total Yield (mg / L) Specific Yield (mg / g DCW) Intracellular proportion (%) 0 1.0±0.0 40.0±0.0 —— —— —— —— 4 6.5±0.6 28.4±0.8 22.1±1.9 115.1±2.3 27.9±1.6 80.8 8 27.9±0.2 9.4±0.2 86.6±8.1 462.5±2.4 31.3±1.8 81.3 12 49.9±0.1 0.5±0.1 106.6±0.4 598.4±13.0 30.0±1.4 82.2 16 65.1±2.7 0.4±0.0 145.9±1.8 1866.6±26.0 84.3±3.3 92.2 20 76.1±2.2 0.6±0.1 174.7±3.7 2896.1±6.8 105.2±1.5 94.0 24 79.7±2.8 2.1±0.3 193.0±3.7 3983.8±42.3 131.3±4.8 95.2 28 88.2±1.6 5.2±0.0 360.4±1.3 4422.3±26.8 143.2±4.9 91.9 32 85.4±3.0 2.2±0.1 348.8±7.5 4788.4±239.1 149.0±5.8 92.7 36 72.8±1.7 6.4±0.1 390.7±5.8 4131.7±60.8 115.6±3.8 90.5

[0052] The results in Table 5 indicate that strain BSC10-6 exhibited excellent high-density fermentation performance. The total citicoline production peaked at 4788.4 ± 239.1 mg / L (4.79 g / L) at 32 h of fermentation. At this time, the dry cell weight (DCW) reached 32.1 g / L, and the specific citicoline yield reached 149.0 mg / g DCW.

[0053] The above results show that the recombinant engineered strain of the present invention, combined with the fermentation process, achieves efficient biosynthesis of citicoline with a yield of 4.79 g / L, demonstrating great potential for industrial application.

[0054] like Figure 2 As shown in Figure B and the data in Table 5, the vast majority of citicoline accumulated within the bacterial cells throughout the fermentation process. At peak production (32 hours), intracellular citicoline accounted for 92.7% of the total yield. This characteristic significantly differs from other technologies, where the product is primarily secreted extracellularly. This greatly simplifies downstream separation and purification steps, reduces extraction costs, and offers significant process advantages.

[0055] The present invention uses a de novo synthesis pathway to directly produce citicoline using cheap raw materials such as glucose and choline chloride, without adding expensive intermediates (such as CMP), further consolidating its cost advantage in industrial production.

[0056] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. A recombinant engineered bacterium, characterized in that: The recombinant engineered bacteria is based on Bacillus subtilis BSC1-4 as the starting strain, and its metabolic network is modified as follows: Step S1, modification of the choline metabolic pathway: inactivation / knockout of the gene encoding choline dehydrogenase gbsB , gene encoding glycine betaine aldehyde dehydrogenase gbsA , introduction / overexpression of transporter proteins opuD , a gene encoding a choline transporter transcriptional repressor opcR ; Step S2, strengthening of CTP precursor supply: introducing / overexpressing a gene encoding a cytidine triphosphate synthase without feedback inhibition, the gene being pyrG A gene mutant in which the glutamic acid at position 156 of the encoded PyrG protein is replaced by lysine, and at the same time, the transcriptional repressor gene encoding the pyrimidine nucleotide operon is inactivated / knocked out pyrR , genes encoding pyrimidine nucleotide phosphorylase pdp , genes encoding cytidine deaminase cdd ; Step S3, reconstruction of central carbon metabolism: inactivating / knocking out key node genes in the central carbon metabolism pathway, wherein the key node genes are selected from at least one of the following: Gene encoding fructose-1,6-bisphosphatase fbp ; Gene encoding phosphoenolpyruvate carboxykinase pckA ; Gene encoding pyruvate:quinone oxidoreductase ydP ; Gene encoding malic enzyme ytJ .

2. The recombinant engineered bacterium according to claim 1, characterized in that In step S3, the gene encoding fructose-1,6-bisphosphatase is inactivated / knocked out fbp , genes encoding pyruvate:quinone oxidoreductase ydP , genes encoding malic enzyme ytJ .

3. Use of the recombinant engineered bacteria according to any one of claims 1 to 2 in the efficient production of citicoline, characterized in that: The recombinant engineering bacteria is used as a fermentation strain, and glucose and choline chloride are used as substrates to ferment and produce citicoline.

4. A method for producing citicoline by fed-batch fermentation using the recombinant engineered bacteria according to any one of claims 1 to 2, characterized in that: The specific operations are as follows: First, the engineered strain stored in the glycerol tube was inoculated into a 1 L Erlenmeyer flask containing 100-300 mL of LB medium and cultured at 37°C and 220 rpm for 10 h to prepare the seed solution. Subsequently, all the seed liquid was aseptically inoculated into a 5 L fermenter containing 1.8 L of initial fermentation medium for fermentation culture; the initial fermentation conditions were set as follows: temperature 37°C, initial stirring speed 200 rpm, ventilation volume 2 mL / min, tank pressure maintained at 0.05 MPa, and ammonia water was used to adjust the medium pH online and maintain it at 7.

0.

5. The method according to claim 4, wherein The components of the initial fermentation medium are: 40 g / L glucose, 10 g / L corn steep liquor powder, 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 10 g / L (NH4)2SO4, 3 g / L KH2PO4, 8 g / L K2HPO4, and 1 g / L MgSO4·7H2O. The pH of the initial fermentation medium is 7.

2.

6. The method according to claim 4, wherein During the fermentation process, the dissolved oxygen level was maintained above 30% by adjusting the stirring speed of 200-700 rpm and the dissolved oxygen linkage control strategy.

7. The method according to claim 6, wherein During the fermentation process, when the dissolved oxygen level drops due to rapid bacterial growth, the stirring speed is automatically increased. When the dissolved oxygen level begins to rise rapidly at the highest speed, the stirring speed is fixed at 700 rpm, and the batch feed medium and choline chloride solution are pumped in at the set flow rate.

8. The method according to claim 7, wherein The feed medium consists of 600 g / L glucose, 20 g / L MgSO4·7H2O, and 30 g / L choline chloride.

Images