Recombinant engineering bacterium, preparation method and application thereof in high-efficiency production of cytidine diphosphate-choline

Abstract

The application belongs to the technical field of bioengineering, and particularly relates to a recombinant engineering bacterium, a preparation method and application thereof in efficient production of cytidine 5'-monophosphate (CMP). The application is improved from multiple aspects such as choline metabolic pathway of Bacillus subtilis, strengthening of CTP precursor supply, reconstruction of central carbon metabolism, and finally the engineering bacterium constructed in the application has a cytidine 5'-monophosphate production of 1640.2±2.4 mg / L in 24 h of fermentation in a flask; in a 5 L fermenter, the production is up to 4788.4±239.1 mg / L (149.0±5.8 mg / g DCW) in 32 h of fed-batch fermentation, and about 93% of the product is accumulated in the cell. The engineering bacterium of Bacillus subtilis constructed by the application through modular engineering has no endotoxin secretion and high safety; the fermentation only needs to add cheap substrate choline chloride, and does not need to add expensive cytidine monophosphate, and has a significant cost advantage; at the same time, the high proportion of intracellular accumulation of the product is beneficial to subsequent separation and purification of the product, and has great industrial application potential.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinant engineered bacterium, its preparation method, and its application in the efficient production of cytidine diphosphate choline. Background Technology

[0002] Cytidine-5′-diphosphate choline (CDP-choline), a precursor to phosphatidylcholine and acetylcholine, participates in the formation of the cell membrane phospholipid bilayer and can stabilize the neurotransmitter system. It has therapeutic effects on functional and consciousness disorders caused by brain injury, Parkinson's disease, depression, and glaucoma, and has been widely used in clinical medicine and health products.

[0003] Microbial fermentation of citicoline has been extensively studied. Among them, Bacillus subtilis is an ideal host for the production of citicoline due to its GRAS (Generally Recognized as Safe) status, clear genetic background, strong protein secretion capacity, and ease of large-scale fermentation.

[0004] Studies have shown that in recombinant Bacillus subtilis, the biosynthesis of cytidine diphosphate (CTP) is mainly accomplished through the Kennedy pathway, which includes steps such as choline uptake, phosphoric acid choline (PAC) generation, CDP-choline synthesis, and cytidine triphosphate (CTP) regeneration. The mechanism is as follows: Bacillus subtilis takes up choline from the culture medium via choline transport proteins and transports it into the cell. Intracellular choline, catalyzed by choline kinase (CK), consumes ATP to generate PPC, which is one of the rate-limiting steps in the CDP-choline pathway. Then, PPC reacts with CTP under the action of phosphoric acid cytidine transferase (CCT) to generate CTP, releasing pyrophosphate (PPi). In addition, a sufficient supply of CTP is crucial for CTP synthesis. Intracellularly, CTP is generated from UTP through an amination reaction catalyzed by CTP synthase (CTPS).

[0005] It is evident that the entire biosynthesis of citicoline is regulated by a variety of factors, including enzyme activity, substrate supply, and metabolic pathway balance. To significantly increase the yield of citicoline, optimization must be carried out at multiple levels. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a recombinant engineered bacterium, its preparation method, and its application in the efficient production of cytidine diphosphate choline.

[0007] The recombinant engineered bacteria provided by this invention is based on Bacillus subtilis BSC1-4, and its metabolic network has been modified as follows:

[0008] Step S1, Modification of the choline metabolic pathway: Inactivation / knockout of the gene encoding choline dehydrogenase gbsB Gene encoding glycine betaine aldehyde dehydrogenase gbsA Introducing / overexpressing transport proteins opuD Gene encoding choline transporter transcriptional repressor protein opcR ;

[0009] Step S2, Enhancement of CTP precursor supply: Introducing / overexpressing a gene encoding a feedback-repressed cytidine triphosphate synthase, wherein the gene is pyrG The gene mutant encodes the PyrG protein in which the glutamic acid at position 156 is replaced by a lysine residue, and simultaneously, the gene encoding the transcriptional repressor protein of the pyrimidine nucleotide operon is inactivated / knocked out. pyrR Gene encoding pyrimidine nucleotide phosphorylase pdp Gene encoding cytidine deaminase cdd ;

[0010] Step S3, Reconstruction of central carbon metabolism: Inactivation / knockout of key node genes in the central carbon metabolism pathway, wherein the key node genes are selected from at least one of the following:

[0011] Gene encoding 1,6-bisphosphate fructose enzyme fbp ;

[0012] Gene encoding phosphoenolpyruvate carboxykinase pckA ;

[0013] Gene encoding pyruvate:quinone oxidoreductase ydaP ;

[0014] gene encoding malic acidase ytsJ .

[0015] Of the recombinant engineered bacteria provided by this invention, the Bacillus subtilis BSC1-4 is preferably the strain disclosed in the inventor's patent CN116790466B.

[0016] In step S3, the gene encoding 1,6-bisphosphate fructase is inactivated / knocked out. fbp Gene encoding pyruvate:quinone oxidoreductase ydaP Gene encoding malic acidase ytsJ .

[0017] Furthermore, the application of the recombinant engineered bacteria in the production of cytidine diphosphate choline is also a key technical content protected by this invention. Specifically, the application involves using the recombinant engineered bacteria as the fermentation strain and choline chloride as the substrate to ferment and produce cytidine diphosphate choline.

[0018] Preferably, the present invention also provides a method for producing cytidine diphosphate choline using the recombinant engineered bacteria in a fed-batch fermentation process, the specific operation of which is as follows:

[0019] First, the engineered strain preserved in glycerol tubes was inoculated into a 1 L Erlenmeyer flask containing 100-300 mL of LB medium and cultured with shaking at 37°C and 220 rpm for 10 h to prepare a seed culture.

[0020] Subsequently, all seed culture was aseptically inoculated into a 5 L fermenter containing 1.8 L of initial fermentation medium for fermentation culture. The initial fermentation conditions were set as follows: temperature 37℃, initial stirring speed 200 rpm, aeration rate 2 mL / min, tank pressure maintained at 0.05 MPa, and ammonia water was used to adjust and maintain the pH of the medium at 7.0 online.

[0021] In the above method, preferably, the initial fermentation medium consists of: 40 g / L glucose, 10 g / L corn steep liquor powder, 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 10 g / L (NH4)2SO4, 3 g / L KH2PO4, 8 g / L K2HPO4, and 1 g / L MgSO4·7H2O, and the pH of the initial fermentation medium is 7.2.

[0022] Preferably, during the fermentation process, the dissolved oxygen level is maintained above 30% by using a stirring speed of 200-700 rpm and a dissolved oxygen linkage control strategy.

[0023] Preferably, during fermentation, when the rapid growth of the cells causes a decrease in dissolved oxygen levels, the stirring speed is automatically increased. When the dissolved oxygen levels begin to rise rapidly at the highest speed, the stirring speed is fixed at 700 rpm, and the feed-in culture medium and choline chloride solution are pumped in at a set flow rate.

[0024] Preferably, the supplemental culture medium consists of 600 g / L glucose, 20 g / L MgSO4·7H2O, and 30 g / L choline chloride. The beneficial effects of this invention are:

[0025] (1) Significantly increased production of cytidine diphosphate choline: This invention systematically and synergistically modifies the three core modules of choline utilization, CTP supply and energy metabolism, and breaks through multiple rate-limiting steps in the cytidine diphosphate choline synthesis pathway, thereby optimizing the metabolic flux. Compared with the Bacillus subtilis (CN116790466B, production 114.3 mg / L) reported in the prior art, the engineered bacteria constructed in this invention produced up to 4788.4±239.1 mg / L in a 5 L fermenter, which is about 42 times higher and has reached the potential level for industrial production.

[0026] (2) Production costs are significantly reduced: The recombinant engineered bacteria of the present invention can efficiently utilize inexpensive glucose and choline chloride as the main raw materials and efficiently synthesize the key precursor CTP through endogenous metabolism. There is no need to add expensive intermediates such as CMP or choline phosphate during the fermentation process, which greatly reduces production costs.

[0027] (3) Downstream processing friendly: When the recombinant engineered bacteria prepared by the present invention are used to prepare cytidine diphosphate choline, about 93% of the product accumulates in the cell, forming a high-concentration product environment. Although the cell disruption unit operation is increased, the complex process of processing a large amount of fermentation broth is avoided, which is conducive to the concentration, separation and purification of subsequent products and reduces the equipment and operating costs of downstream processing. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of the metabolic pathway and systematic modification strategy of the recombinant engineered bacteria in this invention;

[0029] Wherein, PEP: phosphoenolpyruvate; TCA: tricarboxylic acid cycle (also known as citric acid cycle); UMP: uridine monophosphate; UTP: uridine triphosphate; CTP: cytidine triphosphate; CMP: 5-cytidine monophosphate; ATP: adenosine triphosphate; ADP: adenosine diphosphate; PPi: pyrophosphate; ywjI , fbp Encodes 1,6-bisphosphate fructose oxidase; pckA : Encodes phosphoenolpyruvate carboxykinase; ydaP Pyruvate: Quinone oxidoreductase; ytsJ : Encodes malic acid oxidase; pyrR : Encoding pyrimidine nucleotide operon ( pyr The repressor protein of operon; pyrG E156K : Encodes a CTP synthase that has de-feedback inhibition; pdp : Encodes pyrimidine nucleotide phosphorylase; cdd : Encodes cytidine deaminase; gbsA Glycine betaine aldehyde dehydrogenase; gbsB : Encodes choline dehydrogenase; opcR: Encodes the choline transport proteins OpuB and OpuC operons ( opuB operon and opuC operon is a transcriptional repressor protein. gbsR :coding opuB operon is a transcriptional repressor protein; OpuB, OpuC, and OpuD are choline transporters. CKI : Encodes choline kinase; CCT : Encodes phosphocholine cytidine transferase;

[0030] Figure 2 The performance curve of the final engineered strain BSC10-6 of this invention in a 5 L fermenter during fed-batch fermentation.

[0031] In this diagram, A shows the changes in cell concentration and glucose concentration during fermentation, while B shows the changes in intracellular, extracellular, and total cytidine diphosphate choline production, as well as the changes in cytidine diphosphate choline ratio production, during fermentation. Detailed Implementation

[0032] To enable those skilled in the art to better understand the present invention, the present invention will now be further described in conjunction with specific embodiments.

[0033] I. Preparation and source of the strains, plasmids and culture media involved in this invention

[0034] Information on all strains and plasmids involved in this invention is detailed in Table 1. Primers were synthesized by Qingke Biotechnology Co., Ltd.

[0035] LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, for general culture of Bacillus subtilis. For solid medium, add 15 g / L agar powder. If necessary, add neomycin 16 μg / mL or chloramphenicol 8 μg / mL.

[0036] Shake-flask fermentation medium: glucose 40 g / L, corn steep liquor powder 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, (NH4)2SO4 10 g / L, KH2PO4 3 g / L, K2HPO4 8 g / L, MgSO4·7H2O 1 g / L, pH 7.2. After fermentation for 4 h, choline chloride with a final concentration of 1 g / L was added.

[0037] Initial culture medium for fed-batch fermentation: Same as shake flask fermentation medium, the fed-batch medium consists of 600 g / L glucose, 20 g / L MgSO4·7H2O and 30 g / L choline chloride.

[0038] Table 1. Strains and plasmids involved in the experiment

[0039]

[0040] II. Primers and sequences involved in this invention

[0041] Primers used for PCR are shown in Table 2.

[0042] Table 2 PCR primer sequences

[0043] Primer Sequence Name Sequence (5'→3') fbp-U1 SEQ ID No.1 GGTTGTTGAAGTTGGTGAA fbp-G2 SEQ ID No.2 TGTATAGCAGCGAGTAGC fbp-D2 SEQ ID No.3 GGCGGAAGTAAGATTGAGAA pckA-U1 SEQ ID No.4 GCACGCATAACCGAACAT pckA-G2 SEQ ID No.5 TGAGCCGAAGCAAGTAGA pckA-D2 SEQ ID No.6 AGGAGAAGGCTATGAGGATT ydaP-U1 SEQ ID No.7 CTATGTCATCCAAGGTGTCA ydaP-G2 SEQ ID No.8 GAGAGCCGAATCACAGAC ydaP-D2 SEQ ID No.9 TGGCTGATTGCTGTATTGA ytsJ-U1 SEQ ID No.10 AAGCGGACCTATTGAGAAG ytsJ-G2 SEQ ID No.11 GTCAGCATCAACGATAACAT ytsJ-D2 SEQ ID No.12 GTAGTCGGATGCGTCATT

[0044] III. HPLC analysis conditions for cytidine diphosphate choline in this invention

[0045] High-performance liquid chromatograph LC-2030 (Shimadzu); chromatographic column, PC HILIC column (250 mm × 4.6 mm, 5 μm); column temperature, 30℃; mobile phase A was 0.5% formic acid aqueous solution, mobile phase B was acetonitrile / methanol (8:2, v / v ) solution, A:B in a 4:6 ratio ( v / v Isocratic elution was performed at a ratio of 1:1; flow rate: 1.0 mL / min; detector: UV detector; detection wavelength: 280 nm; injection volume: 20 μL.

[0046] Example 1

[0047] In this embodiment, to promote a greater inflow of carbon flux into the TCA, genes involved in the gluconeogenesis pathway are knocked out. fbp , pckA , ydaP Blocking the conversion of pyruvate to acetic acid, knocking out ytsJ To reduce the conversion of malic acid to phosphoenolpyruvate, and obtain respectively fbp Knockout strain BSC10-1 fbp and pckA Double knockout strain BSC10-2, fbp and ydaP Double knockout strain BSC10-3, fbp and ytsJ Double knockout strain BSC10-4, fbp , ytsJ and pckA Three knockout strains BSC10-5 fbp , ytsJ and ydaP Three knockout strains BSC10-6.

[0048] The specific operation of this embodiment is as follows:

[0049] Step S1, Modification of the choline metabolic pathway: Knockout of the gene encoding choline dehydrogenasegbsB Gene encoding glycine betaine aldehyde dehydrogenase gbsA Introducing / overexpressing transport proteins opuD Gene encoding choline transporter transcriptional repressor protein opcR The recombinant engineered bacteria obtained was named BSC5-1;

[0050] Step S2, Enhancement of CTP precursor supply: Introducing a gene encoding a feedback-restricted cytidine triphosphate synthase, wherein the gene is... pyrG The gene mutant encodes the PyrG protein in which the glutamic acid at position 156 is replaced by a lysine residue; simultaneously, the gene encoding the transcriptional repressor protein of the pyrimidine nucleotide operon is knocked out. pyrR Gene encoding pyrimidine nucleotide phosphorylase pdp Gene encoding cytidine deaminase cdd The recombinant engineered bacteria obtained was named BSC9-8;

[0051] Step S3, reconstructing central carbon metabolism, specifically involves the following steps:

[0052] With BS168N / Δ fbpm Using the genome as a template, the UDCRG fragment (SEQ ID No. 13) was amplified using primer pair fbp-U1 / fbp-G2. The UDCRG fragment was then transformed into competent BSC9-8 cells to obtain... fbp Knockout strain BSC10-1.

[0053] With BS168N / Δ pckAm Using the genome as a template, the UDCRG fragment (SEQ ID No. 14) was amplified using primer pairs pckA-U1 / pckA-G2, and then transformed into competent BSC10-1 cells to obtain... fbp and pckA Double knockout strain BSC10-2.

[0054] With BS168N / Δ ydaPm Using the genome as a template, the UDCRG fragment (SEQ ID No. 15) was amplified using primer pair ydaP-U1 / ydaP-G2 and transformed into competent BSC10-1 cells to obtain... fbp and ydaP Double knockout strain BSC10-3.

[0055] With BS168N / Δ ytsJm Using the genome as a template, the UDCRG fragment (SEQ ID No. 16) was amplified using primer pair ytsJ-U1 / ytsJ-G2, and then transformed into competent BSC10-1 cells to obtain... fbp and ytsJDouble knockout strain BSC10-4.

[0056] Obtained using the same method described above fbp , ytsJ and pckA Three-knockout strain 10-5 and fbp , ytsJ and ydaP Three knockouts of strain 10-6.

[0057] Experimental Example 1

[0058] The effects of various engineered bacteria prepared in Example 1 on the fermentation production of cytidine diphosphate choline were evaluated.

[0059] Each engineered bacterial strain preserved in glycerol tubes was activated by streaking on LB agar plates. Single colonies were picked from the plates and inoculated into test tubes containing 5 mL of LB liquid medium. The culture was prepared by shaking at 37°C and 200 rpm for 12 h to obtain a seed culture. The seed culture was transferred to a 250 mL Erlenmeyer flask containing 30 mL of fermentation medium at an inoculation rate of 1% (v / v). The flask was then shaken and cultured at 37°C and 220 rpm. After 4 h of fermentation, choline chloride was added to a final concentration of 1 g / L. The total fermentation time was 24 h.

[0060] During shake-flask fermentation, 1 mL of fermentation broth was collected at 4 h, 8 h, 12 h, 20 h, and 24 h, respectively. The supernatant was discarded by centrifugation, and the cell pellet was washed with deionized water, resuspended, and diluted appropriately. The OD of the bacterial suspension was then measured. 600 In addition, 2.5 mL of fermentation broth was taken at 12 h and 24 h respectively for the determination of total cytidine diphosphate choline production.

[0061] Using control strain BSC9-8, fbp Knockout strain BSC10-1 fbp and pckA Double knockout strain BSC10-2, fbp and ydaP Double knockout strain BSC10-3, fbp and ytsJ Double knockout strain BSC10-4, and fbp , ytsJ and pckA Three knockout strains 10-5 fbp , ytsJ and ydaP The three knockout strain 10-6 was fermented, and the growth results of the strain are shown in Table 3.

[0062] Table 3. Growth status of strains (OD) 600

[0063] Time (h) BSC9-8 BSC10-1 BSC10-2 BSC10-3 BSC10-4 BSC10-5 BSC10-6 4 0.7±0.1 0.2±0.0 1.9±0.3 2.0±0.3 2.5±0.1 0.9±0.0 2.5±0.2 8 5.1±0.3 5.5±0.3 7.4±0.7 6.3±0.5 7.4±0.4 7.0±0.1 8.2±0.3 12 8.3±0.3 8.8±0.2 10.3±0.4 10.8±0.3 11.3±0.1 10.8±0.1 11.0±0.8 20 14.2±0.8 14.3±0.2 14.4±0.0 14.3±0.2 14.3±0.2 15.0±0.4 14.7±0.2 24 14.3±1.2 14.9±0.7 15.2±0.9 15.4±1.2 14.1±0.9 14.8±0.5 14.7±0.2

[0064] The results in Table 3 show that neither single nor combined knockout of the central carbon metabolism-related genes involved in this invention had a significant negative impact on the growth of the strain.

[0065] The results of cytidine diphosphate choline production for each strain at 12 h and 24 h of fermentation are shown in Table 4.

[0066] Table 4. Citicoline production (mg / L) of different strains after 12 h and 24 h of fermentation.

[0067] Strain 12 h 24 h BSC9-8 846.9 ± 17.2 1441.4 ± 15.7 BSC10-1 855.1 ± 17.4 <![CDATA[1546.2 ## ± 25.8]]> BSC10-2 <![CDATA[911.7 ## ± 9.9]]> <![CDATA[1495.6 # ± 21.1]]> BSC10-3 <![CDATA[926.3 ## ± 11.4]]> <![CDATA[1543.2 ## ± 32.0]]> BSC10-4 <![CDATA[947.3 ## ± 18.2]]> <![CDATA[1545.7 ## ± 13.2]]> BSC10-5 <![CDATA[906.9 # ± 14.5]]> <![CDATA[1607.0 ## ± 19.2]]> BSC10-6 <![CDATA[991.2 ## ± 14.7]]> <![CDATA[1640.2 ## ± 2.4]]>

[0068] Note: # The results showed a significant difference compared to the control strain BSC9-8 (P < 0.05). ## The results showed a highly significant difference compared to the control strain BSC9-8 (P < 0.01).

[0069] The results in Table 4 show that modifying the central carbon metabolism pathway can further significantly increase the production of citicoline. Knockout fbp The cytidine diphosphate choline (CPC) yield of strain BSC10-1 after 24 h of fermentation was 1546.2 ± 25.8 mg / L, which was 7.3% higher than that of the control strain BSC9-8 (yield 1441.4 ± 15.7 mg / L). Subsequently, strains were knocked out... pckA , ydaP and ytsJ Double knockout strains BSC10-2, 10-3, and 10-4 were obtained. Their 24-hour citicoline production did not increase significantly, but their 12-hour production increased by 6.6%, 8.3%, and 10.8% respectively compared to BSC10-1. Finally, a triple knockout strain BSC10-5 (Δ...) was constructed. fbp , Δ ytsJ ,Δ pckA ) and BSC10-6 (Δ fbp , Δ ytsJ , Δ ydaP The 24-hour cytidine diphosphate choline (CDP-C) production reached 1607.0 ± 19.2 mg / L and 1640.2 ± 2.4 mg / L, respectively. In particular, the final engineered strain BSC10-6 exhibited the best production performance, with its yield increasing by 13.8% compared to the starting strain BSC9-8, reaching the highest value at the shake-flask level.

[0070] The above results demonstrate that the present invention achieves its effect by blocking the gluconeogenesis pathway (knockout). fbp , pckA And direct more carbon flux to the TCA cycle (knockout) ydaP , ytsJThis can effectively enhance cellular energy metabolism and the supply of key precursors, thereby ultimately achieving a significant increase in cytidine diphosphate choline production.

[0071] Experimental Example 2: Fermentation in a Fermenter with Batch Feeding

[0072] First, the engineered strain BSC10-6, preserved in glycerol tubes, was inoculated into a 1 L Erlenmeyer flask containing 200 mL of LB medium and cultured with shaking at 37°C and 220 rpm for 10 h to prepare a seed culture.

[0073] Subsequently, all seed culture was aseptically inoculated into a 5 L fermenter containing 1.8 L of initial fermentation medium. During fermentation, the DO level was maintained above 30% by adjusting the stirring speed between 200-700 rpm in conjunction with a dissolved oxygen (DO) control strategy. When rapid cell growth caused a drop in DO, the stirring speed was automatically increased. When the DO level was observed to begin to rise rapidly at the highest stirring speed (usually around 9-10 hours of fermentation), it indicated that the initial glucose had been depleted. At this point, the stirring speed was fixed at 700 rpm, and the feed medium and choline chloride solution were pumped in at the set flow rate.

[0074] The initial fermentation conditions were set as follows: temperature 37℃, initial stirring speed 200 rpm, aeration rate 2 mL / min, tank pressure maintained at 0.05 MPa, and ammonia water was used to adjust and maintain the pH of the culture medium at 7.0 online.

[0075] Sample testing: Samples were taken every 4 hours starting from the start of fermentation.

[0076] Glucose concentration determination: Take the supernatant of the fermentation broth and use a biosensor analyzer (SBA-40E) to determine the residual glucose concentration.

[0077] Cell dry weight (DCW) determination: Take 1 mL of fermentation broth, centrifuge to collect cells, wash twice with deionized water, and dry in an 80℃ oven to constant weight. Calculate DCW (g / L).

[0078] Determination of cytidine diphosphate choline concentration: The total yield and the extracellular yield in the fermentation broth supernatant were measured separately.

[0079] The determination of total cytidine diphosphate choline concentration was as follows: 2.5 mL of fermentation broth was mixed with 2.5 mL of deionized water and placed in an ice-water bath. The mixture was then processed using an ultrasonic cell disruptor. The disrupted suspension was centrifuged at 8000 rpm for 10 min, and the supernatant was collected. The supernatant was then heat-treated at 100℃ for 5 min, followed by centrifugation at 12000 rpm for 10 min to thoroughly remove proteins and cell debris. The final supernatant was then diluted with 20% acetonitrile water (…). v / vAfter appropriate dilution and filtering through a 0.22 μm filter membrane, HPLC analysis was performed.

[0080] Fermentation results and product characteristics analysis: The growth, substrate consumption, and product synthesis curves of the final engineered strain BSC10-6 in a 5 L fermenter are shown below. Figure 2 As shown, the key performance parameters are summarized in Table 5. Figure 2 In the diagram, A represents the cell concentration (OD) during fermentation. 600 B represents the changes in glucose concentration and intracellular, extracellular, and total cytidine diphosphate choline production during fermentation, as well as the changes in cytidine diphosphate choline production (mg / g DCW).

[0081] Table 5. Citicoline production (mg / L) of different strains after 12 h and 24 h of fermentation.

[0082] Time (h) <![CDATA[OD 600 ]]> Glucose Content in Supernatant (g / L) Extracellular Content (mg / L) [[ID=16 ​ Intracellular percentage (%) 0 1.0±0.0 40.0±0.0 —— —— —— —— 4 6.5±0.6 28.4±0.8 22.1±1.9 115.1±2.3 27.9±1.6 80.8 8 27.9±0.2 9.4±0.2 86.6±8.1 462.5±2.4 31.3±1.8 81.3 12 49.9±0.1 0.5±0.1 106.6±0.4 598.4±13.0 30.0±1.4 82.2 16 65.1±2.7 0.4±0.0 145.9±1.8 1866.6±26.0 84.3±3.3 92.2 20 76.1±2.2 0.6±0.1 174.7±3.7 2896.1±6.8 105.2±1.5 94.0 24 79.7±2.8 2.1±0.3 193.0±3.7 3983.8±42.3 131.3±4.8 95.2 28 88.2±1.6 5.2±0.0 360.4±1.3 4422.3±26.8 143.2±4.9 91.9 32 85.4±3.0 2.2±0.1 348.8±7.5 4788.4±239.1 149.0±5.8 92.7 36 72.8±1.7 6.4±0.1 390.7±5.8 4131.7±60.8 115.6±3.8 90.5

[0083] The results in Table 5 show that strain BSC10-6 exhibits excellent high-density fermentation performance. At 32 h of fermentation, the total yield of citicoline reached a peak of 4788.4 ± 239.1 mg / L (4.79 g / L), at which point the cell dry weight (DCW) reached 32.1 g / L, and the specific yield of citicoline was as high as 149.0 mg / g DCW.

[0084] The above results show that the combination of the recombinant engineered strain of the present invention and the fermentation process achieves efficient biosynthesis of cytidine diphosphate choline, with a yield of 4.79 g / L, demonstrating great potential for industrial application.

[0085] like Figure 2 As shown in B and the data in Table 5, during the entire fermentation process, the vast majority of cytidine diphosphate choline (CPC-Ccholine) accumulates inside the bacterial cells. At the peak yield (32 h), intracellular CPC-Ccholine accounts for 92.7% of the total yield. This characteristic is significantly different from the pattern in other technologies where the product is mainly secreted extracellularly, greatly simplifying the downstream separation and purification steps, reducing extraction costs, and demonstrating significant process advantages.

[0086] This invention enables the direct production of cytidine diphosphate choline (CPC-Ccholine) from inexpensive raw materials such as glucose and choline chloride via a de novo synthesis route, eliminating the need for expensive intermediates (such as CMP) and further solidifying its cost advantage in industrial production.

[0087] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A recombinant engineered bacterium, characterized in that, The recombinant engineering bacteria are Bacillus subtilis BSC1-4 as a starting strain, and the metabolic network is modified as follows: Step S1, modification of the choline metabolic pathway: inactivation / knock-out of the gene encoding choline dehydrogenase gbsB inactivation / knock-out of the gene encoding glycine betaine aldehyde dehydrogenase gbsA introduction / overexpression of transporters opuD inactivation / knock-out of the gene encoding choline transporter transcriptional repressor opcR ; Step S2, CTP precursor supply reinforcement: introduction / overexpression of a gene encoding a feedback-inhibited cytidine triphosphate synthetase, which is pyrG a gene mutant encoding a PyrG protein in which glutamic acid at position 156 is substituted with lysine, and in which the gene encoding the transcription repressor protein of the pyrimidine nucleotide operon is inactivated / knocked out pyrR a gene encoding a pyrimidine nucleotide phosphorylase pdp a gene encoding a cytidine deaminase cdd ; Step S3, remodeling of central carbon metabolism: inactivation / knock-out of the gene encoding 1,6-biphosphofructase fbp , the gene encoding pyruvate:quinone oxidoreductase ydaP , the gene encoding malic enzyme ytsJ ; The Bacillus subtilis BSC1-4 is a strain disclosed in patent CN116790466B.

2. The use of the recombinant engineering bacteria of claim 1 in the high-efficiency production of cytidine diphosphate-choline, characterized in that, The recombinant engineering bacteria are used as fermentation strains to produce cytidine diphosphate choline by fermentation with glucose and choline chloride as substrates.

3. The method for producing cytidine diphosphate-choline by fed-batch fermentation using the recombinant engineering bacteria according to claim 1, characterized in that, The specific operation is as follows: First, the engineering strain stored in the glycerol tube is inoculated into a 1 L triangular flask containing 100-300 mL of LB medium, and is cultured at 37℃ and 220 rpm for 10 h to prepare a seed liquid; Then, all the seed liquid is aseptically inoculated into a 5 L fermenter containing 1.8 L of initial fermentation medium for fermentation culture; the initial fermentation conditions are set as follows: temperature 37℃, initial stirring speed 200 rpm, aeration amount 2 mL / min, tank pressure maintained at 0.05 Mpa, and ammonia is used to adjust and maintain the pH of the medium at 7.

0.

4. The method of claim 3, wherein, The composition of the initial fermentation medium is: glucose 40 g / L, corn syrup dry powder 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, (NH4)2SO4 10 g / L, KH2PO4 3 g / L, K2HPO4 8 g / L, MgSO4·7H2O 1 g / L, and the pH of the initial fermentation medium is 7.

2.

5. The method of claim 3, wherein, During the fermentation process, the dissolved oxygen level is maintained above 30% through the stirring speed of 200-700 rpm and the dissolved oxygen linkage control strategy.

6. The method of claim 5, wherein, During the fermentation process, when the rapid growth of the bacteria leads to a decrease in the dissolved oxygen level, the stirring speed is automatically increased, and when the dissolved oxygen level starts to rise rapidly at the highest speed, the stirring speed is fixed at 700 rpm, and the batch feeding medium and choline chloride solution are pumped in at a set flow rate.

7. The method of claim 6, wherein, The feeding medium is composed of 600 g / L of glucose, 20 g / L of MgSO4·7H2O, and 30 g / L of choline chloride.

Images