A wheat cell wall-associated receptor-like kinase TaWAKL8-2B and its application in rust resistance

Abstract

The present invention provides a wheat cell wall-associated receptor-like kinase TaWAKL8-2B and its application in rust resistance, belonging to the field of bio-agricultural technology. The present invention provides an application of wheat cell wall-associated receptor-like kinase TaWAKL8-2B in improving wheat rust resistance. The wheat cell wall-associated receptor-like kinase TaWAKL8-2B of the present invention can significantly enhance the broad-spectrum resistance of wheat to stripe rust and leaf rust by regulating linalool synthesis and ROS accumulation. Overexpression TaWAKL8-2B The disease resistance of transgenic plants was significantly improved, while knockout plants were susceptible to the disease. This invention provides an important gene resource for wheat rust resistance breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of biological agriculture, and in particular relates to a wheat cell wall-associated receptor-like kinase TaWAKL8-2B and an application thereof in rust resistance. Background Art

[0002] Wheat stripe rust is caused by ( Puccinia striiformis f. sp. Tritici , Pst ), leaf rust is caused by ( Puccinia triticina , Ptt Wheat stripe rust and leaf rust are major fungal diseases threatening global wheat production. Existing rust-resistant varieties are becoming ineffective due to frequent virulence variations in the pathogens, necessitating the development of broad-spectrum, long-lasting rust-resistant genetic resources. Summary of the Invention

[0003] The purpose of the present invention is to provide a wheat cell wall-associated receptor-like kinase TaWAKL8-2B and its application in rust resistance, which can significantly enhance the broad-spectrum resistance of wheat to stripe rust and leaf rust.

[0004] The present invention provides an application of a wheat cell wall-associated receptor-like kinase TaWAKL8-2B in improving wheat rust resistance. The wheat cell wall-associated receptor-like kinase TaWAKL8-2B comprises a protein with an amino acid sequence shown in SEQ ID NO.1.

[0005] The present invention also provides an application of a gene encoding wheat cell wall-associated receptor-like kinase TaWAKL8-2B in improving wheat rust resistance, wherein the encoding gene comprises a gene having a nucleotide sequence shown in SEQ ID NO.2.

[0006] The present invention also provides an application of a recombinant vector in improving wheat rust resistance, wherein the recombinant vector is inserted with a gene encoding wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the encoding gene includes a gene with a nucleotide sequence shown in SEQ ID NO.2.

[0007] The present invention also provides an application of a recombinant bacterium in improving wheat rust resistance, wherein the recombinant bacterium comprises a recombinant vector; the recombinant vector is inserted with a gene encoding wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the encoding gene comprises a gene having a nucleotide sequence shown in SEQ ID NO.2.

[0008] Preferably, the wheat rust includes wheat stripe rust and / or wheat leaf rust.

[0009] Preferably, the improvement of wheat rust resistance is achieved by upregulating linalool biosynthesis genes TaLLSs and / or inhibition of peroxidase genes TaPODs accomplish.

[0010] Preferably, wheat rust resistance is improved by overexpressing the gene encoding wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the encoding gene includes the gene with the nucleotide sequence shown in SEQ ID NO.2.

[0011] The present invention also provides a method for breeding rust-resistant wheat varieties, comprising the following steps: using a recombinant vector or a recombinant bacterium to transform wheat cells to obtain transgenic plants; the recombinant vector is inserted with a gene encoding wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the encoding gene includes a gene with a nucleotide sequence shown in SEQ ID NO.2; and the recombinant bacterium contains the recombinant vector.

[0012] The present invention also provides the use of a gene encoding a knockout wheat cell wall-associated receptor-like kinase TaWAKL8-2B in constructing a wheat model susceptible to rust, wherein the encoding gene includes a gene having a nucleotide sequence shown in SEQ ID NO.2.

[0013] The present invention also provides a method for constructing a wheat model susceptible to rust, comprising the following steps: using CRISPR-Cas9 technology to knock out the coding gene of wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the coding gene includes a gene with a nucleotide sequence shown in SEQ ID NO.2.

[0014] The present invention provides a use of a wheat cell wall-associated receptor-like kinase TaWAKL8-2B in improving wheat rust resistance, wherein the wheat cell wall-associated receptor-like kinase TaWAKL8-2B comprises a protein having an amino acid sequence shown in SEQ ID NO.1. The wheat cell wall-associated receptor-like kinase TaWAKL8-2B of the present invention can significantly enhance the broad-spectrum resistance of wheat to stripe rust and leaf rust by regulating linalool synthesis and ROS accumulation. Overexpression TaWAKL8-2B The disease resistance of transgenic plants was significantly improved, while knockout plants were susceptible to the disease. This invention provides an important gene resource for wheat rust resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 : TaWAKL8-2B identification of β-lactamases and their expression patterns during pathogen infection;

[0017] Figure 2 : TaWAKL8-2B The knockout plant has reduced resistance to Puccinia striiformis and reduced ROS accumulation;

[0018] Figure 3 : TaWAKL8-2B The overexpression plant has significantly enhanced resistance to Puccinia striiformis;

[0019] Figure 4 : TaWAKL8-2B Regulation of resistance to Puccinia recondita. DETAILED DESCRIPTION

[0020] The application provides application of a wheat cell wall related receptor-like kinase TaWAKL8-2B in improving wheat rust resistance, and the wheat cell wall related receptor-like kinase TaWAKL8-2B includes a protein of an amino acid sequence shown in SEQ ID NO. 1.

[0021] In the present invention, the amino acid sequence shown in SEQ ID NO.1 is specifically:

[0022] The molecular mechanisms by which plant cell wall-associated kinases (WAKs) and their WAKL-like proteins (WAKLs) contribute to wheat rust resistance remain unclear. The wheat cell wall-associated receptor-like kinase TaWAKL8-2B, provided by the present invention, significantly enhances broad-spectrum wheat resistance to stripe rust and leaf rust by regulating linalool biosynthesis and ROS accumulation.

[0023] The application further provides application of a coding gene of a wheat cell wall related receptor-like kinase TaWAKL8-2B in improving wheat rust resistance, wherein the coding gene comprises a gene with a nucleotide sequence as shown in SEQ ID NO. 2.

[0024]

[0025] The present application also provides a recombinant vector for improving the resistance of wheat to rust, wherein the recombinant vector is inserted with a coding gene of wheat cell wall-related receptor-like kinase TaWAKL8-2B; and the coding gene comprises a gene with a nucleotide sequence shown in SEQ ID NO. 2.

[0026] As an embodiment, the backbone plasmid of the recombinant vector is a pANIC6E vector (Mann et al. 2014, Plant Biotechnology Journal), which is inserted with a coding region sequence (a nucleotide sequence shown in SEQ ID NO. 2). TaWAKL8-2B

[0027] The present application does not have special restrictions on the construction method of the recombinant vector, and a conventional method in the art can be used.

[0028] The present application also provides a recombinant bacteria for improving the resistance of wheat to rust, wherein the recombinant bacteria comprises a recombinant vector; the recombinant vector is inserted with a coding gene of wheat cell wall-related receptor-like kinase TaWAKL8-2B; and the coding gene comprises a gene with a nucleotide sequence shown in SEQ ID NO. 2.

[0029] As an embodiment, the original bacteria of the recombinant bacteria comprise Escherichia coli or Agrobacterium. The present application does not have special restrictions on the construction method of the recombinant bacteria, and a conventional method in the art can be used.

[0030] As an embodiment, the wheat rust comprises wheat stripe rust (Puccinia striiformis f. sp. tritici) and / or wheat leaf rust (Puccinia triticina). Pst Ptt

[0031] As an embodiment, the improvement of the resistance of wheat to rust is achieved by up-regulating a linalool synthesis gene TaLLSs and / or inhibiting a peroxidase gene TaPODs .

[0032] As an embodiment, the improvement of the resistance of wheat to rust is achieved by over-expressing a coding gene of wheat cell wall-related receptor-like kinase TaWAKL8-2B; and the coding gene comprises a gene with a nucleotide sequence shown in SEQ ID NO. 2.

[0033] The present application also provides a method for cultivating a rust-resistant wheat variety, comprising the following steps: transforming wheat cells with a recombinant vector or a recombinant bacteria to obtain a transgenic plant; the recombinant vector is inserted with a coding gene of wheat cell wall-related receptor-like kinase TaWAKL8-2B; the coding gene comprises a gene with a nucleotide sequence shown in SEQ ID NO. 2; and the recombinant bacteria comprises the recombinant vector.​​​

[0034] As an embodiment, the recombinant vector is transformed into wheat cells through Agrobacterium-mediated transformation, and the wheat cells include wheat immature embryos.

[0035] The present invention also provides the use of a gene encoding a knockout wheat cell wall-associated receptor-like kinase TaWAKL8-2B in constructing a wheat model susceptible to rust, wherein the encoding gene includes a gene having a nucleotide sequence shown in SEQ ID NO.2.

[0036] The present invention also provides a method for constructing a wheat model susceptible to rust, comprising the following steps: using CRISPR-Cas9 technology to knock out the coding gene of wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the coding gene includes a gene with a nucleotide sequence shown in SEQ ID NO.2.

[0037] Linalool is a monoterpenoid compound with direct antibacterial and signal regulation functions, but its role in wheat rust resistance has not yet been revealed. TaWAKL8-2B The disease resistance of transgenic plants was significantly improved. TaWAKL8-2B By upregulating linalool biosynthesis genes ( TaLLSs ) and inhibition of peroxidase genes ( TaPODs Plants defend themselves against pathogens by generating reactive oxygen species (ROS) and synthesizing secondary metabolites such as terpenoids.

[0038] In the present invention, knockout TaWAKL8-2B This results in decreased disease resistance of wheat, reduced ROS accumulation, and accelerated growth of pathogens.

[0039] In the present invention, knockout TaWAKL8-2B The present invention provides an important gene resource for wheat rust resistance breeding.

[0040] To further illustrate the present invention, a wheat cell wall-associated receptor-like kinase TaWAKL8-2B provided by the present invention and its application in rust resistance are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1

[0042] qRT-PCR analysis TaWAKL8-2B The expression patterns at different stages of pathogen infection were analyzed in detail. TaWAKL8-2B Gene cloning and expression analysis.

[0043] 1. Clone from the wheat variety "Shuiyuan 11" TaWAKL8-2BThe full-length coding sequence of SEQ ID NO. 2 was obtained by using the recombinant vector construction method to obtain the recombinant target plasmid. This step used the following forward primers: TaWAKL8-2B-ORF-F :atgtcacaagcaaagctcatcctc (SEQ ID NO. 3) and reverse primer: TaWAKL8-2B-ORF-R : atcttggaatttcagatg attgg (SEQ ID NO. 4).

[0044] 2. Then use the following wheat TaWAKL8-2B Quantitative analysis of gene-specific fragments using quantitative primers: Forward primer: TaWAKL8-2B-qRT-F :catcctcgcaacggtgacgg (SEQ ID NO.5), reverse primer: TaWAKL8-2B -qRT-R: gagcagctttggtggatggc (SEQ ID NO.6). The internal reference gene is the elongation factor gene TaEF-1α Internal reference primer: Forward primer: TaEF1α-F :tggtgtcatcaagcctggtatggt (SEQ ID NO.7), reverse primer: TaEF1α -R: actcatggtgcatctcaacggact (SEQ ID NO. 8).

[0045] Real-time fluorescence quantitative PCR (qRT-PCR) TaWAKL8-2B Expression analysis, specific experimental steps: First, the amplification efficiency of the quantitative primers and the specificity of the amplified products were tested to ensure the accuracy of the quantitative results, and then the fluorescence quantitative PCR experiment was performed. The reaction system was TB Green Premix DimerEraser (2×) 10.0 μL, TaWAKL8-2B -qRT-F 0.6 μL, TaWAKL8-2B -qRT-R 0.6 μL, cDNA template (<100 ng) 2.0 μL, ddH2O 6.8 μL, after thorough mixing, instant centrifugation, and quantitative analysis using a fluorescent quantitative PCR instrument (CFX96). TaWAKL8-2B In the incompatible interaction (CYR23 infection), the expression level was significantly upregulated, with a peak value of 30 times ( Figure 2 ).

[0046] Example 2

[0047] Creation and disease resistance verification of transgenic plants:

[0048] Using Gateway technology TaWAKL8-2B Genes were inserted into the pANIC6E vector. Primers for overexpression vector construction: Forward primer:TaWAKL8-2B- 6E-F: ggggacaagtttgtacaaaaaagcaggcttcagcgtagtctgggacgtcgtatgggtaatgtcacaagcaaagctcatcctc (SEQ ID NO. 9), reverse primer: TaWAKL8-2B -6E-R: ggggaccactttgtacaagaaagctgggtcctaagcgtagtctgggacgtcgtatgggtatcttggaatttcagatgattgg (SEQ ID NO. 10).

[0049] The recombinant plasmid was constructed by using a BP reaction to connect the coding region sequence of TaWAKL8-2B to the intermediate vector of Donor221, and the reaction system was as follows: gene fragment 4.0 μL, BP enzyme 0.5 μL, intermediate vector 2.0 μL, buffer 1×TE supplemented to 10 μL. After 12 h of connection at 25°C, Escherichia coli DH5α was transformed. Then, the successfully connected TaWAKL8-2B -Donor221 was connected to the final vector pANIC6E by an LR reaction, and the reaction system was as follows: TaWAKL8-2B -Donor221 1.5 μL, pANICE6E vector 1.0 μL, LR enzyme 0.5 μL, buffer 1×TE supplemented to 5 μL. After 12 h of connection at 25°C, Escherichia coli DH5α was transformed.

[0050] The overexpression strain (OE) was obtained by transforming wheat young embryos through an Agrobacterium-mediated genetic transformation system. TaWAKL8-2B The positive single clone was picked and placed in 10 mL MGL (biotin was added) culture medium, and cultured at 180 rpm for 24 h. The treatment method of Agrobacterium was referred to Ishida et al. (2015), Agrobacterium-mediated transformation of immature embryos of wheat. The ear of the wheat variety Fielder was selected 14 d after flowering, the grains were gently peeled off, and then the young embryos were picked after surface sterilization. The transformation method and the preparation of the culture medium were in accordance with Ishida et al. (2015). After screening and differentiation through herbicides, the regenerated plants were obtained after rooting culture and transplanting into the medium. TaWAKL8-2B The regenerated plants of the gene TaWAKL8-2B-KO-L1 and TaWAKL8-2B-KO-L2 After the overexpression strain was inoculated with the stripe rust CYR32, the number of lesions was reduced by 70% compared with the control (Fielder), the accumulation of ROS was increased by 2 times (OE), and the resistance to the stripe rust was significantly enhanced (OE). Figure 3 Figure 4

[0051] ​​Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained based on the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. Use of a gene encoding a wheat cell wall-associated receptor-like kinase TaWAKL8-2B overexpressed in improving wheat stripe rust resistance, characterized in that: The coding gene is a gene with a nucleotide sequence shown in SEQ ID NO.

2.

2. Use of a recombinant vector in improving wheat stripe rust resistance, characterized in that: The recombinant vector is inserted with a coding gene of wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the coding gene is a gene with a nucleotide sequence shown in SEQ ID NO.

2.

3. Use of a recombinant bacterium in improving wheat stripe rust resistance, characterized in that: The recombinant bacteria comprises a recombinant vector; the recombinant vector is inserted with a coding gene of wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the coding gene is a gene with a nucleotide sequence shown in SEQ ID NO.

2.

4. The use according to any one of claims 1 to 3, characterized in that Wheat stripe rust resistance is improved by overexpressing the coding gene of wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the coding gene is the gene with the nucleotide sequence shown in SEQ ID NO.

2.

5. A method for breeding stripe rust-resistant wheat varieties, characterized in that: The method comprises the following steps: using a recombinant vector or a recombinant bacterium to transform wheat cells to obtain transgenic plants; The recombinant vector is inserted with a gene encoding wheat cell wall-associated receptor-like kinase TaWAKL8-2B; the encoding gene is a gene with a nucleotide sequence shown in SEQ ID NO.2; The recombinant bacteria comprises the recombinant vector.

Images