Primer composition for respiratory tract pathogen detection, related product and application
By designing specific primer and probe compositions, combined with fully automatic nucleic acid detection and analysis instruments, rapid and accurate detection of a variety of respiratory pathogens is achieved, the detection difficulties in the prior art are solved, and detection efficiency and accuracy are improved.
Patent Information
- Application Number
- CN202511072540.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-01
- Publication Date
- 2025-09-02
AI Technical Summary
The prior art cannot quickly and accurately detect pathogens of respiratory infection diseases, making it difficult to accurately use medication and prevent and control transmission of treatment plans.
Design specific primer compositions and probe compositions for the detection of multiple respiratory pathogens simultaneously, combining fully automatic nucleic acid detection and analysis instruments and kits to achieve multiple PCR amplification and fluorescence detection.
It has achieved rapid and accurate detection of influenza A virus, influenza B virus, Bauterus pertussis, adenovirus, respiratory syncytial virus and Mycoplasma pneumoniae. It has high sensitivity, good specificity, strong anti-interference, good stability, and high detection accuracy. It is suitable for the mixed conditions of multiple pathogens.
Smart Images

Figure CN120574992A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of pathogen detection, and in particular relates to a primer composition for respiratory pathogen detection and related products and applications. Background Art
[0002] Respiratory infections (such as influenza, mycoplasma pneumonia, and pertussis) are among the highest causes of morbidity and mortality worldwide. Their severity varies depending on factors such as the type of pathogen, site of infection, population immunity, and available medical care. Common pathogens include viruses (such as influenza A / B, adenovirus, and respiratory syncytial virus) and bacteria (such as Mycoplasma pneumoniae and Bordetella pertussis). Treatment options vary significantly depending on the pathogen: Influenza A viruses (such as H1N1, H3N2, and H5N1) require neuraminidase inhibitors (such as oseltamivir); Mycoplasma pneumoniae requires macrolide antibiotics; and Bordetella pertussis requires early macrolide treatment to interrupt transmission. Therefore, rapid and accurate etiological diagnosis is crucial for targeted medication and epidemic prevention and control.
[0003] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the Invention
[0004] The purpose of the present invention is to solve the problem of rapid and accurate detection of pathogens of respiratory infections and to provide a primer combination for respiratory pathogen detection and related products and applications.
[0005] The first aspect of the present invention provides a primer composition for detecting respiratory pathogens, comprising a primer pair for influenza A virus, a primer pair for influenza B virus, a primer pair for Bordetella pertussis, a primer pair for adenovirus, a primer pair for respiratory syncytial virus, and a primer pair for Mycoplasma pneumoniae, wherein: The primer pair for influenza A virus is: a primer pair with nucleotide sequences as shown in SEQ ID NO: 1-2; The primer pair for influenza B virus is: a primer pair with nucleotide sequences as shown in SEQ ID NO: 4-5; The primer pair for Bordetella pertussis is: a primer pair having nucleotide sequences as shown in SEQ ID NOs: 7-8; The primer pair for adenovirus is: a primer pair with nucleotide sequences as shown in SEQ ID NO: 10-11; The primer pair for respiratory syncytial virus is: a primer pair with nucleotide sequences as shown in SEQ ID NOs: 13 to 15; The primer pair for Mycoplasma pneumoniae is a primer pair whose nucleotide sequence is shown in SEQ ID NO: 17-18.
[0006] The second aspect of the present invention provides a primer-probe combination for detecting respiratory pathogens, comprising the above primer combination and probes, wherein the probes include a probe for influenza A virus, a probe for influenza B virus, a probe for Bordetella pertussis, a probe for adenovirus, a probe for respiratory syncytial virus, and a probe for Mycoplasma pneumoniae, wherein: The probe for influenza A virus is: a probe having a nucleotide sequence as shown in SEQ ID NO: 3; The probe for influenza B virus is: a probe having a nucleotide sequence as shown in SEQ ID NO: 6; The probe for Bordetella pertussis is: a probe having a nucleotide sequence as shown in SEQ ID NO: 9; The adenovirus probe is a probe having a nucleotide sequence as shown in SEQ ID NO: 12; The probe for respiratory syncytial virus is: a probe having a nucleotide sequence as shown in SEQ ID NO: 16; The probe for Mycoplasma pneumoniae is a probe having a nucleotide sequence as shown in SEQ ID NO: 19.
[0007] In one embodiment of the present invention, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group. The fluorescent reporter groups include, but are not limited to, FAM (6-carboxyfluorescein), ROX (Rhodamine X), Cy5 (Cyanine 5), and VIC (phosphoramidite). The fluorescent quenchers include, but are not limited to, BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), and MGB (minor groove binder). If the number of combinations of fluorescent reporter and fluorescent quencher groups is less than the number of target pathogens to be detected, detection can be performed in different mixed systems, with different probes in the same mixed system using different combinations of fluorescent reporter and fluorescent quencher groups, and there is no spectral cross-interference between the combinations.
[0008] A third aspect of the present invention provides a kit for detecting respiratory pathogens, comprising a primer solution, wherein the primer solution comprises the above primer composition or the above primer-probe composition.
[0009] In one embodiment of the present invention, the primer solution further includes a primer-probe combination for detecting an internal reference gene, wherein the internal reference gene is ribonuclease P (RNase P), and the primer-probe combination for detecting the internal reference gene includes a primer pair having a nucleotide sequence as shown in SEQ ID NO: 20-21, and a probe having a nucleotide sequence as shown in SEQ ID NO: 22.
[0010] In one embodiment of the present invention, the primer solution is divided into primer solution A and primer solution B. The primer solution A includes a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 1 to 2, a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 4 to 5, a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 7 to 8, a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 20 to 21, a probe having a nucleotide sequence as shown in SEQ ID NO: 3, a probe having a nucleotide sequence as shown in SEQ ID NO: 6, a probe having a nucleotide sequence as shown in SEQ ID NO: 9, and a probe having a nucleotide sequence as shown in SEQ ID NO: 22; The primer solution B includes a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 10 to 11, a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 13 to 15, a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 17 to 18, a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 20 to 21, a probe with a nucleotide sequence as shown in SEQ ID NO: 12, a probe with a nucleotide sequence as shown in SEQ ID NO: 16, a probe with a nucleotide sequence as shown in SEQ ID NO: 19, and a probe with a nucleotide sequence as shown in SEQ ID NO: 22.
[0011] In one embodiment of the present invention, the probes whose nucleotide sequences are as shown in SEQ ID NO: 3 and SEQ ID NO: 12 are labeled with a fluorescent reporter group FAM at the 5' end and a fluorescent quencher group BHQ1 at the 3' end; the probes whose nucleotide sequences are as shown in SEQ ID NO: 6 and SEQ ID NO: 16 are labeled with a fluorescent reporter group ROX at the 5' end and a fluorescent quencher group BHQ2 at the 3' end; the probes whose nucleotide sequences are as shown in SEQ ID NO: 9 and SEQ ID NO: 19 are labeled with a fluorescent reporter group Cy5 at the 5' end and a fluorescent quencher group BHQ2 at the 3' end; the probes whose nucleotide sequences are as shown in SEQ ID NO: 22 are labeled with a fluorescent reporter group VIC at the 5' end and a fluorescent quencher group BHQ1 at the 3' end.
[0012] In one embodiment of the present invention, the kit further includes an amplification reaction solution, a positive quality control product, a negative quality control product, carrier RNA, proteinase K, magnetic beads, a rinse solution, an eluent, silicone oil, a lysis solution C, isopropanol, a rinse solution 1A, and a rinse solution 2A, wherein the rinse solution 1A is composed of guanidine hydrochloride and isopropanol, and the rinse solution 2A is ethanol.
[0013] In one embodiment of the present invention, the kit is packaged into three parts: box body I, box body II and box body III, wherein the box body I is composed of the amplification reaction solution, the primer solution A, the primer solution B, the carrier RNA, the proteinase K, the positive quality control product and the negative quality control product, the box body II is composed of the magnetic beads, the rinse solution and the eluent, and the box body III is composed of the silicone oil, the lysis solution C, the isopropanol, the rinse solution 1A and the rinse solution 2A.
[0014] The fourth aspect of the present invention provides a detection system for respiratory pathogen detection, including a fully automatic nucleic acid detection and analysis instrument and the above-mentioned reagent kit. The fully automatic nucleic acid detection and analysis instrument includes an air path module, a mechanical module, and a microfluidic chip.
[0015] A fifth aspect of the present invention provides the use of the above primer composition, the above primer-probe composition, the above kit, or the above detection system in the preparation of a product for detecting respiratory pathogens, wherein the respiratory pathogens include influenza A virus, influenza B virus, Bordetella pertussis, respiratory syncytial virus, adenovirus, and Mycoplasma pneumoniae.
[0016] Compared with the prior art, the present invention achieves the following technical effects: (1) The present invention can simultaneously detect influenza A viruses (seasonal H1N1, novel influenza A (H1N1) virus (2009), H3N2, H5N1, H7N9), influenza B viruses (Victoria and Yamagata), adenoviruses (groups B, C, and E), respiratory syncytial viruses (subtypes A and B), Mycoplasma pneumoniae, and Bordetella pertussis, thereby quickly identifying the causative pathogens, which is of great significance for clinical detection.
[0017] (2) High detection sensitivity: The detection Ct value of the primer-probe combination of the present application is smaller than that of the control combination, the sample concentration that can be detected is low, and the amplification efficiency is high.
[0018] (3) Good inclusiveness: The detection rate of each pathogen subtype is ≥95% (n≥20) and the coefficient of variation CV of the Ct value is no more than 5%, and the inclusiveness meets the requirements.
[0019] (4) Strong anti-interference ability: Endogenous substances (such as mucin and human cells) and exogenous interfering substances (such as oxymetazoline and dexamethasone) that may be introduced during the sampling process will not affect the detection results. When two or three targets in the same system are present in the sample, internal competitive inhibition will not occur. The present invention can also correctly detect the mixture of two pathogens and three pathogens.
[0020] (5) Good detection specificity: There is no cross-reaction between the 6 pathogens within the detection range, and there is no cross-reaction with the 43 common respiratory pathogens outside the detection range of the kit that have the same genes or gene sequences as the pathogens within the detection range.
[0021] (6) Good precision: the repeatability precision, indoor precision, reproducibility precision and inter-batch precision CV are all ≤5%, meeting the requirements.
[0022] (7) Good stability: The shelf life is more than 12 months under conditions of storage and transportation at low and room temperatures, repeated freezing and thawing (number ≤ 6 times), etc.
[0023] (8) High detection accuracy: Through pathogen consistency analysis, it was found that the total consistency analysis rate of the detection kit of the present invention for six types of pathogens reached more than 99.2%, and the detection accuracy was high. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figures 1A-1B This is a screenshot of some experimental data software in the inclusive study; Figures 2A-2D This is a screenshot of some experimental data software in the interference research; Figure 3 These are screenshots of some experimental data software used in pathogen-specific studies. DETAILED DESCRIPTION
[0025] Unless expressly stated otherwise, throughout the specification and claims, the term "comprise" or variations such as "include" or "comprising", etc., will be understood to include the stated elements or components but not to exclude other elements or other components.
[0026] The technical solutions of the present invention are described below by means of specific embodiments. It should be understood that one or more steps mentioned in the present invention do not exclude the presence of other methods and steps before and after the combination step, or other methods and steps may be inserted between these explicitly mentioned steps. It should also be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. Unless otherwise specified, the numbering of each method step is only for the purpose of identifying each method step, and does not limit the order of arrangement of each method or the scope of implementation of the present invention. Changes or adjustments in their relative relationships can also be regarded as the scope of implementation of the present invention without substantial changes in the technical content.
[0027] The sources of the raw materials and instruments used in the examples are not particularly limited and can be purchased from the market or prepared according to conventional methods known to those skilled in the art.
[0028] Example 1 Preparation of primers In this example, primers were designed based on the conserved matrix protein M1 gene of influenza A and B viruses, the DNA binding protein E2B gene of adenovirus, the N gene of respiratory syncytial virus, the cell adhesion protein gene P1 of Mycoplasma pneumoniae, and the promoter of the pertussis toxin S1 subunit of Bordetella pertussis as target genes. RSV consists of two subtypes, subtype A and subtype B, whose gene sequences differ partially. Therefore, three primers were designed for both RSV subtypes: a shared upstream primer and two downstream primers, one for subtype A and one for subtype B. The base sequences of these primers are shown in Table 1.
[0029] Table 1 Primer base sequences
[0030] The PCR amplification procedure is as follows:
[0031] This application uses a multiplex PCR method to achieve rapid detection of multiple pathogens. Screening for appropriate primers is key. The inventors fully considered issues such as specificity, compatibility, and conservatism in primer design and optimized the reaction conditions (such as primer concentration, annealing temperature, Mg 2+ concentration, etc.), thereby enabling the simultaneous amplification of multiple target fragments of different sizes in a single reaction. Subsequent detection methods (such as microarray hybridization and high-throughput sequencing) can then be used to distinguish and identify different pathogens.
[0032] Example 2 Preparation of primers and probes This Example differs from Example 1 in that, based on the primer designs in Example 1, the inventors designed matching probe sequences to form primer-probe combinations for each pathogen. Human RNaseP was used as an internal reference gene, and corresponding primers (the internal reference primer nucleotide sequences are SEQ ID NO: 20 CTGACCTGAAGGCTCTGC and SEQ ID NO: 21 GGCAAAGTTGTGAAGAGTTCAG) and probes were designed. All probes were labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. The probe base sequences and modifications are shown in Table 2.
[0033] Table 2 Probe base sequences and modifications
[0034] The primers and probes used in Examples 1 and 2 were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Sequence accuracy was verified by comparing the synthesis order and CoA. The synthesized primers were prepared into a 100 μmol / L stock solution, and the probes were prepared into a 50 μmol / L stock solution. Sensitivity control samples were used for calibration, and qualified samples were stored below -15°C for future use.
[0035] Example 3 Kit Preparation A kit for detecting respiratory pathogens, comprising a primer solution, an amplification reaction solution, a positive quality control, a negative quality control, carrier RNA, proteinase K, magnetic beads, a rinse solution, an eluent, silicone oil, lysis solution C, isopropanol, rinse solution 1A, and rinse solution 2A. The primer solution comprises primer solution A and primer solution B. Primer solution A comprises fragments of nucleotide sequences such as SEQ ID NOs: 1-9 and 20-22; primer solution B comprises fragments of nucleotide sequences such as SEQ ID NOs: 10-19 and 20-22. Each probe fragment comprises the modifications shown in Table 2. Amplification reaction solution was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; positive quality controls included pseudoviral vectors containing RNA target sequences of influenza A virus (FluA), influenza B virus (FluB), and respiratory syncytial virus (RSV), lentiviral vectors containing adenovirus (Adv) DNA target sequences, Bordetella pertussis (BP), Mycoplasma pneumoniae (MP) target sequence plasmids, and HEK293 cells. Pseudoviral vectors were purchased from Sangon Biotech (Shanghai) Co., Ltd.; negative quality controls were 1×10 5 HEK293 cell mixture (cells / mL), HEK293 cells were self-produced; Carrier RNA was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; magnetic beads were purchased from Suzhou Beaver Biomedical Engineering Co., Ltd.; the rinse buffer was bovine serum albumin (BSA) solution; the eluent contained Tris and EDTA; the lysis buffer C contained guanidine isothiocyanate and dithiothreitol; the rinse buffer 1A consisted of guanidine hydrochloride and isopropanol; the rinse buffer 2A was ethanol; proteinase K, silicone oil, and isopropanol were purchased commercially.
[0036] The kit is packaged in three parts: Cartridge I, Cartridge II, and Cartridge III. Cartridge I contains the amplification reaction solution, Primer Solution A, Primer Solution B, carrier RNA, Proteinase K, positive and negative quality controls; Cartridge II contains magnetic beads, rinse solution, and eluent; and Cartridge III contains silicone oil, Lysis Solution C, isopropanol, Rinse Solution 1A, and Rinse Solution 2A. Cartridge I, Cartridge II, and Cartridge III should be stored below -15°C, 2-8°C, and 10-30°C, respectively.
[0037] Table 3 Kit composition
[0038] Example 4 Detection method and analysis of detection results Detection method The kit of Example 3 is used in conjunction with a real-time fluorescence quantitative PCR instrument (such as ABI7500, ABI QuantStudio7 Flex, Macroshi SLAN-96P, Macroshi SLAN-96S, Macroshi SLAN-48P, Yarui MA1600, Bio-Rad CFX Opus96, Bio-Rad CFX 96, Tianlong Genesy 96T, Tianlong Gentier96E / 96R, Mingde QPT1000, etc.) to detect respiratory pathogens. The specific steps include: 1. Preparation 1.1 Sample preparation Place the sampling tube on a vortex mixer and vortex thoroughly for 10 seconds. Frozen samples need to be thawed at room temperature in advance.
[0039] 1.2 Reagent Preparation Take out Kit I and Kit II from the refrigerator respectively, wait for each component to fully equilibrate to room temperature, mix them well, and shake off the residual reagents on the tube wall to the bottom of the tube.
[0040] 2. Experimental Procedure 2.1 Nucleic acid extraction: (1) Take 200 μL of each sample, negative control, and positive control using a pipette, add 200 μL of lysis buffer, 10 μL of proteinase K, 5.5 μL of carrier RNA, 30 μL of magnetic beads, and 170 μL of isopropanol to each sample for nucleic acid capture, shake and mix, and then keep at 65°C for 10 minutes; (2) Magnetic bead adsorption and discarding of waste liquid; (3) Rinse the magnetic beads with 80 μL of rinse solution 1A and 80 μL of rinse solution 2A respectively; (4) Elute the magnetic beads with 60 μL of elution buffer at 65°C for 5 min to obtain the sample nucleic acid.
[0041] 2.2 PCR amplification: (1) Preparation of amplification system: Add 7.5 μL of amplification reaction solution, 6 μL of primer solution A, and 16.5 μL of sample nucleic acid to amplification tube A. Add 7.5 μL of amplification reaction solution, 6 μL of primer solution B, and 16.5 μL of sample nucleic acid to amplification tube B.
[0042] (2) Amplification program settings: Same as the PCR amplification program in Example 1.
[0043] (3) Set the following fluorescence channels according to the probe modification conditions in Table 2:
[0044] 2.3 After the experiment is completed, clear the site and clean the equipment.
[0045] The test kit of this embodiment 3 can be used in conjunction with a fully automatic nucleic acid detection and analysis instrument (such as model BHQ-III, BHNA-Q1200) for detection. The fully automatic nucleic acid detection and analysis instrument includes an air path module, a mechanical module, and a microfluidic chip. The front of the microfluidic chip is provided with a liquid reservoir. The reagents in the test kit can be added to the corresponding liquid reservoir through the sample gun of the mechanical module; the back of the chip is provided with pumps and valves. The movement of liquid is achieved by regularly switching different groups of pumps and valves. The experimenter only needs to place each reagent component in the corresponding position on the reagent rack of the instrument to automatically complete the detection. For specific operations, please refer to the instrument manual. The experimental data of the test example of this application was mainly obtained through detection using a fully automatic nucleic acid detection and analysis instrument (BHQ-III / BHNA-Q1200).
[0046] Result analysis: To improve efficiency, the detection experiment was performed using a fully automatic nucleic acid detection and analysis instrument (BHQ-III / BHNA-Q1200). The detection criteria for each target were: a Ct value greater than 40 or no Ct was considered negative (-); a Ct value ≤ 40 was considered positive (+). Based on the fluorescence channel settings, the following judgment rules were set: 1. Invalid results If the internal reference and the pathogen in either amplification tube A or amplification tube B are both negative, the sample test result is considered invalid; the cause must be investigated and retested or resampled.
[0047] 2. Effective results (1) The internal reference in both amplification tube A and amplification tube B is positive; or (2) the internal reference in amplification tube A or amplification tube B is negative, but the tube with the negative internal reference is pathogen-positive; in both cases, the test results are valid, and a pathogen-positive result is considered as the corresponding pathogen being detected, and a pathogen-negative result is considered as the corresponding pathogen not being detected.
[0048] For example, the detection results of the three channels in the following table are: Channel 1: Valid result, positive for respiratory syncytial virus, negative for all other pathogens. Channel 2: Valid result, negative for all pathogens. Channel 3: Invalid result.
[0049]
[0050] Test Case 1. Sensitivity study The inventors designed multiple primer and probe combinations for target pathogens. The "present combination" for a particular pathogen refers to the primer and probe combination corresponding to that pathogen in Example 2 (e.g., the "present combination" for influenza A virus refers to the primer and probe combination corresponding to SEQ ID NOs: 1-3). Other primer and probe combinations for that pathogen are designated "Control Combination 1," "Control Combination 2," and "Control Combination 3," respectively. Because the target pathogens may have different subtypes, different primers and probes were designed for each subtype, and these primers and probes were mixed and used in the same system. The primer and probe sequences and modifications for some of the control combinations for each pathogen are shown in Table 4 below.
[0051] Table 4 Primer probe sequences and modifications for each pathogen control combination
[0052] The present combination and the control combination were used to test the corresponding pathogen samples. The samples were diluted 10-fold to form a five-step gradient with a copy / reaction range of 10 to 100,000. The sensitivity and amplification efficiency of each primer-probe combination are shown in Table 5.
[0053] Table 5 Sensitivity, amplification efficiency and specificity test results of each primer-probe combination
[0054] Note: NoCt indicates no detection at that concentration. The number in the "Copies / Reaction" column reflects the amplification efficiency. A smaller Ct value indicates a higher amplification efficiency, and a Ct value greater than 40 indicates no detection. An "Amplification Efficiency" closer to 100% indicates better linearity for the corresponding combination. A NoCt in negative samples indicates that the primer-probe combination exhibits no nonspecific amplification and meets specificity requirements.
[0055] According to the data in Table 5, except for a false positive detection in a negative sample of control combination 1 for Bordetella pertussis, all other primer-probe combinations were negative, meeting the specificity requirements. Taking into account Ct values, amplification efficiency, and specificity, we selected primer-probe combinations with the best efficacy for each pathogen (one each for influenza B virus, adenovirus, respiratory syncytial virus, Mycoplasma pneumoniae, and Bordetella pertussis, all of which are combinations of this application; for influenza A virus, three combinations were selected, including this application's combination and control combination 1 and control combination 2) for validation of efficacy under mixed system conditions.
[0056] To improve detection efficacy, this application placed primer-probe combinations for pathogens that are prone to co-infection in clinical samples into tubes A and B for testing. The six pathogens and internal references formed two quadruple systems: tube A (including influenza A and B viruses, pertussis, and internal references) and tube B (including adenovirus, respiratory syncytial virus, Mycoplasma pneumoniae, and internal references). The quadruple hybrid system was then validated. Three hybrid systems were designed, and the primer-probe combinations for each pathogen in each system are detailed in the table below.
[0057] Table 6 Primer-probe combinations for each pathogen in the three mixed systems
[0058] The above three mixed systems were tested according to the detection method of Example 4, with 100 copies / reaction sample. The results are shown in Table 7.
[0059] Table 7 Results of combined detection of 100 copies / reaction in the mixed system
[0060] The results in Table 7 show that when three primer-probe combinations (the present application combination, control combination 1, and control combination 2) were tested for influenza A alone, the differences in their effects were not significant. However, when mixed with primer-probe combinations for other pathogens, the control combinations interfered with the detection of other pathogens. Control combinations 1 and 2 affected the detection sensitivity of influenza B virus. Compared with the present application system, the sensitivity of control system 1 or 2 for detecting influenza B virus was approximately 10-fold lower (calculated based on a 100% amplification efficiency and a 3.3 difference in the corresponding Ct value for each 10-fold difference in sample concentration). Therefore, the present application system demonstrated a clear advantage. The primer-probe combinations for each pathogen in the present application not only have high sensitivity (low Ct value), high amplification rate (90%-110%), and good specificity, but also do not interfere with each other when mixed for detection.
[0061] 2. Inclusive research A total of 54 clinical samples with temporal and geographical diversity were used as the research objects, involving 6 pathogens with a total of 18 major subtypes: influenza A virus (H1N1 (novel influenza A H1N1 virus (2009), seasonal influenza H1N1 virus, H3N2, H5N1, H7N9), influenza B virus (Yamagata, Victoria), Bordetella pertussis, adenovirus (types 1, 2, 3, 4, 5, 7, 55), respiratory syncytial virus (types A and B), and Mycoplasma pneumoniae. Each subtype included strains from three different sources, for a total of 54 strains. All clinical samples were obtained from Wuhan University and collected from sentinel hospitals across the country.
[0062] These 54 samples were diluted to the minimum detection limit concentration and tested using the kit of Example 3 of the present application and a fully automatic nucleic acid detection and analysis instrument. The results showed that the detection rate of each pathogen subtype was ≥95% (n≥20) and the coefficient of variation CV of the Ct value was no more than 5%. The inclusiveness of this kit meets the requirements.
[0063] Some of the sample test results in this study are as follows Figures 1A-1B As shown, Figure 1A Sample wells 1-10 in the middle tested 10 replicates of H3N2-positive clinical samples, and the blue curve represents influenza A virus H3N2; Figure 1B Sample wells 1-10 were tested with 10 replicates of Yamagata-positive clinical samples. The yellow curve represents influenza B virus Yamagata; the green curves in the figure represent internal controls.
[0064] 3. Interferor Research Potential interfering substances in the nasopharynx mainly include: blood, nasal secretions or mucus, drugs used in the nose and throat to relieve nasal congestion, nasal dryness, irritation or asthma and allergy symptoms, as well as antibiotics and antiviral drugs. This study selected 29 common interfering substances, used single positive critical positive level and mixed positive critical level samples for detection, and calculated the Ct bias value. The Ct bias value results of each sample are shown in Table 8. It can be seen from the results in Table 8 that: except for 50μg / mL freeze-dried nasal spray influenza attenuated vaccine (interfering substance number 26), the Ct value deviation of the sample detection after adding other interfering substances is within 1.67, indicating that the interfering substances do not affect the detection of various pathogens. In addition, 2% whole blood and high concentration human cells (10 6 Because the freeze-dried attenuated nasal influenza vaccine may affect the detection of influenza A and B viruses, false positives for influenza A or B viruses may occur in patients who use this vaccine.
[0065] Table 8 Ct bias values
[0066] Note: The interfering substances No. 1-29 in the table correspond to the following concentrations: 2.5% (w / v) mucin (No. 1), 15% (v / v) oxymetazoline hydrochloride (No. 2), 100 mg / L triamcinolone acetonide (No. 3), 320 mg / L budesonide (No. 4), 10 mg / mL montelukastena (No. 5), 10 mg / mL fexofem hydrochloride (No. 6), 50 mg / L amantadine (No. 7), 7.5 mg / mL ribavirin (No. 8), 7.5 mg / mL oseltamivir (No. No. 9), 10 mg / mL levofloxacin (No. 10), 10 mg / mL norfloxacin (No. 11), 1.7 mg / mL menthol (No. 12), 500 mg / L mupirocin (No. 13), 60 mg / L NaCl (No. 14), 0.2% anhydrous ethanol (No. 15), 2% (v / v) whole blood (No. 16), 50 mg / L dexamethasone (No. 17), 150 mg / L mometasone (No. 18), 100 mg / L tobramycin (No. 19), 10^6 cells / mL HEK293 cells (No. 20), 100 μg / mL phenylephrine (No. 21), 50 μg / mL beclomethasone (No. 22), 10 μg / mL flunisolide (No. 23), 50 μg / mL fluticasone (No. 24), 50 μg / mL histamine hydrochloride (No. 25), 50 μg / mL freeze-dried nasal attenuated influenza vaccine (No. 26), 50 μg / mL benzocaine (No. 27), 100 μg / mL zanamivir (No. 28), and 100 μg / mL peramivir (No. 29).
[0067] During this study, some of the test results software screenshots are as follows Figures 2A-2D As shown, Figure 2A Wells 1-10 correspond to the test results of sample 1 in Table 8 after adding interfering substances 1-10, respectively. The blue curve represents the positive result of influenza A virus; Figure 2B Wells 1-10 correspond to the test results of sample 2 in Table 8 after adding interfering substances 1-10, respectively. The yellow curve represents the positive result of influenza B virus; Figure 2C Wells 1-10 correspond to the test results of sample 4 in Table 8 after adding interfering substances 1-10, respectively. The blue curve represents adenovirus positive; Figure 2D Wells 1-10 correspond to the test results of sample 6 in Table 8 after adding interfering substances 1-10, respectively. The red curve represents the positive result of Bordetella pertussis; the green curve in each figure represents the internal control.
[0068] 4. Competitive interference studies between pathogens To verify the competitive interference between the three pathogens in each of the A-tube system (FluA, FluB, BP) and the B-tube system (MP, ADV, RSV) of this application's test kit, 18 combinations of six pathogen samples were tested using the present test kit and a fully automated nucleic acid detection and analysis instrument. The pathogen sample combinations and experimental results are shown in Table 9. As shown in Table 9, all combinations accurately detected the target pathogens, and the presence of one or two high-concentration pathogens did not affect the detection of other pathogens in the same system, demonstrating that this test kit is free of competitive interference.
[0069] Table 9 Competition interference detection results
[0070] Note: In the table, 1*LOD (low concentration) is the detection limit concentration of the pathogen; 1000*LOD (high concentration) refers to the 1000-fold detection limit concentration selected based on domestic literature and the 510(K) files of BioMérieux Film Array Respiratory Panel 2 (RP2) and Thermo Fisher Scientific xTAG® Respiratory Viral Panel FAST.
[0071] 5. Pathogen-specific studies The selection of pathogens for validation of the specificity (cross-reactivity) of this test kit primarily considered the following: nucleic acid sequence homology, susceptibility to causing the same or similar clinical symptoms, and the presence of other microorganisms parasitic or complicating at the sampling site. Ultimately, this study selected 43 other common respiratory pathogens not detected by the test kit and designed cross-reactivity validation at a medically relevant level for viral infection. A list of these 43 pathogens is provided in Table 10.
[0072] Table 10 43 pathogen cultures not detected by the kit
[0073] The kit of this application was used to detect the 6 pathogens within the detection range (sample numbers 1-12) and the 43 pathogens in Table 10 (sample numbers 13-55). The test results are shown in Table 11. The results show that all 6 pathogens within the detection range of this kit were accurately detected, and the test results of the other 43 pathogens were negative. There was no cross-reaction between the 6 pathogens within the detection range of this kit and the other 43 pathogens.
[0074] Figure 3 This is a software screenshot of the test results of some data in this study. The green line in the figure represents the internal reference, and sample wells 1-10 represent the test results of sample numbers 13-22.
[0075] Table 11 Cross-reactivity test results
[0076] 6. Precision study According to YY / T1789.1, "Methods for Performance Evaluation of In Vitro Diagnostic Test Systems - Part 1: Precision," clinical samples were used for this study, including negative samples, pathogen-positive samples, and common mixed infection samples. The samples involved were obtained from cooperative medical institutions. The samples used for precision evaluation in this study included three levels: negative samples, borderline-positive samples, and moderate-positive samples. The borderline-positive and moderate-positive samples were prepared by diluting negative samples to the concentrations of 2×LoD and 20×LoD, respectively.
[0077] The test model for repeatability and intra-laboratory precision evaluation is 20×2×2. In the same laboratory, the same (group of) operators use the same batch of the test kit of this application on the same instrument to test the same test sample for 20 days (which can be non-consecutive days). Two analysis batches are run every day, and each analysis batch is tested twice. At the end of the evaluation, 40 pairs, or 80 measurement results, are obtained. The SSPS analysis software is used to calculate the SS and MS of each sample, and the Excel template is designed according to the formulas provided in YY / T1789.1 "Methods for Performance Evaluation of In Vitro Diagnostic Test Systems Part 1: Precision" to calculate S, CV and the 95% confidence interval of repeatability precision and intra-laboratory precision. The calculation results are shown in Tables 12 and 13 below.
[0078] Table 12 Results of precision evaluation of each experiment
[0079] Table 13 Repeatability precision and 95% confidence intervals of intra-laboratory precision
[0080] The test model for inter-laboratory precision evaluation was 3×5×5. The same test sample was tested on 5 days in 3 laboratories using the same series of instruments of the same model. One analytical batch was run every day, and each analytical batch was tested 5 times. At the end of the evaluation, 75 measurement results were obtained. The SSPS analysis software was used to calculate the SS, MS, and DF of each sample, and an Excel template was designed to calculate S, CV, and the 95% confidence interval of reproducibility precision according to the formulas provided in YY / T1789.1 "Methods for performance evaluation of in vitro diagnostic test systems Part 1: Precision". The results of the repeatability and indoor precision tests were used to design an Excel template to perform intra-batch and inter-batch precision analysis for each pathogen. Through the above test analysis, the repeatability precision, indoor precision, reproducibility precision, and inter-batch precision CV of the kit were all ≤5%, meeting the requirements.
[0081] 7. Kit Stability Study The kit of this application consists of three boxes, box I / II / III, which are stored at below -15°C, 2~8°C, and 10~30°C respectively.
[0082] Real-time stability: Store according to the storage requirements of cartridges I / II / III, and verify using the company's reference materials at 0 months, and after 6, 10, 12, and 15 months of storage, to test the product's four performance indicators: positive compliance rate, negative compliance rate, precision, and minimum detection limit.
[0083] Stability in use: The above four performance indicators of the product were tested after freeze-thaw cycles 0, 2, 4, 6, and 8 times for Kit I.
[0084] Transport Stability: Due to the different storage temperatures of the test kits, Test Kit I is shipped on dry ice, Test Kit II is shipped refrigerated, and Test Kit III is shipped at room temperature. The product is stored according to the test kit's storage conditions before and after transportation. Test kit performance is tested using the company's reference product at designated test points. Test point design: Pre-shipment inspection, immediate inspection after 7 days of transportation, storage under specified storage conditions until the expiration date, and re-inspection three months after the expiration date to determine the product's shelf life after transportation.
[0085] The above studies have shown that: Box I should be stored below -15℃ and transported on dry ice for 7 days with a freeze-thaw cycle of ≤6 times; Box II should be stored at 2℃~8℃ and transported in a cold chain for 7 days; Box III should be stored and transported at 10℃~30℃; the shelf life can exceed 12 months.
[0086] 8. Clinical Accuracy Studies A total of 2,267 subjects were enrolled in this clinical trial, 117 of whom were excluded, resulting in a total of 2,150 valid cases. These 2,150 valid cases were tested using the kit of this application, and the consistency of the kit of this application was verified using similar marketed products, sequencing methods, and culture as comparison methods.
[0087] 1) Consistency analysis of the kit in this application Compared with the control method, the consistency analysis of each pathogen was conducted on 2150 valid cases. The results are shown in Table 14: Table 14 Consistency analysis results of each pathogen
[0088] 2) Consistency analysis of pertussis culture results using this application kit This study cultured and identified 895 cases of Bordetella pertussis, and the results were as follows: Positive compliance rate: 84 / 85=98.8%, 95% confidence interval is (93.6%, 99.8%).
[0089] Negative compliance rate: 568 / 810=70.1%, 95% confidence interval is (66.9%, 73.2%).
[0090] The overall agreement rate was 72.8%, with a 95% confidence interval of (69.8%, 75.7%).
[0091] Kappa value: 0.30.
[0092] Clinical data statistics show that the test kit and the comparison method have a concordance rate analysis with positive and negative concordance rates for each pathogen, as well as the lower limits of their 95% confidence intervals, exceeding 90%. Furthermore, based on first-generation sequencing results, each pathogen covers the major prevalent subtypes of the past three years, as well as the viral subtypes claimed to be covered by the test kit. This demonstrates that the kit and the comparison method have good consistency and high accuracy, meeting clinical requirements.
[0093] The foregoing descriptions of specific exemplary embodiments of the present invention are for purposes of illustration and description. These descriptions are not intended to limit the invention to the precise forms disclosed, and it is apparent that many variations and modifications are possible in light of the foregoing teachings. The exemplary embodiments have been selected and described for the purpose of explaining the specific principles of the invention and their practical application, thereby enabling those skilled in the art to realize and utilize a variety of exemplary embodiments of the invention and various options and modifications. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. A primer composition for detecting respiratory pathogens, characterized in that: The primer composition includes a primer pair for influenza A virus, a primer pair for influenza B virus, a primer pair for Bordetella pertussis, a primer pair for adenovirus, a primer pair for respiratory syncytial virus, and a primer pair for Mycoplasma pneumonia, wherein: The primer pair for influenza A virus is: a primer pair with nucleotide sequences as shown in SEQ ID NO: 1-2; The primer pair for influenza B virus is: a primer pair with nucleotide sequences as shown in SEQ ID NO: 4-5; The primer pair for Bordetella pertussis is: a primer pair having nucleotide sequences as shown in SEQ ID NOs: 7-8; The primer pair for adenovirus is: a primer pair with nucleotide sequences as shown in SEQ ID NO: 10-11; The primer pair for respiratory syncytial virus is: a primer pair with nucleotide sequences as shown in SEQ ID NOs: 13 to 15; The primer pair for Mycoplasma pneumoniae is a primer pair whose nucleotide sequence is shown in SEQ ID NO: 17-18.
2. A primer-probe combination for detecting respiratory pathogens, characterized in that: The primer-probe combination comprises the primer combination and probe according to claim 1, wherein the probe comprises a probe for influenza A virus, a probe for influenza B virus, a probe for Bordetella pertussis, a probe for adenovirus, a probe for respiratory syncytial virus, and a probe for Mycoplasma pneumoniae, wherein: The probe for influenza A virus is: a probe having a nucleotide sequence as shown in SEQ ID NO: 3; The probe for influenza B virus is: a probe having a nucleotide sequence as shown in SEQ ID NO: 6; The probe for Bordetella pertussis is: a probe having a nucleotide sequence as shown in SEQ ID NO: 9; The adenovirus probe is a probe having a nucleotide sequence as shown in SEQ ID NO: 12; The probe for respiratory syncytial virus is: a probe having a nucleotide sequence as shown in SEQ ID NO: 16; The probe for Mycoplasma pneumoniae is a probe having a nucleotide sequence as shown in SEQ ID NO:
19.
3. The primer-probe combination according to claim 2, characterized in that The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group. The fluorescent reporter group is FAM, ROX, Cy5 or VIC, and the fluorescent quencher group is BHQ1, BHQ2, BHQ3 or MGB.
4. A kit for detecting respiratory pathogens, characterized in that: The kit includes a primer solution, and the primer solution includes the primer composition according to claim 1 or the primer-probe composition according to any one of claims 2-3.
5. The kit according to claim 4, characterized in that The primer solution also includes a primer-probe combination for detecting an internal reference gene, wherein the internal reference gene is ribonuclease P (RNase P), and the primer-probe combination for detecting the internal reference gene includes a primer pair having nucleotide sequences as shown in SEQ ID NOs: 20-21, and a probe having a nucleotide sequence as shown in SEQ ID NO:
22.
6. The kit according to claim 5, characterized in that The primer solution is divided into primer solution A and primer solution B. The primer solution A includes a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 1 to 2, a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 4 to 5, a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 7 to 8, a primer pair having a nucleotide sequence as shown in SEQ ID NOs: 20 to 21, a probe having a nucleotide sequence as shown in SEQ ID NO: 3, a probe having a nucleotide sequence as shown in SEQ ID NO: 6, a probe having a nucleotide sequence as shown in SEQ ID NO: 9, and a probe having a nucleotide sequence as shown in SEQ ID NO: 22; The primer solution B includes a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 10 to 11, a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 13 to 15, a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 17 to 18, a primer pair with a nucleotide sequence as shown in SEQ ID NOs: 20 to 21, a probe with a nucleotide sequence as shown in SEQ ID NO: 12, a probe with a nucleotide sequence as shown in SEQ ID NO: 16, a probe with a nucleotide sequence as shown in SEQ ID NO: 19, and a probe with a nucleotide sequence as shown in SEQ ID NO:
22.
7. The kit according to claim 6, characterized in that The probes with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 12 are labeled with a fluorescent reporter group FAM at the 5' end and a fluorescent quencher group BHQ1 at the 3' end; the probes with nucleotide sequences as shown in SEQ ID NO: 6 and SEQ ID NO: 16 are labeled with a fluorescent reporter group ROX at the 5' end and a fluorescent quencher group BHQ2 at the 3' end; the probes with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 19 are labeled with a fluorescent reporter group Cy5 at the 5' end and a fluorescent quencher group BHQ2 at the 3' end; the probes with nucleotide sequences as shown in SEQ ID NO: 22 are labeled with a fluorescent reporter group VIC at the 5' end and a fluorescent quencher group BHQ1 at the 3' end.
8. The kit according to claim 5, wherein The kit also includes an amplification reaction solution, a positive quality control product, a negative quality control product, carrier RNA, proteinase K, magnetic beads, a rinse solution, an eluent, silicone oil, a lysis solution C, isopropanol, a rinse solution 1A, and a rinse solution 2A, wherein the rinse solution 1A is composed of guanidine hydrochloride and isopropanol, and the rinse solution 2A is ethanol.
9. A detection system for respiratory pathogen detection, characterized in that: It comprises a fully automatic nucleic acid detection and analysis instrument and a kit according to any one of claims 5-9, wherein the fully automatic nucleic acid detection and analysis instrument comprises an air path module, a mechanical module, and a microfluidic chip.
10. Use of the primer combination according to claim 1, the primer-probe combination according to any one of claims 2-3, the kit according to any one of claims 4-8, or the detection system according to claim 9 in preparing a product for detecting respiratory pathogens, wherein the respiratory pathogens include influenza A virus, influenza B virus, Bordetella pertussis, respiratory syncytial virus, adenovirus, and Mycoplasma pneumoniae.
Citation Information
Patent Citations
Nucleic acid detection kit for simultaneously detecting nine respiratory pathogens based on common qPCR (quantitative polymerase chain reaction) detection platform
CN114921587A
PCR (Polymerase Chain Reaction) device based on rotary valve and detection method
CN115058314A
Fluorescent PCR melting curve kit for 12 respiratory pathogens
CN117144063A
Primer probe combination and kit for detecting respiratory pathogen nucleic acid
CN117604132A
Nucleic acid composition, kit and detection method for simultaneously and rapidly detecting 16 respiratory pathogens
CN119162388A
Cited By
Convection amplification primer group and probe for detecting multiple respiratory pathogens and application
CN122081566A