BnaALS1 linkage mutant protein based on gene editing, mutant gene and application of BnaALS1 linkage mutant protein and mutant gene

By applying SpRY and gene editing of CBE and ABE systems in rapeseed, a double-site mutation of BnaALS1 protein was achieved, solving the problem of simultaneous resistance of rapeseed to SU and IMI herbicides, supporting the rice-rapeseed rotation model and reducing breeding costs.

CN120591228APending Publication Date: 2025-09-05YANGZHOU UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510774060.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-09-05

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve simultaneous resistance to SU and IMI herbicides in rapeseed, and chemical mutagenesis makes it difficult to predict the direction of mutation, resulting in limitations in rice-oil rotation patterns.

Method used

A gene editing method combining SpRY with CBE and ABE systems was used to achieve a double-site mutation of the BnaALS1 protein in rapeseed. Specifically, the 544th base was replaced by a cytosine editor and the 1420th base was edited by an adenine editor to obtain the BnaALS1P182SW474R mutant protein, which confers combined resistance to SU and IMI herbicides in rapeseed.

Benefits of technology

It has achieved simultaneous resistance of rapeseed to SU and IMI herbicides, reduced the harmful effects of IMI herbicide residues on subsequent crops, supported the rice-oil rotation model, and reduced breeding screening costs and time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591228A_ABST
    Figure CN120591228A_ABST
Patent Text Reader

Abstract

The invention discloses a BnaALS1 linkage mutant protein based on gene editing, a mutant gene and an application of the BnaALS1 linkage mutant protein and the mutant gene. According to the invention, the BnaALS1 gene is edited by using a gene editing technology, and a germplasm resource with linkage mutation is created, so that the BnaALS1 gene has the characteristics of resisting sulfonylurea and imidazolone herbicides at the same time. The BnaALS1 linked mutant germplasm can effectively solve the problem of inhibition of soil residues on rape growth caused by application of imidazolone herbicides to preceding crops, and can also safely apply sulfonylurea herbicides during the rape planting period for field weed prevention and control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a BnaALS1 linked mutant protein, a mutant gene and applications thereof based on gene editing. Background Art

[0002] As my country's primary source of edible vegetable oil, rapeseed production is crucial to ensuring the security of the country's edible oil supply. However, weeds in fields severely restrict rapeseed yields and their simplified cultivation. According to statistics, weeds in rapeseed fields cause a 15.8% decrease in rapeseed yield, and in severe cases, the yield reduction in some fields can exceed 50%. Therefore, cultivating and promoting herbicide-resistant rapeseed varieties has become the most cost-effective way to address the weed problem. This not only facilitates simplified rapeseed cultivation but also has important practical significance for improving agricultural production efficiency.

[0003] There are many types of herbicides available, the largest of which are those targeting acetolactate synthase (ALS). ALS inhibitor herbicides mainly include five categories: sulfonylureas (SU), imidazolinones (IMI), pyrimidinylbenzoates (PB), triazolopyrimidines (TP), and sulfonylaminocarbonyltriazolinones (SCT). ALS is a key enzyme that catalyzes the synthesis of branched-chain amino acids (leucine, isoleucine, and valine) in plants and microorganisms. The mechanism of action of ALS herbicides is that the small molecules of the herbicide form a new macromolecular complex with the ALS enzyme, thereby blocking the substrate from entering the active site of the enzyme, inhibiting the activity of ALS, and ultimately hindering the synthesis of branched-chain amino acids.

[0004] Studies have shown that mutations at certain specific amino acid sites in the ALS enzyme can confer resistance to ALS herbicides on plants. These key sites include Ala-122, Pro-197, Ala-205, Trp-574, Ser-653, and Gly-654 (with the ALS amino acid sequence of Arabidopsis thaliana as a reference). In my country, the rapeseed resistant germplasms that have been created are mainly targeted at IMI and SU herbicides. For example, the natural mutant M9 discovered by the Institute of Economic Crops of Jiangsu Academy of Agricultural Sciences belongs to the IMI-resistant class, while the series of mutant germplasms such as M342, PN19, M196, DS3 and 5N created by EMS mutagenesis technology belong to the SU-resistant class. In addition, the team of Huazhong Agricultural University obtained the SU-resistant mutant germplasm M45 through EMS mutagenesis, and the Northwest Agriculture and Forestry University also obtained the SU-resistant mutant germplasm K5. It can be seen that the current screening of herbicide-resistant materials mainly relies on chemical mutagenesis technology, and is mainly resistant to SU, while there are few materials with both IMI and SU resistance.

[0005] Rice-oil rotation helps stabilize grain and oil production and effectively utilizes fallow winter fields. In recent years, some regions have promoted the cultivation of clean rice (rice resistant to IMI herbicides) in conjunction with the spraying of IMI herbicides. However, IMI herbicides have a long soil residue period, seriously affecting the growth of the subsequent rapeseed crop. When the IMI herbicide methoxazole is used at a rate of 50 g / hm2, rapeseed can be planted only eight months after the application (Xiang Binghan et al., 2022). Therefore, the promotion of clean rice has seriously restricted the implementation of the rice-oil rotation model. Breeding IMI-resistant / tolerant rapeseed varieties is an important way to solve this dilemma.

[0006] Mutations caused by chemical mutagenesis are often random, making it difficult to predict the direction of the mutation, and it is difficult to obtain germplasm with simultaneous mutations at two locations on the same gene (linked mutations). In recent years, the CRISPR-Cas editing system has been widely used in crop genetic improvement because of its advantages such as high targeting efficiency, low cost, and directed mutagenesis. In particular, single-base editors such as cytosine base editors (CBE) and adenine base editors (ABE), developed based on the CRISPR-Cas9 system, can achieve precise editing of crop genes. Compared with chemical mutagenesis, gene editing can more easily obtain linked mutation germplasm.

[0007] Currently used CRISPR / Cas9-based base editing systems in plants mostly require target sites with the NGG PAM sequence. Restrictions on the PAM sequence and the editing range significantly limit the targetable regions of base editors. To overcome the conventional SpCas9's reliance on the NGG PAM, researchers have identified a variant, SpRY. SpRY recognizes PAM sequences including NRN (N represents any base, R is A or G) and NYN (Y is C or T) (NRN sites generally have higher editing efficiency than NYN sites), thus essentially breaking through the PAM restriction and being referred to as a "PAM-free" Cas9 variant. Combining SpRY with CBE and ABE systems has enabled base editing in plant genomes. This strategy has been applied in various crops, including rice, soybean, and cotton. However, there are currently no reports of gene editing using SpRY in rapeseed. Whether SpRY-based base editing systems can effectively work in rapeseed remains to be verified, and achieving enhanced resistance to multiple herbicides through gene editing in rapeseed remains a significant challenge. Summary of the Invention

[0008] Purpose of the invention: The technical problem to be solved by the present invention is to provide a BnaALS1 linked mutant protein that can simultaneously possess resistance to SU and IMI herbicides.

[0009] The technical problem to be solved by the present invention is to provide a BnaALS1 linked mutant gene that is resistant to both SU and IMI herbicides. The double-site mutant genotype BnaALS1 of the present invention P182S W474R Conferring combined resistance to SU and IMI herbicides on rapeseed.

[0010] The technical problem that the present invention also aims to solve is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium.

[0011] The technical problem that the present invention also aims to solve is to provide an sgRNA based on the mutant gene and a gene editing vector thereof.

[0012] The technical problem that the present invention also aims to solve is to provide the BnaALS1 linked mutant protein, the BnaALS1 linked mutant gene, the expression cassette, the recombinant vector, the recombinant cell or recombinant bacteria, and the use of the sgRNA based on the mutant gene in cultivating plants with herbicide resistance.

[0013] The final technical problem to be solved by the present invention is to provide a method for obtaining herbicide-resistant plants based on gene editing methods, thereby effectively alleviating the phytotoxic effects of IMI herbicides residual from the previous crop on rapeseed growth. At the same time, SU herbicides can be applied during rapeseed planting to control field weeds, thereby achieving simplified cultivation of rapeseed.

[0014] Technical solution: In order to solve the above technical problems, the present invention provides a BnaALS1 linked mutant protein, in which the 182nd position of the rapeseed wild-type BnaALS1 protein is mutated from proline to serine and the 474th position is mutated from tryptophan to arginine.

[0015] Preferably, the amino acid sequence of the mutant protein is shown in SEQ ID NO.1.

[0016] A BnaALS1 linked mutant gene encodes the BnaALS1 linked mutant protein.

[0017] The BnaALS1 linked mutant gene mutates from C to T at position 544 of the rapeseed wild-type BnaALS1 gene, and simultaneously mutates from T to C at position 1420.

[0018] Preferably, the nucleotide sequence of the BnaALS1 linked mutant gene is shown as SEQ ID NO.2.

[0019] An expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium contains the mutant gene.

[0020] Based on the sgRNA of the mutant gene, the sgRNA sequence is shown in SEQ ID NO.3.

[0021] The gene editing vector based on the mutant gene is obtained by connecting the sgRNA into the editing vector.

[0022] The use of the BnaALS1 linked mutant protein, the BnaALS1 linked mutant gene, the expression cassette, the recombinant vector, the recombinant cell or recombinant bacteria, and the sgRNA based on the mutant gene in cultivating plants with herbicide resistance.

[0023] A method for obtaining herbicide-resistant plants based on a gene editing method, the method comprising the following steps: using a cytosine editor to replace the C base at position 544 of the plant's ALS1 gene with a T base, resulting in a mutation of the proline at position 182 (position 197 of the ALS protein in Arabidopsis) encoding the BnaALS1 protein to a serine; and simultaneously using an adenine editor to complete the base editing of position 1420 to change T>C, resulting in a mutation of the tryptophan at position 474 (position 574 of the ALS protein in Arabidopsis) to an arginine.

[0024] The plants include but are not limited to rapeseed.

[0025] The herbicides include but are not limited to one or two of bensulfuron-methyl and imazethapyr.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following outstanding significant advantages: The present invention realizes the linkage mutation of BnaALS1 double sites in rapeseed for the first time through single base editing. The base editing method provided by the present invention can improve the traits of rapeseed in a targeted manner. Compared with chemical mutagenesis, it is faster, more efficient and more accurate. At the same time, the present invention enriches the herbicide-resistant germplasm resources of rapeseed. The BnaALS1 linkage mutant gene or protein provided by the present invention is difficult to obtain by traditional mutagenesis breeding, reducing the screening and identification costs of breeding. The mutant material BnaALS1 obtained by the present invention P182S W474R (R30) also has strong resistance to bensulfuron-methyl and imazethapyr herbicides. P182S , BnaALS1 P182SW474R It has acquired tolerance to imidazolinone herbicides and stronger resistance to bensulfuron-methyl; compared with BnaALS1 W474R , BnaALS1 P182S W474R It has acquired resistance to the herbicide bensulfuron-methyl and has stronger tolerance to imidazolinone herbicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 A diagram of the base editing vector used in the present invention;

[0028] Figure 2 The Sanger sequencing peak diagram shows that 7 T0 generation transgenic plants have mutation events at the target site;

[0029] Figure 3 BnaALS1 P182S W474R Identification results of resistance of mutant materials to bensulfuron-methyl and imazethapyr.

[0030] Figure 4 BnaALS1 W474RIdentification results of resistance of mutant materials to bensulfuron-methyl and imazethapyr. DETAILED DESCRIPTION

[0031] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0032] In order to make the purpose of the invention, technical solutions and beneficial technical effects of the present invention more clear, the present invention is further described in detail below with reference to the embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Modifications or substitutions made to the methods, steps or conditions of the present invention without departing from the spirit and essence of the present invention are within the scope of the present invention.

[0033] Example 1 Construction of CRISPR / Cas9 gene editing vector

[0034] The sequence information of the wild-type BnaALS1 gene of the present invention was obtained from the BnIR database (https: / / yanglab.hzau.edu.cn / BnIR / ), with the gene ID BnaC01g25380D. In the early stages of the present invention, the Pro-182-Ser (P182S) mutant germplasm R10 of the BnaALS1 gene was obtained using a cytosine base editor (Patent No.: ZL202010051263.0; the Pro-182-Ser (P182S) position in this application is equivalent to the Pro-197-Ser (P197S) position in the patent). This germplasm has been deleted of the transgenic T-DNA. The present invention uses this germplasm as a transgenic receptor to carry out genetic transformation and gene editing of rapeseed, further editing the Trp-474 site.

[0035] In Brassica napus, the codon for Trp at position 474 in BnaALS1 and BnaALS3 is TGG. There are two editing strategies for this site: (1) using an ABE editor to mutate the first nucleotide T to C (TGG→CGG), changing the encoded amino acid to Arg; (2) using a CBE editor to mutate the second or third nucleotide G to A (TGG→TAG / TGA), introducing a stop codon. Because CBE editing at this site produces a stop codon, leading to premature translation termination, while ABE editing can achieve amino acid substitution (Trp→Arg), the ABE editor should be selected for editing this site. To achieve this targeted editing in Brassica napus, we constructed the adenine editing vector pABE8e for trial editing at this site. The system includes the following components: the Arabidopsis thaliana U6 promoter (pAtU6) drives the expression of sgRNA; the promoter (pAtRPS5a (RIBOSOMAL PROTEIN S5 A promoter) drives the expression of the adenine deaminase gene (TadA8e) and SpRY, encoding the TadA8e-SpRY fusion protein; and the 35S promoter drives the expression of the hygromycin resistance gene (HPT).

[0036] The vector construction method is as follows: Based on the monocot gene editing vector rABE8e (J Integr Plant Biol. 2021 Sep; 63(9): 1595-1599.), the pOsU6 promoter was replaced with pAtU6, the ZmUBI promoter was replaced with pAtRPS5a, and the Cas9 variant SpRY was replaced with Cas9 to construct the pABE8e adenine editing vector plasmid. See the base editing vector map for details. Figure 1 The sequence of the pABE8e adenine editing vector plasmid is shown in SEQ ID NO. 4 + SEQ ID NO. 5 in the sequence listing. The target site was designed using CRISPR-P 2.0 software (http: / / crispr.hzau.edu.cn / CRISPR2 / ); the target site sequence was TCCCATTGCATGACCATCC (SEQ ID NO. 3). This target site was then ligated into the sgRNA expression cassette on the adenine editing vector pABE8e to construct the expression vector. The specific method is as follows:

[0037] (1) Target site primer synthesis:

[0038] The following primers with adapters, sgRNA-F and sgRNA-R (Qingke Biotechnology), were synthesized. The primer sequences are as follows:

[0039] sgRNA-F: GATTGTCCATTGCATGACCATCC;

[0040] sgRNA-R: AAACGGATGGTCATGCAATGGGAC (the darkened bases represent the linker sequence).

[0041] (2) Primer annealing:

[0042] 1 μL sgRNA-F (10 μM) + 1 μL sgRNA-R (10 μM) + 8 μL Anneal Buffer (10 mM Tris, 1 mM EDTA, 50 mM NaCl) were mixed and incubated at 95°C for 10 min, then decreased to 20°C at 0.1°C / s.

[0043] (3) Vector digestion:

[0044] 5 μL pABE8e adenine editing vector plasmid (about 1 μg) + 10 μL 10×NEBuffer + 1 μL Bsa I enzyme (NEB, product number R3733) + 84 μl water were added and incubated at 37°C for 2-3 hours, and the vector was recovered.

[0045] (4) Connection:

[0046] 2 μL annealed product + 2 μL recovered enzyme-digested vector + 0.5 μL 10×T4 buffer + 0.5 μL T4 ligase (200 units / μL), room temperature for 15 min.

[0047] (5) Transformation:

[0048] Add 5 μL of the ligation product to the competent E. coli DH5α, incubate on ice for 30 min, heat shock at 42°C for 45 s, incubate on ice for 2 min, add 400 μL of antibody-free LB, incubate at 37°C for 1 h, centrifuge at 5000 rpm for 1 min, aspirate most of the supernatant, and retain 100 μL of liquid for aspiration, and apply it to LB+Kan plates.

[0049] (6) Colony PCR identification:

[0050] Prepare a PCR system: 10 μL of PCR mix (Novozymes, Cat. No. P112): M13F (10 μM, GGTAACGCCAGGGTTTTCC) 0.4 μL + sgRNA-R (10 μM, AAACGGATGGTCATGCAATGGGAC) 0.4 μL + 9.2 μL of H2O + a small amount of bacteria. PCR reaction: 95°C for 7 min, 95°C for 25 s, 56°C for 25 s, 72°C for 25 s, 28 cycles, and 72°C for 5 min. Positive clones were then identified by agarose gel electrophoresis.

[0051] (7) Positive colonies were picked and verified by Sanger sequencing (Qingke Biotechnology). The plasmids were extracted by shaking the bacteria. The plasmids were extracted by Beijing Quanshijin Biotechnology Co., Ltd. Plasmid MiniPrep Kit. Refer to the instructions for specific methods to verify the correct construction of the base editing vector. The successfully constructed vector was transformed into Agrobacterium tumefaciens GV3101 strain via freeze-thaw method.

[0052] Example 2: Acquisition of tissue culture seedlings, positive identification and editing detection

[0053] The gene editing vector was transferred into the recipient material R10 (BnaALS1) by Agrobacterium-mediated genetic transformation of Brassica napus hypocotyls. P197S ), for specific methods, please refer to this laboratory paper (Liu et al., 2021, doi:10.3389 / fpls.2021.732733). After the tissue culture regenerated seedlings were transplanted into the soil and grew normally, the young leaves were taken and genomic DNA was extracted using the 2% CTAB method. Subsequently, the vector-specific primers M13F (GGTAACGCCAGGGTTTTCC) and sgRNA-R (AAACGGATGGTCATGCAATGGGAC) were used for PCR positive detection. PCR system, PCR mix (Novozymes, product number P112) 10μL: M13F (10μM, GGTAACGCCAGGGTTTTCC) 0.5μL + sgRNA-R (10μM, AAACGGATGGTCATGCAATGGGAC) 0.5μL + H2O 8μL + DNA template (50ng / μL) 1μL. PCR reaction: 95°C for 7 minutes, 95°C for 25 seconds, 56°C for 25 seconds, 72°C for 25 seconds, 34 cycles, 72°C for 5 minutes. Agarose gel electrophoresis was then performed, and 12 of the 13 tissue culture seedlings were positive, with a positive rate of 92.3%.

[0054] We then performed editing tests on the positive plants we obtained. We used BnaALS1-specific primers to amplify the target site (F: CTGCGATTGGAGCGTCTGTG; R: TGAACATGACAATCACACCC). The amplified product was then subjected to Sanger sequencing. Based on the sequencing peaks, we found that a total of 7 T0 generation plants had the expected T>C mutation at the 5th nucleotide position of the target site, with a mutation rate of 58.3% ( Figure 2 ). We then used TA cloning sequencing to further determine the mutation type of the edited strain. P182S BnaALS1 mutants were obtained based on P182S W474R Double-site linked mutation material.

[0055] Example 3: BnaALS1 P182S W474RIdentification of mutants resistant to bensulfuron-methyl and imazethapyr

[0056] The homozygous mutant strain BnaALS1 obtained in Example 2 P182S W474R The leaves of T1 plants were self-pollinated using bagging, and DNA from the leaves of T1 plants was amplified by PCR and Sanger sequencing using specific primers (F:CTGCGATTGGAGCGTCTGTG; R:TGAACATGACAATCACACCC), confirming that they were homozygous mutants with double-site mutations. P182S W474R Homozygous mutant, BnaALS1 P197S Ten plants of each homozygous mutant (R10) and wild-type control J9712 were sprayed with bensulfuron-methyl. 12 mg ai / L bensulfuron-methyl (10% wettable powder, Zhengzhou Laien Ping'an Garden Plant Protection Co., Ltd.) was sprayed at the 5-6 leaf stage, with 20 mL sprayed per plant. This dosage is roughly equivalent to 4 times the recommended concentration for controlling broadleaf weeds in the field. After 20 days, BnaALS1 P182S W474R No material was affected, BnaALS1 P182S A small number of leaves of the material showed slight phytotoxicity, while the new leaves of the wild type of the transgenic receptor material turned yellow and were severely phytotoxic. Figure 3 The above results indicate that BnaALS1 P182S W474R It has strong resistance to bensulfuron-methyl herbicide and is slightly stronger than BnaALS1. 1827S .

[0057] BnaALS1 P182S W474R 、BnaALS1 P182S Ten plants of each type were sprayed with imidacloprid. 100 mg ai / L (10% aqueous solution, Jiangsu Ruibang Agrochemical Co., Ltd.) was sprayed at the 5-6 leaf stage, with 10 ml sprayed per plant. This dosage is roughly equivalent to 1 times the recommended concentration for controlling broadleaf weeds in the field. After 20 days, BnaALS1 P182S W474R were not affected, while BnaALS1 P182S and the wild type with yellowing of new leaves, which were seriously damaged by the pesticide ( Figure 3 The above results indicate that BnaALS1 P182S W474R It is tolerant to the herbicide imazethapyr.

[0058] Example 4: BnaALS1 W474R Obtaining mutants and identifying resistance to bensulfuron-methyl and imazethapyr

[0059] Using the method of Example 2, we transferred the base editing vector constructed in Example 1 into the recipient wild type J9712. 68 positive plants were obtained through tissue culture and positive identification. After mutation detection, it was found that the mutation rate of the BnaALS1 target site was 41.2% (28 / 68). Subsequently, BnaALS1 was obtained through self-fertilization. W474R Homozygous mutant.

[0060] BnaALS1 P182S W474R Homozygous mutant, BnaALS1 W474R Homozygous mutants and wild-type control J9712 were potted in a pot experiment. The greenhouse conditions were: 16h light / 8h dark photoperiod, light temperature of 24°C, dark temperature of 20°C, and relative humidity of 65%. When the rapeseed developed to the 5-6 leaf stage, 10 plants of each material were sprayed with bensulfuron-methyl and imidacloprid. The spraying concentration of bensulfuron-methyl was 6mg ai / L (10% wettable powder, Zhengzhou Laien Ping'an Garden Plant Protection Co., Ltd.), and 20mL was sprayed on each plant (equivalent to twice the recommended concentration for controlling broadleaf weeds in the field). After 14 days, BnaALS1 P182S W474R Material growth was almost unaffected, BnaALS1 W474R The new leaves of the material turned yellow, and the resistance was weak, while the wild type J9712 material was more seriously damaged by the drug ( Figure 4 ). The above results show that BnaALS1 P182S W474R The resistance to bensulfuron-methyl is strong, BnaALS1 W474R The material has only weak resistance to bensulfuron-methyl.

[0061] The treatment concentration of imazethapyr was 100 mg ai / L (10% aqueous solution, Jiangsu Ruibang Agrochemical Co., Ltd.), and 10 ml was sprayed on each plant. This dosage is roughly equivalent to 1 times the recommended concentration for controlling broadleaf weeds in the field. After 14 days, BnaALS1 P182S W474R Showing significant drug resistance, BnaALS W474 Has a certain degree of drug resistance, but weaker than BnaALS1 P182S W474R , while the wild type was severely damaged by the drug ( Figure 4 The above results indicate that BnaALS1 P182S W474R It is tolerant to imazethapyr herbicide and is stronger than BnaALS. W474 .

Claims

1. BnaALS1 linked mutant protein, characterized in that In the BnaALS1 linked mutant protein, the 182nd position of the rapeseed wild-type BnaALS1 protein is mutated from proline to serine and the 474th position is mutated from tryptophan to arginine.

2. A BnaALS1 Linked mutant gene, characterized by It encodes the BnaALS1 linked mutant protein according to claim 1.

3. according to claim 2 BnaALS1 A linked mutant gene, characterized in that described BnaALS1 Linked mutant gene in rapeseed wild type BnaALS1 The 544th position of the gene mutated from C to T, and the 1420th position mutated from T to C.

4. An expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium, characterized in that: It contains the mutant gene according to claim 2 or 3.

5. The sgRNA based on the mutant gene according to claim 2, characterized in that The sgRNA sequence is shown as SEQ ID NO.

3.

6. The gene editing vector based on the mutant gene according to claim 2, characterized in that: The gene editing vector is obtained by connecting the sgRNA described in claim 5 into the editing vector.

7. The BnaALS1 linked mutant protein according to claim 1, or the BnaALS1 linked mutant protein according to claim 2 or 3 BnaALS1 Use of a linked mutant gene, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria according to claim 4, and the sgRNA based on the mutant gene according to claim 5 in cultivating plants with herbicide resistance.

8. A method for obtaining herbicide-resistant plants based on gene editing, characterized in that: The method comprises the following steps: achieving the plant's BnaALS1 The 544th base of the gene was edited to replace C with T, resulting in the mutation of proline at position 182 encoding the BnaALS1 protein to serine; at the same time, the adenine editor was used to complete the base editing of T>C at position 1420, causing the tryptophan at position 474 to arginine.

9. The method for obtaining herbicide-resistant plants based on gene editing according to claim 8, characterized in that: The plants include rapeseed.

10. The method for obtaining herbicide-resistant plants based on gene editing according to claim 8, characterized in that: The herbicide comprises one or both of bensulfuron-methyl and imazethapyr.

Citation Information

Patent Citations

  • Sulfonylurea herbicide tribenuron-methyl resisting gene of brassica napus and application

    CN106754997A

  • Herbicide-tolerant plants

    CN107418969A

  • BnALS1 mutant gene and protein based on gene editing and application of BnALS1 mutant gene and protein

    CN111118060A

  • Acetolactate synthase mutant protein with herbicide resistance and application thereof

    CN111690625A