Preparation method of OPG gene knockout non-human animal model

Abstract

The invention relates to a preparation method of a gRNA and OPG gene knockout non-human animal model of a targeted non-human animal OPG gene. The preparation method of the OPG gene knockout non-human animal model comprises the following steps: a non-human animal OPG gene is destroyed by using a gene editing technology, and gRNA for targeting the non-human animal OPG gene comprises one or two of SEQ ID NO: 1 and / or SEQ ID NO: 2. The gRNA specifically targeting the OPG gene of the non-human animal is designed, and the OPG gene is knocked out by using Cas9 protein to cause frameshift mutation, so that the purpose of performing gene knockout on the non-human animal is achieved. The method for modifying the OPG gene of the non-human animal is simple and easy to implement and short in period, the OPG model constructed by the method provides a basis for researching the physiological mechanism and the molecular mechanism of the OPG gene, and meanwhile, an important tool is provided for researching the pathogenesis of osteoporosis and developing medicines.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for preparing an OPG gene knockout non-human animal model. Background Art

[0002] Osteoporosis, also known as osteoporotic bone disease, is a systemic, multi-skeletal disease characterized by relatively low cartilage mass, which is susceptible to microscopic structural brittle damage. This damage leads to significantly increased cartilage brittleness and recurrent soft bone fractures. According to a European and American survey, the number of people suffering from chronic osteoporosis in my country and around the world has exceeded 1.02 billion, and this number is expected to rise to 1.36 billion in the next 20 years. As a biological tissue, bone is constantly formed and resorbed, and the balance between osteoblasts and osteoclasts influences bone health. Osteoprotegerin (OPG), an osteoclastogenesis inhibitor, affects the balance between osteoblasts and osteoclasts primarily through two mechanisms. First, it directly inhibits the action of osteoclasts (OCs) by regulating the expression of proteases and their inhibitors. Second, it forms the OPG / RANK / RANKL signaling pathway, together with the receptor activator of nuclear factor-κB (RANK) and the receptor activator of nuclear factor-κB ligand (RANKL). Binding of RANK and RANKL stimulates OC differentiation and maturation, while OPG competitively binds to RANKL, inhibiting normal OC differentiation. This in turn reduces bone resorption, disrupts the balance between osteoblasts and osteoclasts, and contributes to the development of osteoporosis. Therefore, animal models with OPG gene mutations will provide powerful experimental tools for the study and treatment of human osteoporosis.

[0003] In view of this, the present invention is proposed. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for preparing an OPG gene knockout non-human animal model, which can be used to prepare an OPG gene knockout non-human animal model.

[0005] In a first aspect of the present invention, a gRNA targeting the OPG gene of a non-human animal is provided, wherein the nucleotide sequence of the gRNA is one or both of SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0006] Specifically, the gRNA includes a nucleotide sequence that is partially complementary to the OPG gene of a non-human animal.

[0007] Specifically, the non-human animal OPG gene is shown as SEQ ID NO:3.

[0008] The second aspect of the present invention provides a method for preparing an OPG gene knockout non-human animal model, comprising the following steps: using gene editing technology to destroy the OPG gene of the non-human animal, and the gRNA used to target the OPG gene of the non-human animal includes one or both of SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0009] Preferably, the gene editing technology adopts: any one of zinc finger nuclease-based gene editing technology, TALEN gene editing technology or CRISPR / Cas9 gene editing technology; more preferably, the gene editing technology is CRISPR / Cas9 gene editing technology.

[0010] Those skilled in the art will understand that, after knowing the efficient gene editing region (in this application, the non-human animal OPG gene), those skilled in the art can use any gene editing method, such as zinc finger nuclease-based gene editing technology, TALEN gene editing technology and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology, as well as other gene editing methods discovered in the future, to edit the known efficient gene editing region, optimize the gene editing conditions, and achieve the purpose of efficient editing. Therefore, this application covers the technical solution of knocking out the non-human animal OPG gene identified in this application by any available gene editing method.

[0011] Preferably, the method for preparing the OPG gene knockout non-human animal model comprises the following steps:

[0012] preparing a gene editing solution comprising Cas9 and a gRNA for targeting the OPG gene of a non-human animal;

[0013] delivering gene editing fluid into fertilized eggs of non-human animals;

[0014] The delivered fertilized eggs were cultured and then transplanted into pseudo-pregnant mice to obtain an OPG gene knockout non-human animal model.

[0015] Preferably, the method further comprises the following step: mating the OPG gene knockout non-human animal model to obtain heterozygous or homozygous offspring.

[0016] Preferably, the delivered fertilized eggs are cultured until they reach two cells and then transplanted into pseudo-pregnant mice.

[0017] Preferably, the gene editing solution is delivered into the fertilized egg of a non-human animal by electrofection. The specific operation of electrofection is known in the art.

[0018] Specifically, the gene editing fluid can be prepared by various methods known in the art.

[0019] Preferably, the molar ratio of Cas9 and gRNA in the gene editing solution is (2-3): (2-5), for example, it can be 1:1, 2:2.5, 2:3, 2:3.5, 1:2, 2:4.5, 2:5, 2.5:2, 2.5:3, 2.5:3.5, 2.5:4, 2.5:4.5, 3:2, 3:2.5, 3:3.5, 3:4, 3:4.5, 3:5, etc.

[0020] Preferably, the gRNA used to target the OPG gene of a non-human animal is a gRNA obtained after screening and confirmation of the knockout efficiency.

[0021] Preferably, the screening of knockout efficiency includes the following steps: constructing the designed gRNA into a vector backbone, delivering it to the recipient cell, and then screening to obtain gRNA with high knockout efficiency.

[0022] Preferably, the drug is delivered to the recipient cells by liposome transfection.

[0023] Preferably, the vector backbone comprises any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the vector backbone is PX459.

[0024] The third aspect of the present invention provides an OPG gene knockout non-human animal model, which is obtained using the above-mentioned method for preparing the OPG gene knockout non-human animal model.

[0025] Preferably, the non-human animal in the present invention is a mouse.

[0026] In a fourth aspect of the present invention, a method for preparing an OPG gene knockout mouse model is provided, wherein the mouse OPG gene is destroyed using CRISPR / Cas9 gene editing technology, and the gRNA used to target the mouse OPG gene includes one or both of SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0027] In one embodiment, the gRNA used to target the mouse OPG gene is shown as SEQ ID NO: 2.

[0028] In one specific embodiment, the mouse is a C57BL / 6J mouse.

[0029] Specifically, the method for preparing the OPG gene knockout mouse model includes the following steps:

[0030] Prepare a gene editing solution containing Cas9 and gRNA targeting the mouse OPG gene;

[0031] Electroporation of gene editing solution into mouse fertilized eggs;

[0032] The electro-transfected fertilized eggs were cultured to two cells and transplanted into pseudo-pregnant mice to obtain the F0 generation of OPG gene knockout mice;

[0033] F0 generation mice were crossed with wild-type mice to obtain F1 generation heterozygous mice, and the F1 generation heterozygous mouse father and F1 generation heterozygous mouse mother were crossed to obtain F2 generation homozygous mice. The OPG gene knockout homozygous mouse model was obtained through phenotypic identification.

[0034] Specifically, preparing a gene editing solution containing Cas9 and a gRNA for targeting the mouse OPG gene includes the following steps: synthesizing a gRNA for targeting the mouse OPG gene; and mixing the gRNA and Cas9 to obtain a gene editing solution.

[0035] Specifically, the synthesis of the gRNA and Cas9 can be performed by methods known in the art.

[0036] Preferably, the gRNA used to target the mouse OPG gene is the gRNA of the OPG gene obtained by screening and confirming the knockout efficiency using mouse cells.

[0037] Preferably, screening the knockout efficiency using mouse cells comprises the following steps:

[0038] The designed gRNA was constructed into the vector backbone PX459 and transfected into mouse cells by liposomes;

[0039] Puromycin was used for screening to obtain a gRNA with high knockout efficiency as the gRNA for the OPG gene obtained after screening and confirmation.

[0040] Preferably, the mouse cells are B16 cells (mouse melanoma cells).

[0041] In a fifth aspect, the present invention provides an OPG gene knockout mouse model, which is obtained using the above-mentioned method for preparing the OPG gene knockout mouse model.

[0042] In a sixth aspect, the present invention provides a vector comprising: a vector skeleton and the above-mentioned gRNA.

[0043] Preferably, the vector backbone comprises any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the vector backbone is PX459.

[0044] Preferably, the vector sequence is shown as SEQ ID NO: 10 and / or SEQ ID NO: 11.

[0045] In a seventh aspect, the present invention provides a cell, tissue or organ, wherein the cell, tissue or organ is derived from a non-human animal model obtained by the above-mentioned preparation method.

[0046] The eighth aspect of the present invention provides the use of the non-human animal model obtained by the above-mentioned method for preparing the OPG gene knockout non-human animal model, and the above-mentioned cells, tissues or organs in model systems for pharmacology, neurology, immunology, microbiology and medical research.

[0047] The present invention has at least the following beneficial effects:

[0048] The technical solution of the present invention achieves the purpose of gene knockout in non-human animals by designing two gRNAs that specifically target the OPG gene in non-human animals and using the Cas9 protein to knock out the OPG gene, causing a frameshift mutation. The method of the present invention for modifying the OPG gene in non-human animals is simple and easy, with a short cycle time. The OPG model constructed using this method provides a basis for studying the physiological and molecular mechanisms of the OPG gene, and also provides an ideal animal model for studying the pathogenesis of osteoporosis and screening new drugs and new therapies. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0050] Figure 1 This is the single nucleotide polymorphism detection result of the OPG gene target provided by the present invention, wherein M is D2000Maker, and the bands are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp respectively.

[0051] Figure 2 This is the identification result of the OPG gene knockout mouse melanoma cells provided by the present invention.

[0052] Figure 3This is the OPG genotype identification of the F2 generation mice provided by the present invention. DETAILED DESCRIPTION

[0053] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0054] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular also includes the plural. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0055] definition

[0056] As used herein, the terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides) of any length or their analogs. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of genes or gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, nucleic acid probes, and primers. One or more nucleotides in a polynucleotide may be further modified. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may also be modified after polymerization, for example, by coupling with a labeling agent.

[0057] The term "CRISPR / Cas9" used in this article refers to an adaptive immune defense developed by bacteria and archaea over a long period of evolution to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technique for making specific DNA modifications to targeted genes. CRISPR / Cas9-based gene editing technology has shown great promise in a range of gene therapy applications, such as blood disorders, tumors, and other genetic diseases. This technology has been applied to the precise modification of the genomes of human cells, zebrafish, mice, and bacteria.

[0058] As used herein, the terms "gRNA," "guide RNA," and "CRISPR guide sequence" are used interchangeably throughout and refer to nucleic acids comprising a sequence that determines the specificity of the Cas binding protein of the CRISPR / Cas system. The gRNA hybridizes (partially or fully complementary) to a target nucleic acid sequence in the genome of the host cell. The length of the gRNA or portion thereof that hybridizes to the target nucleic acid may be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.

[0059] The term "gRNA" as used herein generally refers to a single-molecule guide RNA or single-stranded guide RNA in the artificial CRISPR / Cas9 system, which refers to the RNA that guides the Cas protein to specifically bind to the target DNA sequence and is an important component of the CRISPR gene knockout / knock-in system. The gRNA of the present application comprises a guide sequence that targets the target sequence. In a preferred embodiment, the sgRNA of the present application further comprises a tracrRNA sequence and a crRNA sequence.

[0060] The term "guide sequence" as used herein refers to a sequence of approximately 17-20 bp that specifies a target site and is used interchangeably with "guide sequence" or "spacer." In the context of forming a CRISPR complex, a "target sequence" is a sequence to which a guide sequence is designed to be complementary, wherein hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. The hybridization requires that the "target sequence" and the "guide sequence" or "guide sequence" have sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex; complete complementarity is not required.

[0061] "Complementary" means that the "guide sequence" or "guide sequence" and the target nucleotide sequence (the target knockout mouse OPG gene in this application) can hybridize through the nucleotide pairing principle discovered by Watson and Crick. It will be understood by those skilled in the art that as long as there is sufficient complementarity, the "guide sequence" can hybridize with the target nucleotide sequence without the need for 100% complete complementarity between them. In some embodiments, when optimally aligned using an appropriate alignment algorithm, the degree of complementarity between the guide sequence and its corresponding target sequence may be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Optimal alignment can be determined using any appropriate algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, an algorithm based on the Burrows-Wheeler Transform, and the like.

[0062] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (including hybridization of a guide sequence to a target sequence and complexing with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from the target sequence). Without wishing to be bound by theory, a tracr sequence that can comprise all or a portion of a wild-type tracr sequence (e.g., about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85, or more nucleotides of a wild-type tracr sequence) or consisting of the above can also form part of a CRISPR complex, for example, by hybridizing along at least a portion of the tracr sequence to all or a portion of a crRNA sequence operably linked to a guide sequence.

[0063] In some embodiments, the tracr sequence has sufficient complementarity with the crRNA sequence to hybridize and participate in the formation of the CRISPR complex. Similar to the hybridization of a "target sequence" and a "guide sequence" or "guide sequence", complete complementarity is not required, as long as it is sufficient to perform its function. In some embodiments, under optimal alignment, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complementarity along the length of the crRNA sequence.

[0064] As used herein, the term "gene knockout" or "knockout" refers to editing the gene in the cell (for example, inserting, replacing, and / or deleting the gene) so that the gene loses its original function (for example, it cannot express a functional protein). Various known molecular biology techniques can be used (for example, using gene editing technology based on zinc finger nucleases, TALEN gene editing technology, and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology) to edit the gene in the cell genome. Gene knockout is not limited to the complete deletion or removal of the entire gene, as long as the gene loses its original function. For example, by inserting an exogenous DNA fragment in the gene, the gene cannot express a functional protein, or by inserting or deleting one or more bases in the gene, the gene is subjected to a frameshift mutation to achieve the knockout of the gene. For example, CRISPR / Cas9 gene editing technology can be used in the gene knockout of the present application.

[0065] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by the inserted polynucleotide, it is referred to as an expression vector. A vector can be introduced into a host cell via transformation, transduction, or transfection, allowing the genetic material it carries to be expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages, such as lambda phage or M13 phage, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomas (such as SV40). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain an origin of replication.

[0066] As used herein, the term "delivery" refers to the introduction of biomacromolecules such as nucleic acids and proteins from outside the cell membrane into the cell membrane through certain pathways. Examples of "delivery" include electrofection, lipofection, lipid-nanoparticle delivery, viral delivery, and exosome delivery.

[0067] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0068] Example

[0069] Instruments used in this experiment:

[0070] The equipment included a stereoscope (Olympus, SZX7), a 37°C 5% CO2 incubator (Sanyo, MCO15A), an inverted fluorescence microscope (Olympus, IX73), a hot stage (THERMOPLATE), an electroporator (BEX, CUY21 EDIT II), a ProFlex PCR System (Thermo Fisher, ProFlex 3×32well PCR system), a gel imager (BiO-RAD, Universal Hood II), an electrophoresis apparatus (BiO-RAD, PowerPacTM Basic), a CO2 constant temperature incubator (Rayward, D180-P), a constant temperature low-speed centrifuge (Eppendorf, 5702R), an inverted fluorescence microscope (Olympus, IX51), a constant temperature water bath (Shanghai Senxin, DKS24), a cell counter (Rayward, C100), and a double-person biological safety cabinet (Shandong Boco, BSC-1360IIA2).

[0071] Reagents used in this experiment:

[0072] BPiI (Thermo Fisher Scientific, ER0291), MinElute PCR Purification Kit (QIAGEN, 2084), T4 DNA Ligase kit (Novozyme, C301), Phanta Max Super-Fidelity DNA Polymerase (Novozyme, P505), MinElute PCR Purification Kit (QIAGEN, Germany, 28004), AgeI (Western enzyme, SE1464S), hyaluronidase (Nanjing Aibei, M2215), M2 culture medium (Sigma, M7167), tissue culture oil (SAGE, ARF4008P-5P), pregnant mare serum hormone PMSG (Ningbo Sansheng Biological), human chorionic gonadotropin hCG (Ningbo Sansheng Biological), PBS solution (Solaibao, P1010), TSINGKE TSE030 T3 Super PCR Mix (TSINGKE, TSE030), Mini-prep Kit (TIANGEN, DP118), Agarose Rapid Gel Extraction Kit (Generay, GK7045-200), PCR Product Purification Kit (Generay, GK2052-100), 5 min TA / Blunt-Zero Cloning Kit (Novagene, C601), DMEM (Gibico, C11995500BT), Serum (Anwei, F0601), Penicillin-Streptomycin (Pusitang, PS0526), ​​Transfection Reagent (Biyuntian, C0533), Puromycin (Gibico, A11138), Trypsin-EDTA (0.25%) (Thermo, 25200056), SpyCas9 NLS (NEB, M0646T).

[0073] 1. gRNA design

[0074] Two gRNAs were designed for knockout of the mouse OPG gene (SEQ ID NO: 3), namely gRNA1 and gRNA2.

[0075] Among them, the sequence of gRNA1 is: ACCACTCTTATACGGACAGC (SEQ ID NO: 1)

[0076] The sequence of gRNA2 is: GTGTGAGGAAGGGCGTTACC (SEQ ID NO: 2)

[0077] 2. Target single nucleotide polymorphism detection

[0078] Using NCBI Primer-BLAST, a pair of primers was designed to amplify all gRNAs (gRNA1, gRNA2). No nonspecific bands were generated after amplifying the genome to be edited using these primers. The sequence of the forward primer was GTGGTTAGTGACTTTTGGCTC (SEQ ID NO: 4), and the sequence of the reverse primer was CTTTGGAAACAATCCAGACACA (SEQ ID NO: 5). The amplified products were subjected to 1% agarose gel electrophoresis and sequencing. The results of agarose gel electrophoresis were as follows: Figure 1 As shown in the figure, M represents the D2000 marker, and the bands are 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp, respectively. Electrophoresis results showed a target band of 594 bp, and no primer-specific bands were observed. The PCR stock solution containing the target band was sent to the company for sequencing, which revealed no single nucleotide mutation at the gRNA location.

[0079] 3. Plasmid construction

[0080] The following gRNA-F and gRNA-R synthesized by Qingke were mixed and annealed according to the procedure in Table 1. The BPiI cloning site was selected and the PX459 vector was linearized using the enzyme digestion method. The enzyme digestion system is shown in Table 2. The ligation products were ligated according to the enzyme ligation system in Table 3. The ligation products were transformed, plated, and single clones were selected. Finally, the successful construction of the vector PX459-gRNA was confirmed by bacterial culture PCR.

[0081] gRNA1-F: CACCGACCACTCTTATACGGACAGC (SEQ ID NO: 6); gRNA1-R: AAACGCTGTCCGTATAAGAGTGGTC (SEQ ID NO: 7); gRNA1-F and gRNA1-R anneal to generate sticky ends that link to the sticky ends on PX459 to form PX459-gRNA1.

[0082] gRNA2-F: CACCGGTGTGAGGAAGGGCGTTACC (SEQ ID NO: 8); gRNA2-R: AAACGGTAACGCCCTTCCTCACACC (SEQ ID NO: 9); gRNA2-F and gRNA2-R anneal to generate sticky ends that link to the sticky ends on PX459 to form PX459-gRNA2.

[0083] Table 1 gRNA annealing program

[0084]

[0085] Table 2 PX459 vector enzyme digestion system

[0086]

[0087] Table 3 Enzyme-linked system

[0088]

[0089] 4. Carrier efficiency identification

[0090] The PX459-gRNA1 vector (SEQ ID NO: 10) and PX459-gRNA2 (SEQ ID NO: 11) vectors were transfected into mouse melanoma cells (B16), and puromycin was added for selection and culture after 48 hours. After another 48 hours, the cells were extracted for PCR amplification, and the PCR products were identified by 1% agarose gel electrophoresis. The vector efficiency identification results are shown in Figure 2. Figure 2 As shown, the results showed that gRNA2 had higher knockout efficiency.

[0091] 5. Preparation of gene editing fluid

[0092] Synthesize gRNA2 and Spy Cas9 NLS and gRNA2 were mixed at a molar ratio of 3:2 and Opti-MEM culture medium was added according to volume to prepare the gene editing solution.

[0093] 6. Gene editing fluid is delivered to the fertilized egg

[0094] 6.1 Superovulation in Female Mice

[0095] PMSG and hCG were diluted to 50 IU / ml and injected intraperitoneally into 4-week-old C57BL / 6J female mice with 10 IU of PMSG per mouse. Forty-eight hours after PMSG injection, hCG was injected intraperitoneally with 10 IU per mouse. Immediately after hCG injection, the mice were caged with the male mice, with one male mouse and one female mouse in the same cage.

[0096] 6.2. Culture droplet preparation

[0097] Hyaluronidase digestion droplets: Prepare one 200 μL hyaluronidase droplet in a 35 mm culture dish, prepare five 50 μL M2 culture drops around it, cover with mineral oil, and preheat in a 37°C incubator overnight.

[0098] M2 culture drops: Prepare 100 μL M2 culture drops in 35 mm culture dishes, cover with mineral oil, and preheat in a 37°C incubator overnight.

[0099] 6.3 Electrotransfection

[0100] The next morning after rehousing, examine the vaginal plug and remove any female mice with plugs. Female mice were sacrificed by cervical dislocation, and the dorsal region was dissected to expose the uterus, fallopian tubes, and ovaries. The fallopian tubes were removed. Fat and blood were removed on paper. The dilated portion of the fallopian tube was ruptured in a drop of digestive oil and the oocytes containing cumulus cells were pulled into hyaluronidase. After 1-2 minutes, the culture dish was shaken clockwise 8-10 times. After digestion, the eggs were removed and washed three times in an M2 culture drop. They were then incubated in M2 medium for at least 2 hours in preparation for electrofection. 5 μL of gene editing solution was added to the gap between the platinum plates of the electrodes. The fertilized eggs were then transferred to Opti-MEM medium, washed three times, and then transferred to gene editing solution for electrofection. After electrofection, the fertilized eggs were washed three times in M2 medium and transferred to an M2 culture drop. The eggs were cultured overnight at 37°C in a 5% CO2 incubator until they reached two cells. The next day, the eggs were transplanted into the oviducts of surrogate mothers. After birth, the tails of the mice were removed for identification.

[0101] 7. Genotype identification of OPG gene knockout mice

[0102] After the F2 generation mice were born 5 days later, 0.5 cm of the mouse tail was collected and placed in a sterile centrifuge tube. After lysis, the crude DNA of the mouse tail was extracted. Using the mouse tail DNA as a template, PCR amplification was performed using the target single nucleotide identification primers. The amplification system is shown in Tables 4 and 5. The amplified products were identified by 1% agarose gel electrophoresis and sequenced. The agarose gel electrophoresis and sequencing results are shown in Tables 4 and 5. Figure 3 As shown, agarose gel electrophoresis revealed that mice 1-8 had only one band, and sequencing results indicated that mice 1 and 2 were homozygous mice with a 2bp deletion in the OPG gene, and the OPG gene knockout mouse model was successfully constructed.

[0103] Table 4 PCR reaction system

[0104]

[0105] Table 5 Nested PCR reaction system

[0106]

[0107]

[0108] The present invention uses CRISPR / Cas9 technology to establish an OPG gene knockout mouse model and form a stably inherited OPG gene knockout mouse population. This mouse model provides a basis for studying the physiological and molecular mechanisms of the OPG gene, and also provides an important tool for studying the pathogenesis of osteoporosis and drug development.

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A gRNA targeting the OPG gene of a non-human animal, characterized in that The nucleotide sequence of the gRNA is one or both of those shown in SEQ ID NO: 1 and / or SEQ ID NO:

2.

2. A method for preparing an OPG gene knockout non-human animal model, characterized in that: The method comprises the following steps: using gene editing technology to destroy the OPG gene of non-human animals, and the gRNA used to target the OPG gene of non-human animals includes one or both of SEQ ID NO: 1 and / or SEQ ID NO:

2.

3. The method for preparing an OPG gene knockout non-human animal model according to claim 2, characterized in that: The gene editing technology adopts: any one of zinc finger nuclease-based gene editing technology, TALEN gene editing technology or CRISPR / Cas9 gene editing technology.

4. The method for preparing an OPG gene knockout non-human animal model according to claim 2, wherein: The steps include: preparing a gene editing solution comprising Cas9 and a gRNA for targeting the OPG gene of a non-human animal; delivering gene editing fluid into fertilized eggs of non-human animals; The delivered fertilized eggs were cultured and then transplanted into pseudo-pregnant mice to obtain an OPG gene knockout non-human animal model.

5. The method for preparing an OPG gene knockout non-human animal model according to claim 4, characterized in that: The molar ratio of Cas9 to gRNA in the gene editing solution is (2-3):(2-5).

6. The method for preparing an OPG gene knockout non-human animal model according to claim 4, characterized in that: The method further comprises the following steps: mating the OPG gene knockout non-human animal model to obtain heterozygous or homozygous offspring.

7. The method for preparing an OPG gene knockout non-human animal model according to claim 2, characterized in that: The gRNA used to target the OPG gene of non-human animals is a gRNA obtained after screening and confirmation of the knockout efficiency. The screening of the knockout efficiency includes the following steps: constructing the designed gRNA into the vector skeleton, delivering it to the recipient cell, and then screening to obtain a gRNA with high knockout efficiency.

8. A carrier, characterized in that include: A vector backbone and the gRNA according to claim 1.

9. A cell, tissue or organ, characterized in that: The cells, tissues or organs are derived from a non-human animal model obtained by the preparation method according to any one of claims 2-7.

10. Use of the non-human animal model obtained by the method for preparing the OPG gene knockout non-human animal model according to any one of claims 2 to 7, and the cells, tissues or organs according to claim 9 in model systems for pharmacological, neurological, immunological, microbiological and medical research.

Images