Double promoter sequence for balancing galP and glk gene expression and application thereof in L-tryptophan synthesis process

Abstract

The invention discloses a double promoter sequence for balancing galP and glk gene expression and an application of the double promoter sequence in an L-tryptophan synthesis process. According to the promoter combination, double-gene expression vectors of Ptac-galP and Pj23119-glk are constructed, basic groups are designed and merged, so that the-35 to-10 regions of the promoters for regulating and controlling the two genes are subjected to random replacement of the basic groups, and a pair of promoter combinations with relatively good expression balance is obtained by combining fluorescence high-throughput screening. Compared with an initial promoter combination, the combination can remarkably improve the sugar transport efficiency of escherichia coli, so that the efficiency of producing L-tryptophan by PTS defective escherichia coli is improved. The technology has important social and economic values.

Description

Technical Field

[0001] The present invention relates to a dual promoter sequence for balancing the expression of galP and glk genes and application thereof in the L-tryptophan synthesis process, belonging to the technical field of synthetic biology and metabolic engineering. Background Art

[0002] Escherichia coli is a Gram-negative bacterium commonly used in bioengineering research. Due to its advantages, such as simple culture medium requirements, robust fermentation, rapid growth and reproduction, rich genomic information, and comprehensive gene editing tools, it has become the most commonly used strain for biofermentation. Among them, E. coli is the most commonly used for L-tryptophan fermentation production. The biosynthesis of L-tryptophan in E. coli depends on five key precursors: phosphoenolpyruvate (PEP), erythrose 4-phosphate (E4P), 5-phosphoribosylpyrophosphate (PRPP), L-serine, and L-glutamine. Enhancing the supply flux of these precursors through metabolic engineering strategies is a key regulatory target for achieving efficient L-tryptophan biosynthesis.

[0003] PEP, as a key intermediate metabolite of EMP, plays an important role in the growth metabolism of Escherichia coli. Studies have shown that the glucose phosphotransferase system (PTS) is the main consumption pathway of PEP, which mediates the transmembrane transport of glucose through phosphorylation, consuming most of the PEP reserves in the cell. It is worth noting that only about 1.5% of PEP is used for the biosynthesis of aromatic amino acids. Theoretical calculations show that without modifying the PTS system, the maximum theoretical conversion rate of Escherichia coli to synthesize L-tryptophan from glucose is 0.227g / g. However, by transforming the PTS system through metabolic engineering, PEP can be maximized to flow to the shikimic acid synthesis pathway, which can increase this theoretical value to 0.43g / g, significantly improving the production efficiency of L-tryptophan.

[0004] Therefore, targeted regulation of PEP metabolic flux to increase PEP supply to the shikimate biosynthesis pathway is a key strategy for improving L-tryptophan production and conversion. Typically, researchers knock out or weaken key PTS transport system genes, such as ptsG, ptsH, or ptsI, to inactivate or weaken the PTS transport system and reduce PEP consumption. While weakening or deleting key genes does effectively reduce PEP consumption, the reduced glucose transport efficiency of E. coli due to PTS deficiency severely impacts bacterial growth and metabolism. GalP and Glk are PEP-independent glucose transport systems within E. coli that can transport extracellular glucose into the cell without consuming PEP, making them ideal endogenous alternatives to the PTS. However, the expression of the galP and glk genes must be precisely coordinated; otherwise, their glucose transport efficiency is low, hindering industrial fermentation production of L-tryptophan. Therefore, regulating the expression of galP and glk is highly beneficial for improving industrial L-tryptophan production in PTS-deficient E. coli. Summary of the Invention

[0005] To address the reported imbalance in expression of the galP and glk genes, this study used random base mutations in the -35 to -10 regions of the Ptac and Pj23119 promoters and combined them with a fluorescent sensor coupled to L-tryptophan production to screen out a pair of dual-promoter sequences with relatively balanced expression. This can effectively improve the slow growth and sugar uptake of PTS-deficient Escherichia coli during L-tryptophan fermentation.

[0006] The present invention is achieved through the following technical solutions:

[0007] The first object of the present invention is to provide a dual promoter sequence for balancing the expression of galP and glk genes, wherein the dual promoter sequence comprises a P promoter for regulating the galP gene. tac Promoter sequence and P regulation of glk gene j23119 Promoter sequence.

[0008] In one embodiment of the present invention, the P regulating galP gene tac The nucleotide sequence of the promoter sequence is shown in SEQ ID NO.3.

[0009] In one embodiment of the present invention, the P regulating glk gene j23119 The nucleotide sequence of the promoter sequence is shown in SEQ ID NO.4.

[0010] The second object of the present invention is to provide the use of the dual promoter sequence for balancing the expression of galP and glk genes in L-tryptophan synthesis.

[0011] In one embodiment of the present invention, the application is specifically to regulate the expression of galP gene and glk gene with the dual promoter sequence in PTS-deficient Escherichia coli.

[0012] In one embodiment of the present invention, the PTS-deficient Escherichia coli is a PTS-deficient Escherichia coli that uses a growth-associated promoter to dynamically regulate the expression of the ptsG gene in the Escherichia coli. fliC 、P rpsT P1 or P rrnC P1.

[0013] In one embodiment of the present invention, the Escherichia coli is Escherichia coli JW-5, ΔtrpR, ΔtrpL, ΔtyrR, ΔsdaB::serA fbr ,Δrpnd::BsglnA fbr ,Δmtr::yddG.

[0014] In one embodiment of the present invention, the dual promoter sequence is expressed in an E. coli host by integration expression.

[0015] In one embodiment of the present invention, the dual promoter sequence is expressed at the E. coli pseudogene site yjiV.

[0016] The third object of the present invention is to provide an L-tryptophan production strain, wherein the strain is based on Escherichia coli as a host and promoter P fliC The expression of the ptsG gene in Escherichia coli is dynamically regulated, and the expression of the galP gene and the glk gene is regulated by the double promoter sequence for balancing the expression of the galP and glk genes.

[0017] Beneficial effects of the present invention:

[0018] In this study, we used random base mutation P tac and P j23119 By combining the -35 to -10 region of the promoter with a fluorescent sensor coupled to L-tryptophan production, a pair of dual promoter sequences with balanced expression were screened. This effectively improved the slow growth and sugar uptake of PTS-deficient Escherichia coli during L-tryptophan fermentation. This provides effective guidance for efficient L-tryptophan production in the fermentation industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 The growth status of LT-8 and LT-10 strains in fermentation medium for 12 hours.

[0021] Figure 2 This is the growth condition of the strain in shake flask fermentation after replacing the ptsG promoter.

[0022] Figure 3 The efficiency of L-tryptophan production and sugar uptake in shake flask fermentation of the strain after replacing the promoter.

[0023] Figure 4 RT-qPCR results of the ptsG gene after the strain replaced Pflic.

[0024] Figure 5 Flowchart for promoter library construction and screening.

[0025] Figure 6 is the fluorescence ratio and OD of LT-11-0 and LT-11-G1 600 contrast.

[0026] Figure 7 is the average acid production efficiency of shake flask fermentation of LT-8, LT-11 and LT-14 strains.

[0027] Figure 8 Comparison of sugar uptake rates of LT-8, LT-11 and LT-14. DETAILED DESCRIPTION

[0028] The present invention is further described below in conjunction with specific examples. These implementation cases are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, after reading the content taught by the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims appended hereto.

[0029] In the following examples, unless otherwise specified, the reagents, materials and equipment used can be purchased from commercial sources, or prepared by conventional methods, or are commonly used in the industry.

[0030] Strain JW-5 was disclosed in the applicant's previously published paper Co-ordinated combination of Embden-Meyerhof-Parnas pathway and pentose phosphate pathway in Escherichia coli topromote L-tryptophan production.

[0031] Table 1 Primers used in this study

[0032]

[0033]

[0034]

[0035] Example 1: Knocking out the ptsG gene of Escherichia coli to disrupt the function of the PTS system

[0036] First, the LT-8 strain (LT-8 strain is a recombinant strain obtained by genetic modification based on a mutagenic strain JW-5 that produces L-tryptophan preserved in our laboratory) was used as the starting strain. Its genotype is: JW-5, ΔtrpR, ΔtrpL, ΔtyrR, ΔsdaB::serA fbr ,Δrpnd::BsglnA fbr ,Δmtr::yddG) was used as the basis for knocking out the ptsG gene and obtaining the recombinant strain LT-10. LT-10 was cultured in a shake flask at 36°C and 200 rpm for 12 hours. The bacterial solution was not turbid. The OD600 determination results of LT-10 were as follows. Figure 1 This may be due to the failure of the PTS system, which leads to problems in the bacterial uptake of glucose and severely inhibits the growth of the bacteria.

[0037] Example 2: Dynamically regulating the expression of the ptsG gene using a growth-associated promoter

[0038] In order to alleviate the problem of early growth stunting after the deletion of the ptsG gene, a growth-associated promoter was chosen to dynamically regulate the ptsG gene. Growth-associated promoters are a type of promoter carried by E. coli itself, which can regulate the expression of downstream genes according to the growth status of the strain. In the early growth stage of the strain, the growth-associated promoter can drive the normal expression of downstream genes to meet the growth needs of the bacteria; when the strain grows to a certain stage, the expression of downstream genes gradually weakens or even stops. Based on this characteristic, the goal is to use the growth-associated promoter to regulate the ptsG gene so that it is expressed normally in the early growth stage of the strain, and the expression is reduced or even paused after the bacteria grows to a certain extent, thereby reducing the consumption of PEP in the middle and late stages without affecting the early growth.

[0039] According to literature reports, three growth-associated promoters were selected: P fliC 、P rpsT P1 and P rrnCP1, and using CRISPR-Cas9 technology to replace the promoter of the ptsG gene of the LT-8 strain with the three promoters mentioned above, the recombinant strains LT-11, LT-12, and LT-13 were obtained. Subsequently, the three strains were subjected to shake flask fermentation experiments and cultured in a medium with an initial sugar concentration of 40 g / L until the glucose was exhausted. After the fermentation was completed, the OD of the three strains was measured and calculated. 600 Value, glucose uptake rate and L-tryptophan production. Figure 2 The results showed that the LT-11, LT-12 and LT-13 strains all showed better growth than LT-10, especially LT-11, whose OD 600 The value reached 10.8, which was significantly higher than 1.90 of LT-10, and better than LT-12 (7.99) and LT-13 (7.68). Although the growth level of LT-11 was still significantly lower than that of LT-8, it was significantly improved compared with LT-10. This shows that the use of growth-associated promoters to regulate the ptsG gene is beneficial to the growth of the strain, among which P fliC The LT-11 strain, in which the promoter controlled the ptsG gene, performed best.

[0040] It is worth noting that the L-tryptophan production of the LT-11 strain reached 8.14 g / L, and the conversion rate increased to 20.35%, which was 12.44% higher than that of the LT-8 strain. Figure 3 However, during the fermentation process, the average sugar uptake rate of LT-11 was significantly lower than that of LT-8. Compared with 1.98mmol / g-1(DCW) / h-1 of LT-8, that of LT-11 was only 1.20mmol / g-1(DCW) / h-1, which resulted in a prolonged fermentation time. In summary, the growth-associated promoter P fliC Regulating the expression of the ptsG gene can help increase the production and conversion rate of L-tryptophan in bacteria and significantly improve the growth problems caused by PTS functional defects, but its sugar uptake rate is still lower than normal. fliC To investigate the regulatory effect of the promoter on the ptsG gene, samples were collected at the logarithmic growth phase (7 h) and the stationary phase (20 h), and the transcription level was determined using RT-qPCR technology with the LT-8 strain without ptsG modification as the control. Figure 4 The results showed that the relative transcription level of ptsG in LT-11 strain was 1.86 at 7h, while it dropped to 0.24 at 20h. flic The promoter plays an effective transcriptional regulatory role in the expression of the ptsG gene.

[0041] Example 3: Balancing the expression of galP and glk to improve the sugar capacity of the strain to take up glucose

[0042] Although the LT-11 strain exhibited robust L-tryptophan production and had recovered growth to some extent, its glucose uptake capacity remained significantly lower than that of LT-8. galP and glk, encoding the galactose symporter and glucokinase, respectively, work synergistically to transport extracellular glucose into the cell without consuming PEP. Balancing the expression levels of galP and glk can help improve glucose transport efficiency.

[0043] First, an L-tryptophan biosensor reported by Fang et al. (Intermediate-sensor assisted push–pull strategy and its application in heterologous deoxyviolace in production in Escherichia coli) was constructed. This sensor senses intracellular L-tryptophan concentration and converts it into a fluorescent signal, whose fluorescence intensity increases with increasing L-tryptophan concentration. This sensor is based on the regulatory mechanism of the tnaCBA operon, in which the tnaC gene encodes a ribosome arresting peptide (TnaC) that senses intracellular L-tryptophan concentration and regulates downstream gene expression. In this study, eGFP was linked downstream of the sensor to make the fluorescent protein responsive to changes in L-tryptophan concentration. The constructed L-tryptophan sensor was then loaded into the pACYCDuet-1 plasmid. Subsequently, the T7 promoter and T7 terminator on the plasmid were replaced with the Ptrc promoter and T2 terminator to ensure compatibility with the K12 strain (the strain JW-5 used in this study was obtained by mutagenesis of Escherichia coli K12, which does not contain the T7 RNA polymerase). Finally, the constructed sensor plasmid was named pACYCDuet-trc-Tryptophan sensor. Subsequently, the Ptac promoter (SEQ ID NO.1TTGACAATTAATCATCGGCTCGTATAATG) was used to regulate the expression of galP, and P j23119 The promoter (SEQ ID NO. 2TTGACAGCTAGCTCAGTCCTAGGTATAAT) regulated the expression of glk, and the expression cassettes of the two genes were integrated into the pACYCDuet-trc-Tryptophansensor plasmid, and the obtained plasmid was named pACYCDuet-NonPTS.

[0044] The plasmid was introduced into LT-11, and the obtained recombinant strain was named LT-11-0. Next, primers were designed so that the -35 to -10 regions of the Ptac and Pj23119 promoters were set to degenerate codon N to introduce random base mutations, and DNA fragments with different promoter sequences were assembled into the L-tryptophan sensor plasmid to construct galP and glk promoter libraries. Subsequently, the library was chemically transformed into LT-11, and colonies carrying galP and glk with different expression intensities were screened. Single colonies were selected into 96 deep-well plates and cultured at 300 rpm for 12 hours. After the culture was completed, the bacterial solution was mixed and diluted, and its fluorescence intensity and OD were measured using a multifunctional microplate reader. 600 The specific process is as follows: Figure 5 As shown. LT-11-0 was used as a control to screen the fluorescence intensity and OD 600 The strain with higher fluorescence intensity and OD600 were further optimized by mutation. After multiple rounds of screening, a strain with significantly improved fluorescence intensity and OD600 was obtained and named LT-11-G1. Figure 6 As shown in the figure, the specific fluorescence value of LT-11-G1 increased by 50.42% compared with LT-11-0, and the OD 600 The increase was 27.23%, indicating that the expression levels of galP and glk on the LT-11-G1 plasmid were more adapted to the LT-11 strain. Therefore, the promoters of galP and glk in the LT-11-G1 strain were sequenced, and the results are shown in SEQ ID NO. 3 (TTGACACATCTACTACTGGATGTATAATG) and SEQ ID NO. 4 (TTGACACAGGTCTTCTAAGCAGTTATAAT).

[0045] To verify the effectiveness of this optimization strategy during fermentation, the galP-glk expression cassette carrying the mutant promoter was replaced into the yjiV pseudogene locus of LT-11. The resulting recombinant strain was named LT-14. Subsequently, shake flask fermentations of LT-11 and LT-14 were performed. The inoculum size was 10%. During fermentation, if the fermentation medium showed yellowing, the pH was adjusted with concentrated ammonia until the fermentation broth turned red. Fermentation was terminated when the glucose in the medium was consumed and the bacterial cells began to decompose. The color of the fermentation broth remained unchanged for a long time and began to turn purple. The fermentation medium consisted of 40 g / L anhydrous glucose, 3.0 g / L yeast extract, 1.6 g / L anhydrous ammonium sulfate, 2.0 g / L citric acid, 5.6 g / L anhydrous dipotassium phosphate, 2.0 g / L anhydrous magnesium sulfate, 1 mL / L trace element solution, and 80 mg / L phenol red. The pH of the medium was adjusted to 7 with ammonia. Sterilization was performed at 115°C for 10 min. The formula of the trace element liquid is: 7.6g / L ferrous sulfate heptahydrate, 0.4g / L cobalt chloride hexahydrate, 0.06g / L copper sulfate pentahydrate, 0.64g / L zinc sulfate, 2.0g / L sodium sulfate, and 0.45g / L manganese sulfate monohydrate.

[0046] Fermentation results such as Figure 7 As shown in the figure, the L-tryptophan production efficiency of LT-14 is significantly improved compared with LT-11, which may be due to the non-PTS system accelerating glucose uptake, thereby promoting bacterial growth and improving L-tryptophan production efficiency. Figure 8 As shown, the glucose consumption rate of LT-14 was significantly higher than that of LT-11, proving that the introduction of this promoter regulatory sequence can significantly enhance the glucose uptake level of Escherichia coli.

[0047] The embodiments provided above are not intended to limit the scope of the present invention, nor are the steps described to limit their execution order. Any obvious improvements to the present invention made by those skilled in the art in combination with existing common knowledge shall fall within the scope of protection defined by the claims of the present invention.

Claims

1. A dual promoter sequence for balancing the expression of galP and glk genes, characterized in that The dual promoter sequence includes a P that regulates the galP gene tac Promoter sequence and P regulation of glk gene j23119 Promoter sequence.

2. The dual promoter sequence according to claim 1, characterized in that The P regulating galP gene tac The nucleotide sequence of the promoter sequence is shown in SEQ ID NO.

3.

3. The dual promoter sequence according to claim 1 or 2, characterized in that The P regulating glk gene j23119 The nucleotide sequence of the promoter sequence is shown in SEQ ID NO.

4.

4. Use of the dual promoter sequence for balancing the expression of galP and glk genes according to any one of claims 1 to 3 in L-tryptophan synthesis.

5. The use according to claim 4, characterized in that The application is specifically to regulate the expression of galP gene and glk gene with the dual promoter sequence in PTS-deficient Escherichia coli.

6. The use according to claim 5, characterized in that The PTS-deficient Escherichia coli uses a growth-associated promoter to dynamically regulate the expression of the ptsG gene in Escherichia coli. The growth-associated promoter is P fliC 、P rpsT P1 or P rrnC P1.

7. The use according to claim 6, characterized in that The Escherichia coli is Escherichia coli JW-5, ΔtrpR, ΔtrpL, ΔtyrR, ΔsdaB::serA fbr ,Δrpnd::BsglnA fbr ,Δmtr::yddG.

8. The use according to any one of claims 4 to 7, characterized in that: The dual promoter sequence is expressed in an Escherichia coli host by means of integration expression.

9. The use according to claim 8, characterized in that The dual promoter sequence is expressed at the E. coli pseudogene site yjiV.

10. An L-tryptophan producing strain, characterized in that The strain uses Escherichia coli as the host and promoter P fliC The expression of the ptsG gene in Escherichia coli is dynamically regulated, and the expression of the galP gene and the glk gene is regulated by the double promoter sequence for balancing the expression of the galP and glk genes according to any one of claims 1 to 3.

Images