Wheat Fd gene and application thereof in regulating nitrogen utilization efficiency of wheat under nitrogen deficiency condition
By screening and verifying the Fd gene, negative regulation was used to improve the nitrogen utilization efficiency of wheat under nitrogen-deficient conditions, which solved the problem of poor growth and nitrogen accumulation of wheat under nitrogen-deficient environments and achieved efficient growth and nitrogen accumulation under nitrogen-deficient conditions.
Patent Information
- Application Number
- CN202510739134.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2045-06-04
AI Technical Summary
Wheat has low nitrogen utilization efficiency under nitrogen-deficient conditions, resulting in poor growth and nitrogen accumulation. Existing technologies make it difficult to effectively improve its growth and nitrogen utilization efficiency under nitrogen-deficient environments.
By screening and verifying the Fd gene related to nitrogen deficiency tolerance, negative regulation was used to promote wheat growth and nitrogen accumulation under nitrogen deficiency conditions, including screening the Fd gene TraesCS5B03G1253700 through genome-wide association analysis (GWAS), and verifying its significantly downregulated expression in extreme tolerant lines through RT-qPCR, and further verifying the function of the Fd gene by inducing mutant plants through EMS.
It improves the nitrogen utilization efficiency of wheat under nitrogen deficiency conditions, promotes nitrogen accumulation in the aboveground parts and roots, reduces the root-to-shoot ratio, improves growth performance under nitrogen deficiency conditions, and provides new strategies for breeding and variety identification.
Smart Images

Figure CN120591289A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of bio-agriculture, and particularly relates to a wheat Fd gene and an application thereof in regulating the nitrogen utilization efficiency of wheat under nitrogen deficiency conditions. Background Art
[0002] Wheat (Triticum aestivum L.), as an important staple crop, plays a vital role in the global food supply. High-yield wheat production depends on the input of fertilizers. Among fertilizers, nitrogen is the main nutrient limiting productivity in many ecosystems, as wheat grains (number, size, and protein content) are the main driver of high nitrogen demand. The extensive use of nitrogen fertilizers in wheat production can easily lead to a lack of balance between nitrogen supply and demand. However, wheat plants grown under high nitrogen conditions have relatively low nitrogen use efficiency, suggesting that wheat can use available nitrogen more efficiently and the potential to reduce nitrogen demand while maintaining high yields has not yet been realized. Summary of the Invention
[0003] In view of this, the object of the present invention is to provide a wheat Fd gene, which improves the nitrogen utilization efficiency of wheat plants under nitrogen deficiency conditions through negative regulation.
[0004] The present invention provides an Fd gene related to the nitrogen deficiency tolerance trait of wheat, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0005] The present invention provides the use of the Fd gene in regulating wheat growth and / or nitrogen accumulation under nitrogen deficiency conditions.
[0006] Preferably, the Fd gene promotes the growth and nitrogen accumulation of wheat under nitrogen deficiency conditions through negative regulation.
[0007] The present invention provides an application of detecting the expression level of the Fd gene in distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties.
[0008] Preferably, the reagent for detecting the expression level of the Fd gene includes qPCR primers;
[0009] The qPCR primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3.
[0010] The present invention provides the use of the Fd gene as a target in cultivating or constructing nitrogen deficiency-tolerant wheat varieties.
[0011] The present invention provides an application of inhibiting the expression level of the Fd gene in improving the nitrogen accumulation of wheat under nitrogen deficiency conditions.
[0012] Preferably, the inhibition of Fd gene expression level includes at least one of the following mutations: frameshift mutation of Fd gene caused by insertion or deletion, nonsense mutation of Fd gene caused by insertion or deletion, promoter mutation of Fd gene and enhancer inactivation mutation.
[0013] Preferably, the reagents for inhibiting the expression level of the Fd gene include siRNA, sgRNA, shRNA, and gene derivatives containing any of the above that interfere with the expression of the Fd gene.
[0014] Preferably, the nitrogen deficiency includes a condition where the nitrogen content in the wheat growth environment is lower than 0.4 mM.
[0015] The present invention provides a wheat Fd gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. The present invention screened for a gene Fd related to the nitrogen deficiency tolerance trait by treating 284 natural wheat varieties with normal nitrogen and nitrogen deficiency conditions in combination with genome-wide association analysis (GWAS), and verified by qPCR that the expression level of the Fd gene in wheat extreme tolerance lines and sensitive lines was significantly different, and was significantly down-regulated in the tolerant lines. The present invention further used Fd gene mutant plants for verification, indicating that the mutation of the Fd gene promoted the growth and nitrogen accumulation of wheat under nitrogen deficiency conditions. This indicates that the Fd gene not only responds to wheat nitrogen deficiency stress by down-regulating expression, but also promotes wheat growth and nitrogen accumulation under nitrogen deficiency conditions by negative regulation, thereby improving the nitrogen use efficiency of wheat. It can be seen that the Fd gene provided by the present invention can effectively regulate the growth and nitrogen use of wheat under nitrogen deficiency conditions, provide a new strategy for the construction and breeding of wheat nitrogen deficiency tolerant varieties, and provide an effective site for the detection of nitrogen deficiency wheat environments and variety identification. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 Figure 1 shows the statistical analysis of wheat seedling traits under different nitrogen levels in the greenhouse; (a) shows plant phenotypes under normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days), with a scale bar of 10 cm; (b) shows the correlation matrix of six phenotypes related to nitrogen tolerance under normal nitrogen and nitrogen deficiency conditions. Note: All Pearson correlation coefficients shown in the matrix are significant at different levels; blank blocks indicate no significant correlation between the corresponding pairs; c–h show the six phenotypic measurements of 284 wheat varieties under two different conditions, including stem dry weight (c), root dry weight (d), root-to-shoot ratio (e), stem nitrogen accumulation (f), root nitrogen accumulation (g), and total nitrogen accumulation (h);
[0017] Figure 2The results of the analysis of wheat related traits under nitrogen deficiency conditions are shown in Figure 2. (a) is the frequency distribution result of relative stem dry weight; (b) is the frequency distribution result of relative root dry weight; (c) is the frequency distribution result of relative root-to-shoot ratio; (d) is the frequency distribution result of relative stem nitrogen accumulation; (e) is the frequency distribution result of relative root nitrogen accumulation; (f) is the frequency distribution result of relative total nitrogen accumulation; Note: Correlation analysis between relative aboveground traits of wheat, including relative aboveground dry weight (RSDW), relative root-to-shoot ratio (RRS), relative aboveground nitrogen accumulation (RSN) and relative total nitrogen accumulation (RTN) (g); Correlation analysis between relative and root traits of wheat, including relative root dry weight (RRDW), relative root-to-shoot ratio, relative root nitrogen accumulation (RRN) and relative total nitrogen accumulation (RTN) (h);
[0018] Figure 3 The results of genome-wide association analysis 1, (a) to (c) are QQ plots and Manhattan plots of three relative traits related to nitrogen deficiency, including RSDW (a), RRDW (b), and RRS (c); the dotted line indicates the significance threshold (p#1×10 3 );
[0019] Figure 4 The results of genome-wide association analysis 1, (a) to (c) are QQ plots and Manhattan plots of three relative traits related to nitrogen deficiency, including RSN (a), RRN (b), and RTN (c); the dotted line indicates the significance threshold (p#1×10 3 );
[0020] Figure 5 The Venn diagram analysis results of genes related to wheat root nitrogen tolerance identified by GWAS.
[0021] Figure 6 The morphological characteristics of the extremely sensitive strain W101 and the extremely tolerant strain W199 after nitrogen deficiency treatment;
[0022] Figure 7 The results of related gene expression in extreme nitrogen deficiency tolerant and sensitive wheat lines are shown;
[0023] Figure 8Results of identification and verification of nonsense mutations in candidate genes induced by EMS; (a) genotype verification results of mutation sites by inverse PCR, blue: wild-type allele; green: fd mutant allele; (b) phenotypic results of plants with fd mutant allele and wild-type (WT) plants under normal and limited nitrogen conditions; (c) changes in nitrogen deficiency physiological indicators (including RSDW, RRDW, RRS, RSNC, RRNC and RTNC) of plants with fd mutant allele and wild-type (WT) plants under normal and limited nitrogen conditions; n = 3 for each sample; error bars represent standard deviations. DETAILED DESCRIPTION
[0024] C GAACAACCGATGCCCCCCAGAAAGCGGTCAAGAGCCGCCTGAGCTTCCTCGGCCGAGGCGCGCCGCAGCTGCGGAGCCTGAGGTCCTCCTTCCCCTCCAAGAAGCTGGACGTCTCCGCGGCGGCCACGTACAAGGTGAAGCTGGTGACCCCGGAAGGGGACGAGCACGAGTTTGAGGCGCCGGACGACGCCTACATCCTGGACTCGGCGGAGACGGCGGGGGTGGAGCTGCCCTACTCGTGCCGGGCGGGGGCGTGCTCGACCTGCGCGGGCAAGATCGAGGCTGGCGCGGTGGACCAGTCGGACGGGTCGTTCCTGGACGACGCGCAGCAGGAGGAGGGCTACGTGCTGACATGCGTGGCCTACCCCAAGTCGGACTGCGTCATCCACACCCACAAGGAGGGCGACCTGTATTAGGAGGGCTCTCATCTCTGGTGCCCCCAGTTGGTTGTGTGTTGAGTAGAACAAACCTTGGTGGTTGTTTATCCCGTGCCTGCCTGTGTGCGTGCTTTGGTCGTTATTAGTCGGAGGTGGTTAAGATTGTTGGGTGAAGAGGCCACCCATGGAGAAGGCGAATAAAATCTGGCTGTGACTGATGGCATCATAAAGCAGTTTGATGGTTTTTGCGTGTGTGCTTTGTGCCGTTTTCGCTGTT) as shown.
[0025] In an embodiment of the present invention, 284 natural wheat varieties were subjected to normal nitrogen and nitrogen deficiency concentration stress treatments, and the results showed that nitrogen deficiency stress significantly inhibited the aboveground growth and nitrogen accumulation of wheat plants, but promoted root growth. A related gene that improves the nitrogen utilization efficiency of wheat under nitrogen deficiency conditions was screened out by genome-wide association analysis (GWAS), i.e., the Fd gene, numbered TraesCS5B03G1253700, Chinese_Spring1.0_chr5B:680354334-680357150. The expression level of the Fd gene in the strains of extreme sensitivity and extreme tolerance to nitrogen deficiency stress was verified by RT-qPCR technology, and the results showed that the Fd gene response to nitrogen deficiency stress down-regulated expression, and significantly down-regulated expression in the extreme tolerance strain, consistent with the genome-wide association analysis results. The Fd gene was described to be expressed in response to wheat nitrogen deficiency stress treatment by down-regulating expression. The nitrogen deficiency preferably includes a condition in which nitrogen content is lower than 0.4 mM in the wheat growth environment. In the present embodiment, a culture medium with a nitrogen content of 0.4 mM in the cultivation environment was used as a nitrogen deficiency stress treatment, while a culture medium with a nitrogen content of 4 mM was used as a normal growth condition.
[0026] In the present invention, in order to further verify the biological function of the Fd gene, wheat mutant plants with homozygous mutations in the Fd gene were selected from the wheat Jing 411 TILLING database induced by ethyl methanesulfonate (EMS) as experimental subjects and subjected to nitrogen deficiency stress treatment. The results showed that compared with wild-type wheat plants, the RSDW (stem dry weight under nitrogen deficiency), RSN (aboveground nitrogen accumulation under nitrogen deficiency), RRN (root nitrogen accumulation under nitrogen deficiency), and RTN (total nitrogen accumulation under nitrogen deficiency) of the wheat mutant plants were significantly reduced. At the same time, the degree of reduction in RRDW (root dry weight under nitrogen deficiency) was less than that of wild-type wheat plants, and the degree of reduction in RRS (root-to-shoot ratio under nitrogen deficiency) was greater than that of wild-type wheat plants. This shows that mutation or down-regulation of the Fd gene is beneficial to increasing total nitrogen accumulation, root nitrogen accumulation, and aboveground nitrogen accumulation under nitrogen deficiency conditions, as well as increasing stem dry weight. At the same time, mutation or down-regulation of the Fd gene is beneficial to reversing the increase in the wheat root-to-shoot ratio caused by nitrogen deficiency conditions and improving the increase in root dry weight caused by nitrogen deficiency conditions. It can be seen that the Fd gene is crucial for improving the nitrogen utilization efficiency of wheat under nitrogen deficiency conditions, which can effectively promote the breeding of nutritionally efficient materials and alleviate the negative impact of nitrogen deficiency environment on wheat growth.
[0027] The present invention provides the use of the Fd gene in regulating wheat growth and / or nitrogen accumulation under nitrogen deficiency conditions.
[0028] In the present invention, the Fd gene preferably promotes the growth and nitrogen accumulation of wheat under nitrogen-deficient conditions in a negative regulatory manner. The promotion of wheat growth under nitrogen-deficient conditions is preferably manifested as promoting the growth of the aboveground part of wheat under nitrogen-deficient conditions, which can be stem growth. The promotion of nitrogen accumulation of wheat under nitrogen-deficient conditions preferably includes at least one of the following: increasing nitrogen accumulation in the aboveground part of the wheat plant, nitrogen accumulation in the root system, and total nitrogen accumulation. Since nitrogen accumulation is one of the basic parameters for evaluating nitrogen utilization efficiency, when the soil nitrogen supply level remains unchanged, an increase in plant biomass (NUtE) indicates an improvement in nitrogen utilization efficiency.
[0029] In the embodiments of the present invention, nitrogen deficiency stress treatment inhibits the growth of the aboveground part and nitrogen accumulation of wheat, but promotes root growth. The mutation of the Fd gene enables the wheat plant to effectively promote the growth of the aboveground part (stem) and inhibit root growth after nitrogen deficiency stress treatment, thereby reducing the root-to-shoot ratio; at the same time, the mutation of the Fd gene can also increase the nitrogen accumulation of the aboveground part, root nitrogen accumulation and total nitrogen accumulation of the wheat plant.
[0030] The present invention provides an application of detecting the expression level of the Fd gene in evaluating the wheat growth environment and / or distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties.
[0031] In the present invention, the reagent for detecting the expression level of the Fd gene preferably includes a qPCR primer. The qPCR primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 (TGCTCGAACAACCGATGCC) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3 (CCGCCGAGTCCAGGATGTAG). The reaction system of the qPCR is preferably: 50 ng of cDNA template, 0.4 μl of each forward / reverse primer (10 μM), 10 μl of mix, and ddH2O is filled to 20 μl. The reaction procedure of the qPCR is preferably pre-denaturation at 94°C for 30 seconds, followed by 45 cycles, each cycle of denaturation at 94°C for 5 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 10 seconds, followed by melting curve analysis, from 60°C to 95°C, collecting a fluorescence signal every 0.5°C, with a duration of 5 seconds / degree Celsius.
[0032] In the present invention, the method for distinguishing between nitrogen deficiency-tolerant wheat varieties and nitrogen deficiency-sensitive wheat varieties preferably comprises the following steps: planting the wheat variety to be tested under nitrogen deficiency conditions, detecting the relative expression level of the Fd gene using RT-qPCR technology, and judging whether the wheat variety to be tested is a nitrogen deficiency-tolerant wheat variety or a nitrogen deficiency-sensitive wheat variety based on the relative expression level of the Fd gene: when the relative expression level of the Fd gene of the wheat variety to be tested is significantly increased compared with that of the reference sample, it indicates that the wheat variety to be tested is a nitrogen deficiency-sensitive wheat variety, and when the relative expression level of the Fd gene of the wheat variety to be tested is not significantly different from that of the reference sample, it indicates that the wheat variety to be tested is a nitrogen deficiency-tolerant wheat variety. The reference sample is preferably a nitrogen deficiency-tolerant wheat variety, such as Xuzhou No. 25, Azulon, Chuanmai No. 41, Shijiazhuang No. 8, and Shanmai No. 512.
[0033] The present invention provides the use of the Fd gene as a target in cultivating or constructing nitrogen deficiency-tolerant wheat varieties.
[0034] In the present invention, the method for cultivating nitrogen deficiency-tolerant wheat varieties preferably involves screening wheat varieties whose relative expression levels of the Fd gene grown under nitrogen deficiency conditions are not significantly different from those of reference samples, and then using them as breeding parents for hybrid breeding. The reference samples are the same as those described above and are not described in detail here. The method for constructing nitrogen deficiency-tolerant wheat varieties preferably involves inhibiting or knocking out the Fd gene in wheat, and collecting wheat varieties in which the Fd gene is not expressed or is expressed at a low level.
[0035] The present invention provides an application of inhibiting the expression level of the Fd gene in improving the nitrogen accumulation of wheat under nitrogen deficiency conditions.
[0036] In the present invention, the suppression of the expression level of the Fd gene preferably includes mutations in at least one of the following ways: Fd gene frameshift mutations caused by insertion or deletion, Fd gene nonsense mutations caused by insertion or deletion, promoter mutations of the Fd gene, and enhancer inactivation mutations. The Fd gene frameshift mutation caused by the insertion or deletion refers to the insertion or deletion of bases that are not multiples of 3, resulting in a complete error in the amino acid sequence downstream of the mutation. The Fd gene nonsense mutation caused by insertion or deletion refers to the introduction of a stop codon (UAA / UAG / UGA) in advance or triggering the NMD degradation pathway of mRNA (nonsense-mediated mRNA decay). The promoter mutation of the Fd gene is TATA box / Inr element destruction or mutation of the transcription factor binding site, etc. The enhancer inactivation mutation refers to base variation of the distal regulatory sequence.
[0037] T ) as shown.
[0038] In the present invention, the improvement of wheat nitrogen accumulation under nitrogen deficiency conditions includes reducing the relative expression of the Fd gene by mutating the Fd gene, thereby regulating the mutant wheat plants to increase nitrogen accumulation in roots and stems and total nitrogen accumulation under nitrogen deficiency conditions, which is beneficial to the breeding of nitrogen deficiency-tolerant wheat varieties and reduces the impact of nitrogen deficiency environment on wheat growth.
[0039] The wheat Fd gene provided by the present invention and its application in regulating nitrogen utilization efficiency of wheat under nitrogen deficiency conditions are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.
[0040] Example 1
[0041] A method for screening genes related to nitrogen deficiency tolerance in wheat
[0042] 1. Materials and Methods
[0043] 1.1 Plant materials and growth conditions
[0044] A total of 284 common wheat germplasms from all over the world were collected (see Table 1).
[0045] Table 1 Summary of information on 284 wheat germplasms
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055] Seeds of all wheat lines were sterilized with 3% hydrogen peroxide for 30 min, rinsed three times with tap water, and then transferred to a sand bed. After germination, 7-day-old seedlings (two-leaf stage) were despermed and transplanted into a hydroponic solution prepared in distilled water (1 mM ammonium sulfate, 1 mM potassium nitrate, 1.5 mM calcium chloride, 1 mM magnesium sulfate, 0.5 mM potassium dihydrogen phosphate, 0.046 mM H3BO3, 9.6 μM manganese chloride·4H2O, 0.01 mM (NH4)6Mo7O 24 Plants were incubated in a nutrient solution containing 4 mM nitrogen (N) for 7 days (4H2O, 4 μM ZnSO4·7H2O, 0.4 μM CuSO4·5H2O, and 0.095 mM Fe(III)-EDTA, pH 5.8). Over the next 15 days, the plants were divided into two treatments: a control culture solution containing 4 mM nitrogen (N) and a nitrogen-deficient culture solution containing 0.4 mM N. The culture solution was refreshed every 3 days.
[0056] In the experiment, wheat was grown in a natural light greenhouse at the Zhongyuan Research Institute of Zhejiang University in Zhengzhou, China, with a day / night temperature of 22°C / 18°C.
[0057] 1.2 Dry weight and nutritional analysis
[0058] Each wheat plant was photographed and divided into stem and root, and then the plants were treated at 105°C for 30 minutes and dried in an oven at 80°C to constant weight. The dry weight of the stem and root was recorded. The nitrogen content of the raw material was determined by the Kjeldahl method. About 0.3g of the raw material was added to a dry 100ml Kjeldahl nitrogen flask and hydrolyzed in 15mL of concentrated sulfuric acid (H2SO4) solution containing 0.4g CuSO4 and 4g K2SO2 in a heating block at 420°C for 2h. After cooling, 20ml of H2O was added to the hydrolyzate, which was then titrated and neutralized to measure the amount of nitrogen in the raw material.
[0059] Root to shoot ratio (RS) = root dry weight (RDW) / stem dry weight (SDW) formula I;
[0060] Total nitrogen accumulation (TN) = aboveground nitrogen accumulation (SN) + root nitrogen accumulation (RN) Formula II
[0061] Each treatment was replicated three times, and three plants were randomly selected. Correlations between traits were calculated using SPSS 21.0 (IBM, Armonk, NY, USA), and treatment average phenotypes were compared using t-tests.
[0062] The nitrogen deficiency tolerance index is used to characterize the relative changes in SDW, RDW, RS, SN, RN, and TN (labeled as RSDW, RRDW, RRS, RSN, RRN, and RTN, respectively) under nitrogen deficiency stress. The relative change of each trait is calculated by dividing the value under nitrogen deficiency treatment / normal treatment, for example, RSDW = (SDW (control) - SDW (nitrogen deficiency)) / SDW (control).
[0063] 1.3 Genome-wide association study (GWAS)
[0064] Capital Bio genotyped all 284 accessions using a wheat 90K single nucleotide polymorphism (SNP; Illumina, 81,587 SNPs) array. SNPs used for subsequent GWAS analysis were obtained after quality control (minor allele frequency > 0.05, missing data < 20%). The physical locations of the SNPs were obtained from the International Wheat Genome Sequencing Consortium website (IWGSC, http: / / www.wheatgenome.org / IWGSC v1.1).
[0065] The population structure was analyzed using the admixture 1.3.0 program. ADMIXTURE was run with K = 1 to K = 20 clusters to determine the optimal value of K. The R package APE was used to create phylogenetic trees to observe the genetic relationships of the samples and eliminate outliers.
[0066] TASSEL v5.2 software was used to perform a genome-wide association analysis based on GLM for the nitrogen deficiency tolerance index of the phenotypic traits. In this example, the P value indicates whether the SNP is associated with the corresponding trait, and R 2 Indicates the phenotypic variation explained by the marker.
[0067] Because the Bonferroni-Holm correction for multiple testing (α = 0.05) (Holm, 1979) was too conservative and no significant marker-trait association (MTA) was detected using this criterion, markers with an adjusted -log10 (P value) ≥ 3.0 were selected as significantly associated markers. In addition, Manhattan and QQ plots were drawn using the CM plot package implemented in R3.6.
[0068] 1.4 Candidate gene analysis and annotation
[0069] Candidate genes were identified as all genes located within the region surrounding the significant SNP (±50 kb) at each significant locus in the IWGSC3 (IWGSC v1.1) physical location. wGRN (http: / / wheat.cau.edu.cn / wGRN), an interactive web server, was then used to accurately prioritize candidate genes associated with nitrogen deficiency-responsive traits in genome-wide association studies. By inputting QTLs from the GWAS results and homologous genes previously identified as involved in rice nitrogen metabolism, genes associated with improved nitrogen use efficiency in wheat under nitrogen deficiency conditions were discovered.
[0070] 2. Results
[0071] 2.1 Phenotypic responses of nitrogen-responsive traits to different environments
[0072] Six agronomic indices of nitrogen deficiency tolerance were observed and calculated in the experiment, including SDW, RDW, RS, SN, RN, and TN. All traits showed wide variation among 284 wheat accessions. Continuous variation was observed in all traits, and their distributions were approximately normal. Plants exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days) at the seedling stage ( Figure 1 (a)). All traits except RRDW and RRS decreased under nitrogen deficiency compared with the control. The mean values of SDW, SN, RN, and TN decreased by 35.5%, 67.5%, 32.2%, and 61.7%, respectively, under nitrogen deficiency. In contrast, the mean values of RRDW and RRS increased by 41.8% and 121.1%, respectively, under nitrogen deficiency. Figure 1 In addition, significant positive correlations were observed between the data for all six nitrogen deficiency-related traits under both nitrogen conditions ( Figure 2 (a)-(f)), indicating that most of the phenotypic variation comes from genetic factors.
[0073] In order to further explore the relationships between the six nitrogen deficiency-related traits under different nitrogen conditions, a correlation matrix ( Figure 1 (b)). The results showed that SDW and SN were significantly positively correlated, with Pearson correlation coefficients (r) of 0.727 and 0.731 under normal and nitrogen-deficient conditions, respectively. Furthermore, a significant positive correlation was observed between RDW and RN data under both nitrogen conditions. These results suggest that SDW and RDW can serve as key phenotypic indicators for characterizing nitrogen use efficiency in wheat. RS was significantly negatively correlated with both SN and TN under different nitrogen levels (p < 0.01), indicating that an increase in the root-to-shoot ratio may significantly reduce nitrogen use efficiency in wheat.
[0074] 2.2 Growth responses of wheat lines to nitrogen deficiency stress
[0075] To identify the responses of extreme wheat lines to nitrogen deficiency, relative traits (RSDW, RRDW, RRS, RSN, RRN, and RTN) were used as composite selection indices under different nitrogen levels.
[0076] Under nitrogen deficiency stress, stem weight and nitrogen accumulation were reduced in all wheat lines compared with the control ( Figure 2 However, approximately 94% of the lines showed an increase in root dry weight in response to nitrogen deficiency. In addition, more than 90% of the lines showed a decrease in root nitrogen accumulation compared to the control.
[0077] Furthermore, by selecting lines with the top 15% relative stem and root biomass indices under nitrogen deficiency, W268 (CA1119), W193 (Emai W23), W101 (Afu), W94 (Aca601), and W4 (Fengchan 3) were identified as extremely nitrogen-deficiency-sensitive lines. Meanwhile, W299 (Azulon), W187 (Chuanmai 41), W110 (Shijiazhuang 8), W53 (Shaanmai 512), and W199 (Xuzhou 25) were more tolerant to nitrogen deficiency, as the bottom 15% relative stem and root biomass indices were responses to nitrogen deficiency stress. Subsequently, ten wheat lines exhibiting extreme nitrate responsiveness were used as material for further candidate gene analysis.
[0078] In addition, the correlation analysis between the nitrogen deficiency response traits of seedlings under nitrogen deficiency stress was calculated, and the correlation coefficients of the six traits were given. Multivariate analysis showed that under nitrogen limitation, there was a robust covariation (p < 0.01) between stem-related parameters (RSDW, RSN) and root system structure indicators (RRDW, RRN) ( Figure 2 (g)-(h)).
[0079] 2.3 Marker-trait association (MTAs) analysis
[0080] A genome-wide association analysis based on GLM was performed on the nitrogen deficiency tolerance index of phenotypic traits. A total of 70 SNPs (MTA) were identified that were significantly associated with six nitrogen deficiency tolerance-related traits (including RSDW, RRDW, RRS, RSN, RRN, and RTN) at a P value of 0.001 (log10 value of 3) ( Figure 3 and Figure 4 ).
[0081] The largest number of loci were found in genome A (33) and genome B (22), while 15 loci were found in genome D. Of these loci, 16 were detected by RSDW, 21 by RRDW, 15 by RRS, 18 by RSN, 9 by RRN, and 5 by RTN.
[0082] Notably, nine loci (BobWhite_c19327_314, BobWhite_c47740_85, BobWhite_c8037_1135, BS00106306_51, Excalibur_c3004_250, Excalibour_rep_c70996_188, IAAV8527, Kukri_c17417_291, Tdurum_contig46954_406, wsnp_CAP11_rep_c4111_1943520, and wsnp_Ra_c38873-46699852) were identified as having two or more traits, demonstrating the presence of pleiotropic regions. Furthermore, QQ plots for all traits indicated that false positives in this GWAS were adequately controlled.
[0083] As a result, 67, 27, 39, 48, 61 and 10 genes were identified using RRDW, RRN, RRS, RSDW, RSN and RTN, respectively ( Figure 5 ).
[0084] Using the QTLs identified in GWAS as input, 220 candidate genes were predicted by wGRN combined with known homologous genes in rice. In the embodiment, wGRN prioritized TraesCS5B03G1253700 (Fd) as a high-confidence candidate based on its connectivity with genes in the functional network.
[0085] Example 2
[0086] RT-qPCR was used to verify the expression levels of the Fd gene in extreme varieties
[0087] Ten extreme nitrogen deficiency-tolerant and -sensitive wheat lines were treated with nitrogen deficiency (0.4 mM N) or normal nitrogen levels (4 mM N) for 15 days. Treated wheat plants were photographed and their morphological characteristics were observed. RNA was extracted from the wheat plants and analyzed by RT-qPCR. Three biological replicates were performed for each sample. Total RNA from the stems was extracted using the Plant RNA Kit (ER302; TransGen Biotech, Beijing, China), and cDNA was synthesized using the cDNA Synthesis Kit (AU341; TransGen Biotech, Beijing, China). Quantitative reverse transcription polymerase chain reaction (qPCR) analysis was performed using the Green qPCR Kit (AQ601; TransGen Biotech, Beijing, China) to determine gene expression levels. Experiments were performed in triplicate. qPCR Fd-F: TGCTCGAACAACCGATGCC; Fd-R: CCGCCGAGTCCAGGATGTAG; Actin-F: CAACGAGCTCCGTGTCGCA (SEQ ID NO: 5); Actin-R: GAGGAAGCGTGTATCCCTCATAG (SEQ ID NO: 6). The qPCR reaction system consisted of 50 ng of cDNA template, 0.4 μl of each forward and reverse primer (10 μM), a 10 μl mix, and ddH2O to 20 μl. The qPCR reaction program was a 94°C initial denaturation for 30 seconds, followed by 45 cycles of denaturation at 94°C for 5 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 10 seconds. Melting curve analysis was performed with fluorescence signals collected every 0.5°C from 60°C to 95°C for 5 seconds per cycle.
[0088] See the results Figure 6 and Figure 7 To verify the function of the candidate gene, extremely tolerant and sensitive lines were exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions. The results showed that nitrogen deficiency stress significantly inhibited aboveground growth and nitrogen accumulation of wheat plants, but promoted root growth. Fd expression levels were downregulated in all extremely nitrogen deficiency-sensitive and -tolerant lines, and the relative expression of Fd was downregulated more in the extremely tolerant lines, indicating that the expression and regulatory patterns of extreme lines in response to nitrogen starvation differ.
[0089] Ten wheat plants were cultured under nitrogen deficiency conditions (0.4 mM N) for 15 days. W199 (Xuzhou No. 25) served as a reference sample and tested using the aforementioned RT-qPCR method. The determination method was that if the relative expression level of the Fd gene in the test sample was upregulated compared to the reference sample, the test sample was considered a nitrogen deficiency-sensitive wheat variety. If there was no significant difference, the test sample was considered a nitrogen deficiency-tolerant wheat variety. The results showed that seven wheat plants were nitrogen deficiency-sensitive wheat varieties, and the remaining three were nitrogen deficiency-tolerant wheat varieties, with a 100% consistency with the nitrogen deficiency phenotype.
[0090] Example 3
[0091] Analysis of wheat mutants of the candidate gene Fd
[0092] To evaluate the candidate gene Fd, we used mutants to assess its function. Homozygous EMS-induced wheat mutants were selected from the Jing411 TILLING database (http: / / jing411.molbreeding.com / ) as candidate genes. The mutation type was premature termination. The mutation site was verified by sequencing the qPCR products amplified with specific primers.
[0093] The qPCR reaction system consisted of 100 ng of genomic DNA template, 0.8 μl of each forward and reverse primer (10 μM), 10 μl of 2× Mix, and ddH₂O to a final volume of 20 μl. The primers were F_fd (AGATGTCAACCTGCACGTTTG, SEQ ID NO: 7) and R_fd (AAGCACACACGCAAAAACCA, SEQ ID NO: 8). The qPCR reaction protocol was preferably a 95°C initial denaturation for 3 minutes, followed by 32 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 15 seconds, followed by a final extension at 72°C for 10 minutes, and storage at 4°C.
[0094] To further investigate the function of the candidate gene, wild-type plants and mutants with high impact from the wheat Jing 411 database were used. Genotypic validation of the mutation site in EMS-induced nonsense (gained stop) mutations was shown by qPCR ( Figure 8 (a) in the figure, the sequence is the reverse complementary sequence (G at position 629 is mutated to A). Under normal and nitrogen deficiency conditions, the difference between plants with Fd mutation and wild type (WT) plants ( Figure 8(C) The results showed that under different nitrogen conditions, changes in physiological parameters of Fd mutant plants differed significantly from those of wild-type plants (WT). RSDW, RSN, RRN, and RTN values of mutant plants were significantly higher than those of WT plants. This suggests that the Fd gene negatively regulates nitrogen accumulation in the roots and aboveground parts of wheat, thereby increasing total nitrogen accumulation and stem weight.
[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. An Fd gene associated with nitrogen deficiency tolerance in wheat, characterized in that: The nucleotide sequence is shown in SEQ ID NO:
1.
2. Use of the Fd gene according to claim 1 in regulating the growth and / or nitrogen accumulation of wheat under nitrogen deficiency conditions.
3. The application according to claim 2, characterized in that: The Fd gene promotes the growth and nitrogen accumulation of wheat under nitrogen deficiency conditions through negative regulation.
4. Use of detecting the expression level of the Fd gene according to claim 1 in distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties.
5. The application according to claim 4, characterized in that: The reagents for detecting the expression level of the Fd gene include qPCR primers; The qPCR primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:
3.
6. Use of the Fd gene according to claim 1 as a target in breeding or constructing nitrogen deficiency-tolerant wheat varieties.
7. Application of inhibiting the expression level of the Fd gene in improving nitrogen accumulation in wheat under nitrogen deficiency conditions.
8. The application according to claim 7, characterized in that: The inhibition of Fd gene expression level includes at least one of the following mutations: Fd gene frameshift mutation caused by insertion or deletion, Fd gene nonsense mutation caused by insertion or deletion, Fd gene promoter mutation and enhancer inactivation mutation.
9. The application according to claim 7, characterized in that: The reagents for inhibiting the expression level of the Fd gene include siRNA, sgRNA, shRNA, and gene derivatives containing any one of the above that interfere with the expression of the Fd gene.
10. The use according to any one of claims 2 to 4 and 6 to 7, characterized in that: The nitrogen deficiency includes a condition in which the nitrogen content in the wheat growth environment is lower than 0.4 mM.
Citation Information
Patent Citations
Primer pair for identifying wheat with different low-nitrogen-resistant characteristics and identification method and application thereof
CN117070665A
Molecular marker related to low-nitrogen tolerance of wheat
CN119685507A