Application of overexpressed AbMYB93 gene in enhancing resistance of atropa belladonna to stem rot caused by fusarium

Abstract

The invention discloses an application of an overexpressed AbMYB93 gene in enhancing the resistance of atropa belladonna to stem rot caused by fusarium, a fusarium strain is separated from a typical atropa belladonna diseased plant, and the fusarium strain can cause stem rot and finally cause death of the plant. Further research finds that the plant hormone brassinolide (BR) can enhance the resistance of the atropa belladonna to the pathogen and increase the TAs content at the same time. Afterwards, the invention reveals that the BR directly up-regulates the expression of a key biosynthetic gene of scopoletin through AbMYB93, so that the resistance of atropa belladonna to the pathogen is enhanced. In conclusion, the research results show that AbMYB93 is a novel regulatory factor for the disease resistance of atropa belladonna, and a practical method for solving the disease resistance of atropa belladonna is established.

Description

Technical Field

[0001] The present invention relates to the field of plant molecular biology, and in particular to application of overexpressing the AbMYB93 gene in enhancing the resistance of belladonna to stem rot caused by Fusarium. Background Art

[0002] Tropane alkaloids (TAs) are a class of naturally occurring plant secondary metabolites, primarily represented by hyoscyamine, scopolamine, and anisodamine. They are widely used clinically as anticholinergic drugs, primarily for anesthesia and analgesia, treatment of organophosphate poisoning, and relief of Alzheimer's disease. They face significant market demand. The only way to industrially produce tropane alkaloids is through extraction from medicinal plants in the Solanaceae family. Belladonna, a widely cultivated and listed medicinal plant, contains relatively low levels of tropane alkaloids, less than 0.1% of the leaf dry weight. This results in high production costs and makes it difficult to meet market demand. In addition, during the cultivation process of A. belladonna, it faces the threat of diseases such as root rot and basal rot, which can cause plant death and severely limit the production of hyoscyamine alkaloids (TAs). Therefore, controlling the disease problems during the cultivation process of A. belladonna is crucial to expanding the cultivation scale and increasing the production of hyoscyamine alkaloids.

[0003] Currently, research on belladonna pests and diseases and their control is scarce. To date, only one study has reported that a fruit rot fungus can infect belladonna, ultimately leading to basal rot and plant death (Lu et al., 2023). However, its pathogenic mechanism remains unclear, and effective control measures are currently unavailable (Lu et al., 2023). Research on other plants has shown that Phytophthora, Pythium, and Fusarium are the main pathogens causing root and stem rot and are widely distributed (Hu et al., 2021; Liu et al., 2023; Chawla et al., 2021). Although synthetic pesticides are recognized as one of the most effective methods for controlling these diseases, their overuse has caused serious problems. Utilizing plant compounds with defensive functions, such as the terpenoid menthol and the phenylpropanoid scopoletin, is considered to be the most economical and effective measure to cope with pathogen stress (Dambolena et al., 2008; Wang et al., 2024). Summary of the Invention

[0004] In view of this, one of the objects of the present invention is to provide the use of overexpressing the AbMYB93 gene in promoting the synthesis of scopoletin in belladonna; the second object of the present invention is to provide the use of overexpressing the AbMYB93 gene in enhancing the resistance of belladonna to stem rot caused by Fusarium; the third object of the present invention is to provide the use of biological materials related to the AbMYB93 gene in promoting the synthesis of scopoletin in belladonna or enhancing the resistance of belladonna to stem rot caused by Fusarium; the fourth object of the present invention is to provide a method for overexpressing the AbMYB93 gene to promote the synthesis of scopoletin in belladonna or enhance the resistance of belladonna to stem rot caused by Fusarium.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: Application of overexpression of AbMYB93 gene in promoting the synthesis of scopoletin in belladonna.

[0006] Application of overexpression of AbMYB93 gene in enhancing the resistance of belladonna to stem rot caused by Fusarium spp.

[0007] In some embodiments of the present invention, the amino acid sequence encoded by the AbMYB93 gene is shown as SEQ ID No.1.

[0008] In some embodiments of the present invention, the nucleotide sequence of the AbMYB93 gene is shown as SEQ ID No. 2.

[0009] The application of biological materials related to the AbMYB93 gene in promoting the synthesis of scopoletin in belladonna or enhancing the resistance of belladonna to stem rot caused by Fusarium oxysporum. The biological materials related to the AbMYB93 gene include a nucleic acid molecule encoding the AbMYB93 gene, or an expression cassette or recombinant vector containing a nucleic acid molecule encoding the AbMYB93 gene, or a microbial cell containing a nucleic acid molecule encoding the AbMYB93 gene, an expression cassette or a recombinant vector containing a nucleic acid molecule encoding the AbMYB93 gene, and the nucleotide sequence of the nucleic acid molecule encoding the AbMYB93 gene is shown in SEQ ID No. 2.

[0010] A method for overexpressing the AbMYB93 gene to promote scopoletin synthesis in belladonna or enhance belladonna's resistance to stem rot caused by Fusarium spp. comprises the following steps: constructing an AbMYB93 gene overexpression vector, then transforming belladonna leaves under the mediation of Agrobacterium, and screening to obtain transgenic plants that promote scopoletin synthesis in belladonna and improve belladonna's disease resistance; the nucleotide sequence of the AbMYB93 gene is shown in SEQ ID No. 2.

[0011] In some embodiments of the present invention, the AbMYB93 gene overexpression vector is obtained by constructing the nucleic acid sequence shown in SEQ ID No. 2 between the BglII and BstEII sites of the pG2 plasmid, and the pG2 plasmid is constructed by replacing the hygromycin resistance gene in pCAMBIA1305.1 with the new glyphosate resistance gene G2-EPSPS using Xhol.

[0012] The beneficial effects of the present invention are as follows: In this invention, a Fusarium strain was isolated from a typical diseased belladonna plant. This strain can cause stem rot and ultimately lead to plant death. By subjecting belladonna hairy roots to BR treatment and bioinformatics analysis, the transcription factor AbMYB93, which is induced by BR and regulates the biosynthesis of TAs in belladonna, was identified for the first time. The specific mechanism by which AbMYB93 regulates the biosynthesis of TAs in belladonna was elucidated using relevant molecular biology and biochemistry methods. This provides an effective functional gene for tropane alkaloid metabolic engineering and offers new ideas for obtaining belladonna germplasm resources that can produce high TAs under BR. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration: Figure 1 Figure 1: Isolation and pathogenicity analysis of the pathogen. A: Pathogen pathogenicity test, including growth phenotype before treatment, growth phenotype 9 days after inoculation with the pathogen isolate, and symptom observation of the entire plant after infection. CK: Wild-type A. belladonna without inoculation with the pathogen isolate. EG: Wild-type A. belladonna inoculated with the pathogen isolate. B: Growth status of the front of the colony of the pathogen isolate after 3 days of culture on a PDA plate. C: Growth status of the back of the colony of the pathogen isolate after 3 days of culture on a PDA plate. D: Spore morphology of the pathogen isolate. E: Phylogenetic tree constructed using the ITS sequence of the pathogen isolate and the 30 reported ITS sequences with the highest similarity values. Pathogenisolate-ITS: Pathogen isolated from diseased A. belladonna plants.

[0014] Figure 2Analysis of the inhibitory effect of scopoletin on FORL growth. A: Observation of FORL colony characteristics in culture medium supplemented with different compounds; B: Observation of spores using a hemacytometer; C: Scanning electron microscopy (SEM) imaging of hyphae; D: Statistical analysis of colony diameters in panel A; E: Statistical analysis of spore numbers in panel B; Control: PDB medium, Fluconazol 0.1 mg / mL: PDB medium supplemented with fluconazole at a final concentration of 0.1 mg / mL, Scopoletin 0.1 mg / mL: PDB medium supplemented with scopoletin at a final concentration of 0.1 mg / mL; Error bars represent standard errors (n ≥ 3). Student's t-test was used for comparison (**P < 0.01).

[0015] Figure 3 Analysis of scopoletin content and disease resistance in transgenic belladonna plants. A: Expression level of AbMYB93 in transgenic belladonna with AbMYB93 overexpression (AbMYB93-OE); B: Sequencing results of transgenic belladonna with AbMYB93 gene editing (AbMYB93-CRISPR); C: Expression level of AbCOSY in transgenic belladonna with AbMYB93-OE; D: Expression level of AbCOSY in transgenic belladonna with AbMYB93-CRISPR; E: Scopoletin content in transgenic belladonna with AbMYB93-OE; F: Scopoletin content in transgenic belladonna with AbMYB93-CRISPR; G: Analysis of disease severity; HJ represent the phenotypes of wild-type, AbMYB93-OE, and AbMYB93-CRISPR belladonna plants before and after pathogen treatment, respectively; Error bars represent standard errors (n ≥ 3), using Student's method. t test (*P < 0.05, ***P < 0.001). DETAILED DESCRIPTION

[0016] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0017] Example 1: Isolation and Identification of Pathogens in Belladonna To isolate the pathogen, root and stem samples were collected from Solanum belladonna plants grown under controlled conditions and showing typical rot symptoms. The samples were surface sterilized in 70% ethanol for 1 minute and then immersed in 1% sodium hypochlorite solution for 5 minutes. Afterwards, they were rinsed three times with sterile water and plated on potato dextrose agar (PDA) plates and incubated at 27 ± 2°C. The pathogen isolates were recovered and the hyphal tips were transferred to fresh PDA plates to obtain pure cultures. Figure 1 As shown in Figures BD and BD, this pathogen forms round, fluffy, cotton-like white colonies on PDA plates. On the back of the dish, the colonies gradually change color from white to reddish-purple as they mature. Two types of conidia are produced during culture: small conidia are colorless, unicellular, and oval or reniform; large conidia are colorless, multicellular, and sickle-shaped or septate. Purified cultures are stored on PDA slants at 4°C for further analysis.

[0018] The pathogen isolates were identified based on their culture morphology and physiological characteristics. The pathogenicity test, including the growth phenotype before treatment, was performed by making a 1 cm long incision at the base of each stem with a sterile scalpel. 10 μL of spore suspension (5 × 10 6 spores / mL) (Koike et al, 2012). Three control groups (CK-1, CK-2, and CK-3) of belladonna were injected with 10 μL of sterile water. The inoculated plants were covered with sterilized polyethylene plastic film to promote infection. The symptoms of the infected plants were observed. It was found that the base of the stems of the belladonna inoculated with the pathogen developed dark brown water-soaked spots, the roots and rhizomes rotted, and the entire plant eventually died. The results are as follows Figure 1 , as shown in A.

[0019] In addition, whole-genome sequencing was performed on the pathogen isolate. The predicted ITS sequences were aligned with the ITS subset of the NCBI NT database using the Blast program, with parameters set to identify >95%. Subsequently, the top 30 ITS sequences with the highest similarity were selected (if there were fewer than 30, all were selected). After multiple sequence alignment and pruning using mafft software, a phylogenetic tree was constructed using FastTree / iqtree / raxml software. Based on the pathogen's culture and pathological characteristics, as well as the phylogenetic tree results, the isolated pathogen was ultimately identified as Fusarium oxysporum.

[0020] Example 2: Analysis of the resistance of scopoletin to pathogenic bacteria To determine whether scopoletin lactone has inhibitory activity against pathogens isolated from Solanum belladonna, we used resazurin as a cell viability indicator. A scopoletin concentration gradient containing 0.1 mM resazurin was established in a 96-well plate by two-fold serial dilution.

[0021] 6 mm pieces of pathogen hyphae were inoculated onto PDA plates supplemented with 0.1 mg / mL scopoletin, 0.1 mg / mL fluconazole, and solvent-treated plates as positive and negative controls, respectively. Fungal growth in the control group did not expand significantly on day 1, but began to proliferate vigorously on day 2, secreting a large amount of light red exudate and proliferating to the edge of the plate by day 5. In contrast, plates treated with scopoletin / fluconazole showed significant inhibition of pathogen hyphae growth and pigment production ( Figure 2 , A). Statistical analysis of colony diameters showed that the pathogen exhibited a delayed and slow growth pattern in the culture medium supplemented with scopoletin ( Figure 2 , D).

[0022] To quantify the number of conidia, a culture medium treated with 0.1 mg / mL scopoletin was filtered through two layers of gauze to obtain a spore suspension, and the conidia were counted using a hemocytometer. Culture medium supplemented with 0.1 mg / mL fluconazole and solvent-treated culture medium served as positive and negative controls, respectively (Figure 2, B). In the control group not treated with scopoletin, the conidia count was approximately 1.9 × 10 7 spores / mL. After scopolamine treatment, the spore count dropped to about 2×10 6 spores / mL (Fig. 2, E).

[0023] Scanning electron microscopy (SEM) observations showed that the hyphae of the control group were intact and smooth, indicating that the hyphae structure was intact. In contrast, the hyphae of the pathogen treated with scopoletin / fluconazole were incomplete, wrinkled, and broken compared to the control group, indicating that the membrane structure of the pathogen was destroyed and its growth was inhibited ( Figure 2 , C).

[0024] Example 3. Construction of AbMYB93 overexpression vector The pG2 plasmid (pG2 plasmid is a plant binary expression vector modified by Zhang et al. to express the novel glyphosate-resistant gene G2-EPSPS in eukaryotes. It was constructed by replacing the hygromycin resistance gene in pCAMBIA1305.1 with G2-EPSPS using Xhol, see the literature Engineering tropane alkaloid production and glyphosate resistance by overexpressing AbCaM1 and G2-EPSPS in Atropa belladonna) was double-digested with Bgl II and BstEII, respectively. The pG2-digested fragment was recovered, and the AbMYB93 gene fragment (SEQ ID NO. 1-2) with restriction enzyme cleavage sites was obtained using the primers in Table 1. The AbMYB93 gene fragment was recovered, and the AbMYB93 gene and the vector fragment were ligated using homologous recombinase to construct an AbMYB93 overexpression vector.

[0025] Table 1. Primers for construction of AbMYB93 overexpression vector Primer name Primer sequences AbMYB93-inpG2-F TGACCATGGTAGATCTgATGGGAAGGTCACCTTGTTGTG (SEQ ID NO.3) AbMYB93-inpG2-R ATTCGAGCTGGTCACCCTAGGGAATATCATGGAACAAAGAATC (SEQ ID NO.4) Example 4, AbMYB93 knockout vector construction Through genomic sequence analysis, the gene editing target site T: 5'-GAAGAAACAGGCCTTAAGAAAGGTCCA-3' was selected on the first exon of AbMYB93, and a target primer with BsaІ was designed. The target was then ligated to the pCAMBIA1300 vector containing the CRISPR / Cas9 system using T4 enzyme.

[0026] Example 5. Creation of AbMYB93 transgenic belladonna plants The positively tested AbMYB93 overexpression vector, knockout vector, and corresponding empty vector (control) were transformed into Agrobacterium EHA105.

[0027] (1) Pick the prepared EHA105 Agrobacterium and place it in 10 mL of liquid culture medium containing YEP, 40 mg / L Rif, and 50 mg / L Kan, and culture it in a constant temperature shaker at 28°C overnight. (2) Transfer 1 mL of the activated bacterial solution from step (1) to 50 mL of liquid culture medium containing YEB, 40 mg / L Rif, and 50 mg / L Kan. Continue culturing in a 28°C constant temperature shaker until the OD600 reaches 0.6. (3) Centrifuge at 5000 rpm for 10 min and discard the supernatant; (4) Resuspend the cells in 50 mL of MS + 100 µM AS liquid culture medium; (5) Cut the cotyledons and hypocotyls of 3-week-old sterile belladonna seedlings and infect them in the bacterial solution for 5-8 minutes; (6) Remove excess bacterial solution and incubate in a dark room at 25°C for 2–3 days; (7) Transfer the explants to screening culture plates and culture at 25°C under a 16 / 8 h photoperiod. Replace the culture medium every 2 weeks. (8) After 6 weeks, the regenerated shoots were transferred to MS rooting medium for rooting culture.

[0028] 2. Transplanting and hardening of sterile seedlings of regenerated belladonna After the regenerated buds grow more roots in the rooting culture, rinse the culture medium on the seedlings under running water and transplant them into nutrient soil (vermiculite, soil and perlite volume ratio of 6:3:1).

[0029] 3. Molecular detection of regenerated belladonna: DNA of regenerated seedlings was extracted by TPS method and positive detection was performed by PCR.

[0030] Transfer approximately 100 mg of fresh Solanum belladonna material to a 1.5 mL EP tube and add 2-3 3 mm steel beads. Grind the sample in an automated sample grinder at 45 Hz for 60 seconds. Then, add 800 μL of TPS extraction solution (pre-mixed with 1% β-mercaptoethanol). Place the sample in a 75°C oven for 30 minutes, mixing by inversion 3-4 times. Remove the sample from the oven, return it to room temperature, and centrifuge it at 12,000 rpm for 10 minutes. Pipette the supernatant into a new 1.5 mL EP tube, add an equal volume of isopropanol, and mix by inversion. Centrifuge at 12,000 rpm for 5 minutes and discard the supernatant. Add 1 mL of 75% ethanol, mix thoroughly, and centrifuge again to remove the supernatant. This step is for DNA cleaning and can be repeated 1-2 times. After the alcohol evaporates, add 30-50 μL ddH2O to dissolve the DNA to obtain the corresponding genomic DNA.

[0031] Using the obtained genomic DNA of each belladonna plant as a template, PCR detection was performed using universal primers 35S-F and AbMYB93-R for overexpressing belladonna plants to obtain three positive belladonna plants. RNA was extracted from these three positive overexpressing belladonna plants and converted into cDNA as a template. qRT-PCR detection was performed using primers q-AbMYB93-F and q-AbMYB93-R (Table 3). It was found that the expression level of AbMYB93 in the three transgenic belladonna plants was significantly increased ( Figure 3, A). These results indicate that this study successfully obtained three Adolescent Nightshade plants overexpressing AbMYB93: OE-3, OE-6, and OE-7. The relevant primers are shown in Table 2 below.

[0032] For the knockout strain, primers AbMYB93-CRISPR-F / R were used to PCR amplify the DNA segment containing the editing target site. The PCR product was sequenced to verify whether the endogenous AbMYB93 was successfully edited. A gene-edited strain with a 5bp deletion (CCTTA) at the target site was obtained and named KO29 ( Figure 3 , B), see Table 2 below for primers.

[0033] Table 2. Summary of primers for positive identification of transgenic belladonna plants Primer name Primer sequences 35S-F CATTTCATTTGGAGAGAACA (SEQ ID NO.5) AbMYB93-R CTAGGGAATATCATGGAACAAAGAATC (SEQ ID NO.6) q-AbMYB93-F GGTCCATGGACTCCTGAAGAAG (SEQ ID NO.7) q-AbMYB93-R GTCCACCGCAATCTACAACTCT (SEQ ID NO.8) AbMYB93-CRISPR-F GGTGCTTTAATTAGATCCAGACAATTTCCTC (SEQ ID NO.9) AbMYB93-CRISPR-R GTGAGGGGCGTGTTGAGAATAAAATTAAG (SEQ ID NO.10) Example 6: Detection of gene expression levels in the scopolamine biosynthesis pathway in transgenic belladonna plants 1. Take 0.1 g of transgenic hairy roots with good growth conditions and place them in a 1.5 mL enzyme-free EP tube. Extract the hairy root RNA and reverse transcribe it into cDNA.

[0034] 2. Dilute the reverse transcribed cDNA 20 times with RNase Free Water and use it as a template for subsequent qRT-PCR.

[0035] 3. Use NCBI to design qPCR primers for the target gene and internal reference gene (PGK). qPCR primers are shown in Table 4.

[0036] 4. After preparing the following system, use Bio-Rad CFX Maestro to perform the reaction: Table 3. qRT-PCR reaction system Reagents content SYBR Green (2x) 5 μL cDNA 4 μL qF 2 μL qR 10 μL Table 4. qRT-PCR primers Primer name Primer sequences q-COSY-F CGAGTCGAGTTCCCGTTTCA (SEQ ID NO.11) q-COSY-R TTAAGCCGGTCCAACCACTC (SEQ ID NO.12) q-PGK-F TCGCTCTTGGAGAAGGTTGAC (SEQ ID NO.13) q-PGK-R CTTGTCCGCAATCACTACATCAG (SEQ ID NO.14) 5. This experiment used the relative quantification method to calculate the expression levels of related genes, and finally used GraphPad Prism 9 to draw related pictures.

[0037] The above method was used to further analyze the transcription levels of scopoletin biosynthesis pathway genes in three A. belladonna plants overexpressing AbMYB93. The results showed that the gene expression levels of scopoletin biosynthesis pathway enzyme gene COUMARIN SYNTHASE (COSY, SEQ ID NO.15) were significantly upregulated ( Figure 3 , C), while COSY expression was downregulated in the knockout strain ( Figure 3, D). The above results indicate that AbMYB93 is a positive regulator of scopolamine biosynthesis pathway genes in Atropa belladonna.

[0038] Example 7: Detection of Scopoletin Content in Transgenic Belladonna Plants 1. Material collection (1) Sample collection: Take the hairy roots that have been cultured in a dark room at 24°C and a shaker at 110 rpm for 28 days and place them in tin foil and mark them with a marker. (2) Place the collected samples in a freeze dryer and dry them to constant weight (2-3 days); (3) Grind the sample into powder using a grinder.

[0039] 2. Extraction of TAs (1) Weigh 25 mg of hairy root powder into 1 mL of alkaloid extract and shake at 200 rpm and 16 degrees for 3 h; (2) After multiple centrifugation, the supernatant was collected and filtered through a 0.22 μm filter; (3) The filtrate was diluted 50 times with alkaloid extract and then detected by LC-MS.

[0040] 3. Detection of TAs Hyoscyamine, anisodamine, and scopolamine were determined using LC-MS. The chromatographic column was a Hypersil GOLD C18 column (Thermo Scientific, 2.1 mm × 100 mm, 1.9 μm) at 35°C. Samples were eluted using a binary gradient elution system with mobile phases A: 0.1% formic acid in water and B: acetonitrile.

[0041] Scopoletin was extracted from the overexpressing transgenic belladonna plants and the control group according to the above method, and the content was determined and analyzed by LC-MS. The results showed that the scopoletin content in the roots and leaves of the transgenic belladonna plants overexpressing AbMYB93 was significantly increased compared with the control ( Figure 3 , E), while scopoletin levels in roots and leaves of the knockout strain were reduced. These results indicate that AbMYB93 can promote the accumulation of scopoletin in belladonna and is a positive regulator of scopoletin biosynthesis in belladonna.

[0042] Example 8: Disease resistance analysis of transgenic belladonna plants Four-week-old transgenic nightshade plants were used to evaluate the pathogenicity of the isolated strains. The inoculum was prepared by transferring mycelial clumps from PDA plates to potato dextrose broth (PDB) liquid medium and incubating at 28 ± 2°C with a shaker at 180 rpm for 48 hours. Spores were collected by centrifugation at 3600 rpm for 5 minutes, and the resulting pellet was resuspended in sterile water to a final concentration of 5 × 10 6 Conidia / mL (determined by counting with a hemocytometer). The prepared spore suspension was used to inoculate the nightshade plants. The specific operation was as follows: a 1 cm long incision was made at the base of each stem using a sterile scalpel, and 10 μL of spore suspension was injected into the incision. Six plants were inoculated with each isolate. After inoculation, the plants were covered with sterilized polyethylene plastic film to promote infection, and the development of symptoms was observed daily. Symptoms were evaluated on the 9th day after inoculation, and the severity of the disease was quantified using a 0-3 rating scale, and the disease severity (%) was calculated accordingly (Wu et al., 2022). The results are shown in Figure 2. Figure 3 , GJ, transgenic belladonna plants overexpressing AbMYB93 showed enhanced resistance to Fusarium oxysporum, while knockout lines of belladonna plants showed reduced resistance to Fusarium oxysporum.

[0043] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. Application of overexpression of AbMYB93 gene in promoting the synthesis of scopoletin in belladonna.

2. Application of overexpression of AbMYB93 gene in enhancing the resistance of belladonna to stem rot caused by Fusarium spp.

3. The use according to claim 1 or 2, characterized in that: The amino acid sequence encoded by the AbMYB93 gene is shown in SEQ ID No.

1.

4. The use according to claim 1 or 2, characterized in that: The nucleotide sequence of the AbMYB93 gene is shown in SEQ ID No.

2.

5. Use of biomaterials related to the AbMYB93 gene in promoting the synthesis of scopoletin in belladonna or enhancing the resistance of belladonna to stem rot caused by Fusarium spp., characterized in that: The biological material related to the AbMYB93 gene includes a nucleic acid molecule encoding the AbMYB93 gene, or an expression cassette or recombinant vector containing a nucleic acid molecule encoding the AbMYB93 gene, or a microbial cell containing a nucleic acid molecule encoding the AbMYB93 gene, an expression cassette or recombinant vector containing a nucleic acid molecule encoding the AbMYB93 gene, and the nucleotide sequence of the nucleic acid molecule encoding the AbMYB93 gene is shown in SEQ ID No.

2.

6. A method for overexpressing the AbMYB93 gene to promote the synthesis of scopoletin in belladonna or enhance belladonna's resistance to stem rot caused by Fusarium spp., comprising the following steps: constructing an AbMYB93 gene overexpression vector, then transforming belladonna leaves under the mediation of Agrobacterium, and screening to obtain transgenic plants that promote the synthesis of scopoletin in belladonna and improve belladonna's disease resistance; the nucleotide sequence of the AbMYB93 gene is shown in SEQ ID No.

2.

7. The method according to claim 6, characterized in that: The AbMYB93 gene overexpression vector is constructed by inserting the nucleic acid sequence shown in SEQ ID No. 2 between the BglII and BstEII sites of the pG2 plasmid. The pG2 plasmid is constructed by replacing the hygromycin resistance gene in pCAMBIA1305.1 with the novel glyphosate resistance gene G2-EPSPS using Xhol.

Images