Method for constructing myxobacteria expression chassis with genetic stability and application of myxobacteria expression chassis

Abstract

The invention belongs to the technical field of biology and new medicine, and discloses a method for constructing a myxobacteria expression chassis with genetic stability and application of the myxobacteria expression chassis. Through gene deletion and overexpression analysis, it is verified that the spontaneous mutation rate of a strain can be reduced by deletion of a TLS pathway and overexpression of RecA, and a myxobacteria strain 2K7 with genetic stability is further constructed on the basis. The spontaneous mutation rate of the new strain is reduced by 11.5 times, and the transformation capability of growth plasmids of the strain is obviously improved. According to the research, the genetic stability of the myxobacteria is improved for the first time through a repair way after modification and replication, and the research method and the research result are innovative.

Description

Technical Field

[0001] The present invention belongs to the field of biology and new medicine technology, and in particular relates to a method for constructing a genetically stable myxobacterium expression chassis and its application. Background Art

[0002] Synthetic biology is transforming the biomanufacturing field at an unprecedented pace. Through the precise design and optimization of biological systems, it enables the efficient synthesis of target compounds, demonstrating broad application prospects in fields such as medicine, chemicals, energy, agriculture, materials, the environment, and health. Chassis cells are the "hardware" foundation of synthetic biology and serve as the vehicle for product synthesis. Selecting appropriate chassis cells optimizes metabolic pathways and enables efficient synthesis of bioproducts. Developing general technologies and tools, as well as rationally designing and systematically modifying chassis cells, are key areas of current biomanufacturing research.

[0003] Myxobacteria are capable of producing a rich variety of novel secondary metabolites with antifungal, antibacterial, and antitumor activities, making them an important class of drug-producing microorganisms after actinomycetes and Bacillus. Currently, more than 100 basic structures and over 600 chemical derivatives have been discovered from myxobacteria [Wenzel SC, Müller R. Myxobacteria—'microbial factories' for the production of bioactive secondary metabolites. Mol Biosyst. 2009. 5(6): 567-574]. However, due to the complexity and specificity of the synthesis conditions for secondary metabolites, especially the high GC% characteristics of myxobacterial genes (clusters), the lack of efficient expression platforms suitable for myxobacterial genes (clusters) has greatly limited the research and development of active natural products from this class of drug-producing microorganisms.

[0004] Current research on myxobacterial expression platforms has primarily focused on the well-dispersed Myxococcus xanthus (M. xanthus) DK1622 strain. As a model strain of myxobacteria, Myxococcus xanthus DK1622 is easy to culture, grows rapidly, and can grow dispersedly in liquid culture. Furthermore, the genetic manipulation methods for this model strain are relatively mature, making it easy to design pathways and genetically modify it, making it an ideal platform host cell. However, previous studies have found that the genetic phenotype of M. xanthus is significantly unstable, and strains are prone to spontaneous mutations during normal passage. Spontaneous mutations in Myxococcus xanthus have been used to screen for mutants lacking motility [MacRae TH, McCurdy HD. The isolation and characterization of gliding motility mutants of Myxococcus xanthus. Can J Microbiol. 1976. 22(9): 1282-1292]. The work of Velicer et al. also proved that when Myxococcus xanthus was propagated under normal culture conditions, colony non-fusion occurred between strains. By sequencing and comparing the genomes of the evolved strains and the starting strains, it was found that this non-fusion phenomenon was caused by spontaneous mutations in the strain genome [Rendueles O, Zee PC, Dinkelacker I, Amherd M, Wielgoss S, Velicer GJ. Rapid and widespread de novoevolution of kin discrimination. Proc Natl Acad Sci USA. 2015. 112(29): 9076-908]. When testing the random mutation of the myxobacterial genome, it was also found that the myxobacterial genome under normal growth had a higher random mutation rate (the spontaneous mutation rate of M. xanthus DK1622 was 3.69×10 -8 [Peng R, Chen JH, Feng WW, Zhang Z, Yin J, Li ZS, Li YZ. Error-prone DnaE2 balances the genome mutation rates in Myxococcus xanthus DK1622. Front Microbiol. 2017. 8:122]. The instability of myxococcal genomes poses challenges for sustained expression in continuous culture. For example, when expressing epothilones in Myxococcus xanthus as a host cell, genetic instability in the expression strain often results in either no product expression or a significant reduction in yield.

[0005] DNA mutations are the result of the combined effects of DNA damage and repair mechanisms [Volkova NV, Meier B, González-Huici V, Bertolini S, Gonzalez S, Abascal F, Martincorena I, Campbell PJ, Gartner A, Gerstung M. Mutational signatures are jointly shaped by DNA damage and repair. Nat Commun. 2020.11(1): 2169]. Various environmental and cellular endogenous stresses, including radiation, high temperature, osmotic pressure, reactive oxygen species, nutrition, desiccation, and quinolone antibiotics, can cause cellular DNA damage, affecting normal physiological metabolism and genome stability [Ruth Hershberg. Mutation-The engine of evolution: studying mutation and its role in the evolution of bacteria. Cold Spring Harb Perspect Biol. 2015.7(9): a018077; Deepa Agashe. The road not taken: Could stress-specific mutations lead to different evolutionary paths? PLoS Biol. 2017.15(6): e2002862]. Most DNA damage can be repaired by the DNA damage repair mechanism (including direct repair, excision repair and mismatch repair) induced by the intracellular SOS response. However, severe DNA damage or DNA damage that is not repaired in time will block the normal DNA replication process of the cell and cause the replication fork to stall. Bacteria restart the replication fork through two post-replication repair pathways: error-prone translesion DNA synthesis (TLS) and template switching (TS). Figure 6). TS in which RecA participates is highly faithful, while TLS is an error-prone repair and is the main source of gene mutations in cells [Shee C, Gibson JL, Darrow MC, Gonzalez C, Rosenberg SM. Impact of a stress-inducible switch to mutagenic repair of DNA breaks on mutation in Escherichia coli. Proc Natl Acad Sci USA. 2011. 108(33): 13659-13664].

[0006] Previous work has shown that the TLS mutation mechanism in Myxococcus xanthus, centered around ImuA (gene number MXAN_3991), ImuB (gene number MXAN_3990), and DnaE2 (gene number MXAN_3984), plays a key role in cellular gene mutation. Their direct deletion reduces the bacterial spontaneous mutation rate, but also affects DNA replication and repair, reducing cell survival and growth. Figure 7 Here, the post-replication repair pathway of Myxococcus xanthus was modified by (1) deleting the imuB gene to destroy the TLS mutation mechanism and reduce the mutation rate of bacteria; (2) simultaneously overexpressing RecA1, which has been shown to have recombination activity in Myxococcus xanthus, to compensate for the effect of TLS deletion on post-replication repair; (3) in order to avoid the disordered expression of recA affecting genome stability, it was placed under the control of the imuB gene promoter. The constructed new strain not only destroyed the TLS pathway catalyzed by ImuA-ImuB-DnaE2, reducing TLS mutations, but also strengthened the TS pathway catalyzed by RecA protein, improving genome stability without affecting the post-replication repair of the strain (≈3.19×10 -9 , the spontaneous mutation rate was reduced by 11.5 times). At the same time, the growth and transformation abilities of the modified strains were significantly improved.

[0007] Through the above analysis, the problems and defects of the existing technology are as follows:

[0008] Previous studies have found that the genetic phenotype of M. xanthus is obviously unstable, and the strain is prone to spontaneous mutations during normal generation. Summary of the Invention

[0009] In response to the problems existing in the prior art, the present invention provides a method and application for constructing a genetically stable myxobacterial expression chassis.

[0010] The present invention is achieved by a method for constructing a genetically stable myxobacterial expression chassis comprising:

[0011] Step 1: Design primers and use Myxococcus xanthus genomic DNA as a template to amplify the recA1 gene with overlapping fragments of the imuB gene upstream and downstream at both ends by overlapping PCR. Considering that imuB and the downstream gene of the operon overlap by 35 bases (atggacgtttctacctccagggactgttcgactga), the terminal 45 bases of imuB are retained during insertion to avoid affecting the expression of downstream genes.

[0012] Step 2: The amplified DNA fragment was ligated to the pbj113 knockout plasmid and electroporated into Escherichia coli. The cells were cultured on LB plates containing 50 mg / L kanamycin at 37°C for 1 day. Single clones of drug-resistant strains were selected and plasmids were extracted for the next step of gene knockout.

[0013] Step 3: The recombinant plasmid was electroporated into the wild-type Myxococcus xanthus DK1622 strain and plated onto CYE plates containing a final concentration of 30 mg / L kanamycin for 5 days at 30°C. Single clones of drug-resistant strains were selected and diluted and plated onto CYE plates containing 1% galactose for counter-screening. Single clone mutants lacking kanamycin resistance were selected on the galactose CYE plates for PCR and sequencing verification.

[0014] Deleting the imuB gene disrupts the TLS mutation mechanism and reduces the bacterial mutation rate. Simultaneously, overexpressing recA1, which has been shown to have recombination activity in Myxococcus, compensates for the effects of TLS deletion on post-replication repair. To prevent disordered recA expression from affecting genomic stability, it is placed under the control of the imuB gene promoter.

[0015] The imuB is a key gene in the bacterial DnaE2 catalyzed TLS pathway, which has been proven in previous experimental work.

[0016] Furthermore, the recA1 is a recombinase with recombinant activity that is demonstrated for the first time in this work.

[0017] Furthermore, the imuB gene promoter activity is the first promoter with regulatory function to be demonstrated.

[0018] Furthermore, the compensation for TLS deficiency may refer to compensation between two post-replication repair pathways.

[0019] Another object of the present invention is to provide a genetically stable myxobacterium expression chassis strain, which is constructed by the method described above.

[0020] Another object of the present invention is to provide a use of the genetically stable myxobacterial expression strain in expressing high GC% genes (clusters) from myxobacteria, Streptomyces, etc.

[0021] Another object of the present invention is to provide a system for constructing a genetically stable myxobacterial expression chassis comprising:

[0022] The primer design module is used to design primers to amplify the recA1 gene with overlapping fragments of the imuB gene upstream and downstream at both ends using the genomic DNA of Myxococcus xanthus as a template by overlapping PCR. Considering that imuB and the downstream genes of the operon overlap by 35 bases (atggacgtttctacctccagggactgttcgactga), the terminal 45 bases of imuB are retained during insertion to avoid affecting the expression of downstream genes;

[0023] The amplification module is used to connect the amplified DNA fragment to the pbj113 knockout plasmid, electroporate into E. coli, and culture on LB plates containing 50 mg / L kanamycin at 37°C for 1 day; select drug-resistant strain monoclones and extract plasmids for the next step of gene knockout;

[0024] The electroporation module is used to electroporate the recombinant plasmid into the wild-type Myxococcus xanthus DK1622 strain, plate it onto CYE plates containing a final concentration of 30 mg / L kanamycin, and culture it at 30°C for 5 days. Single clones of drug-resistant strains are selected and diluted and coated onto CYE plates containing 1% galactose for counter-screening. Single clone mutants without kanamycin resistance are selected on the galactose CYE plates for PCR and sequencing verification.

[0025] Another object of the present invention is to provide a computer device comprising a memory and a processor, wherein the memory stores a computer program, and when the computer program is executed by the processor, the processor performs the steps of the method for constructing a genetically stable myxobacterial expression chassis.

[0026] Another object of the present invention is to provide a computer-readable storage medium storing a computer program, which, when executed by a processor, causes the processor to perform the steps of the method for constructing a genetically stable myxobacterial expression chassis.

[0027] Another object of the present invention is to provide an information data processing terminal, which is used to implement the system for constructing a genetically stable myxobacterial expression chassis.

[0028] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0029] First, the present invention verified through gene deletion and overexpression analysis that the deletion of the TLS pathway and the overexpression of RecA can reduce the spontaneous mutation rate of the strain, and further constructed a genetically stable myxobacterium strain 2K7. The new strain not only reduced the spontaneous mutation rate by 11.5 times, but also significantly improved the growth and plasmid transformation ability of the strain. This study is the first to improve the genetic stability of myxobacteria by modifying the post-replication repair pathway. The research methods and results are innovative. Although there is no data on the use of this method for research and modification in other bacteria or eukaryotic cells, considering that the post-replication repair pathway is widely conserved in cells, the research method has universal applicability.

[0030] Secondly, besides myxobacteria, the main antibiotic-producing microorganisms currently are actinomycetes. The high GC% characteristics of their genomes limit the selection of chassis cells for the expression of their second-generation genes (clusters). This invention enables the construction of genetically stable myxobacteria. Genetically stable chassis cells based on myxobacteria will become the preferred chassis cells for expressing high GC% genes (clusters), with broad commercial value in new drug screening, biopharmaceuticals, and targeted manufacturing.

[0031] The expression of myxobacterial genes (clusters) before the present invention was mainly in the model bacteria Myxococcus xanthus. For example, the anticancer drug epothilone derived from myxobacteria was expressed in Myxococcus xanthus Ze9. Due to the genetic instability of myxococci, the state of the expressing bacteria was unstable, and the product yield was low and unstable. The myxobacterial mutation box transformation method provided by the present invention significantly improved the genetic stability of myxobacteria by balancing the post-replication repair pathway, achieving a breakthrough in myxobacterial transformation technology. At the same time, the transformed Myxococcus xanthus 2K7 retains the excellent properties of good dispersion of the model bacteria and easy genetic manipulation, and grows faster, has a lower spontaneous mutation rate, and is more resistant to stress. It fills the gap that myxobacteria do not have an excellent expression chassis.

[0032] As described in the background, myxobacteria are a class of microorganisms that, after actinomycetes, encode numerous secondary metabolites with antifungal, antibacterial, and antitumor activities, making them an important class of pharmaceutical microorganisms. However, the lack of gene expression systems based on myxobacteria, particularly the lack of genetically stable high-GC% chassis cells, has severely hampered the development of metabolites derived from myxobacteria. Our technology successfully addresses the susceptibility of myxobacterial genomes to mutations and constructs genetically stable chassis cells, overcoming key difficulties in myxobacterial expression systems and providing a suitable expression chassis for the sustained expression of high-GC% genes from myxobacteria or actinomycetes. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a flow chart of a method for constructing a genetically stable myxobacterial expression chassis provided by an embodiment of the present invention.

[0034] Figure 2 This is a system structure diagram for constructing a genetically stable myxobacterial expression chassis provided by an embodiment of the present invention.

[0035] Figure 3 Schematic diagrams of two pathways for bacterial replication fork restart provided by embodiments of the present invention. Newly synthesized DNA strands and their templates are shown in green and blue. DNA damage sites (×) and mutation sites (M) are shown in red.

[0036] Figure 4 The ImuA-ImuB-DnaE2 deletion provided in the embodiments of the present invention significantly reduces the spontaneous mutation rate of the strain.

[0037] Figure 5 This is a mutant analysis provided in the examples of the present invention. (A) Mutation frequency; (B) Survival analysis; (C) Growth curve. DK1622, wild-type Myxococcus xanthus; IA, imuA mutant; IB, imuB mutant; YL1601, dnaE2 mutant.

[0038] Figure 6 This is the modified Myxococcus xanthus 2K7 strain provided in the examples of the present invention. A. Schematic diagram of gene cluster modification; B. Spontaneous mutation rate of the strain; C. Growth curve; D. Colony appearance; E. Radiation resistance of the strain.

[0039] Figure 7 The plasmid transformation and stability analysis provided in the embodiment of the present invention is as follows: A. Plasmid stability analysis. The 2K7 strain carrying the plasmid and the wild-type DK1622 were cultured continuously, and samples were taken every 24 hours to plate the plasmid stability. B. Plasmid transformation efficiency analysis. 1x and 2x10 6 The amount of pZJY41 plasmid was transformed into an excess of Myxococcus cells (1.55 x 10 10 ) and detect the colony forming number (CFU).

[0040] Figure 8 This is the electrophoresis diagram of MXAN_2477 gene expression provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0041] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0042] like Figure 1 As shown, the method for constructing a genetically stable myxobacterial expression chassis provided by the embodiment of the present invention includes the following steps:

[0043] S101, designed primers, using Myxococcus xanthus genomic DNA as a template, to amplify the recA1 gene with overlapping fragments of the imuB gene upstream and downstream at both ends by overlapping PCR. Considering that imuB and the downstream genes of the operon overlap by 35 bases (atggacgtttctacctccagggactgttcgactga), the terminal 45 bases of imuB were retained during insertion to avoid affecting the expression of downstream genes;

[0044] S102: The amplified DNA fragment was ligated to the pbj113 knockout plasmid and electroporated into Escherichia coli. The cells were cultured on LB plates containing 50 mg / L kanamycin at 37°C for 1 day. Single clones of the drug-resistant strain were selected and the plasmids were extracted for the next gene knockout step.

[0045] S103: The recombinant plasmid was electroporated into the wild-type Myxococcus xanthus DK1622 strain and plated onto CYE plates containing a final concentration of 30 mg / L kanamycin for 5 days at 30°C. Single clones of drug-resistant strains were selected and diluted and plated onto CYE plates containing 1% galactose for counter-screening. Single clones of mutant strains lacking kanamycin resistance were selected on the galactose CYE plates and verified by PCR and sequencing.

[0046] The imuB gene was deleted to disrupt the TLS mutation mechanism and reduce the bacterial mutation rate; at the same time, recA1, which has been shown to have recombination activity in Myxococcus, was overexpressed to compensate for the effect of TLS deletion on post-replication repair; in order to prevent the disordered expression of recA from affecting genome stability, it was placed under the control of the imuB gene promoter.

[0047] The imuB provided in the embodiment of the present invention is a key gene of the bacterial DnaE2 catalyzing TLS pathway, which has been proven in previous experimental work.

[0048] The recA1 provided in the embodiments of the present invention is a recombinase with recombinant activity that has been proven for the first time.

[0049] The imuB gene promoter activity provided in the embodiment of the present invention is the first proven promoter with regulatory function.

[0050] The compensation for TLS deficiency provided by the embodiments of the present invention may refer to compensation between two post-replication repair pathways.

[0051] Another object of the present invention is to provide a genetically stable myxobacterium expression chassis strain, which is constructed by the method described above.

[0052] Another object of the present invention is to provide a use of the genetically stable myxobacterial expression strain in expressing high GC% genes (clusters) from myxobacteria, Streptomyces, etc.

[0053] like Figure 2 As shown, the system for constructing a genetically stable myxobacterial expression chassis provided by an embodiment of the present invention includes:

[0054] The primer design module is used to design primers to amplify the recA1 gene with overlapping fragments of the imuB gene upstream and downstream at both ends using the genomic DNA of Myxococcus xanthus as a template by overlapping PCR. Considering that imuB and the downstream genes of the operon overlap by 35 bases (atggacgtttctacctccagggactgttcgactga), the terminal 45 bases of imuB are retained during insertion to avoid affecting the expression of downstream genes;

[0055] The amplification module is used to connect the amplified DNA fragment to the pbj113 knockout plasmid, electroporate into E. coli, and culture on LB plates containing 50 mg / L kanamycin at 37°C for 1 day; select drug-resistant strain monoclones and extract plasmids for the next step of gene knockout;

[0056] The electroporation module is used to electroporate the recombinant plasmid into the wild-type Myxococcus xanthus DK1622 strain, plate it onto CYE plates containing a final concentration of 30 mg / L kanamycin, and culture it at 30°C for 5 days. Single clones of drug-resistant strains are selected and diluted and coated onto CYE plates containing 1% galactose for counter-screening. Single clone mutants without kanamycin resistance are selected on the galactose CYE plates for PCR and sequencing verification.

[0057] DNA mutation is the result of the combined effects of DNA damage and repair mechanisms. Various environmental and endogenous cellular stresses, including radiation, high temperature, osmotic pressure, reactive oxygen, nutrition, desiccation and quinolone antibiotics, can cause cellular DNA damage. Most DNA damage can be repaired by DNA damage repair mechanisms induced by the bacterial SOS response (including direct repair, excision repair, mismatch repair, recombination repair, etc.), while severe DNA damage or DNA damage that is not repaired in time will block normal DNA replication in cells and cause replication fork stalling. Bacteria repair stalled replication through two post-replication repair pathways (replication fork restart): error-prone translesion DNA synthesis (TLS) and template switching (TS) ( Figure 3 TS, in which RecA is involved, is highly faithful, while TLS is error-prone and is the main source of gene mutations in cells.

[0058] Previous studies have shown that the TLS mutation mechanism centered on ImuA, ImuB, and DnaE2 in Myxococcus xanthus plays a key role in cellular gene mutation. They are all DNA repair proteins induced by the SOS response and jointly participate in the error-prone TLS to restart stalled replication forks. In order to improve the genomic stability of Myxococcus xanthus, the two post-replication repair pathways were rebalanced by knocking out and overexpressing key genes. In theory, the TLS pathway catalyzed by ImuA-ImuB-DnaE2 was destroyed, reducing TLS mutations, while the TS pathway catalyzed by RecA protein was strengthened, which would achieve genome stability. The results showed that: (1) the deletion of the imuB gene can destroy the TLS mutation mechanism and reduce the mutation rate of bacteria; (2) overexpression of RecA1, which has been shown to have recombination activity in Myxococcus, can compensate for the effect of TLS deletion on post-replication repair, improve bacterial survival, and correspondingly reduce the mutation rate; (3) In order to prevent the disordered expression of recA from affecting genomic stability, it was placed under the control of the imuB gene promoter. The spontaneous mutation rate of the newly constructed strain (named 2K7) was reduced by 11.5 times. At the same time, the growth and transformation abilities of the modified 2K7 strain were significantly improved.

[0059] 1. Materials and methods

[0060] 1.1. Strains and growth conditions.

[0061] Myxococcus xanthus used in this study was cultured in CYE medium: 10 g / L casein peptone, 5 g / L yeast extract, 4 mM magnesium sulfate 7·H2O, 10 mM MOPS, pH 7.6. For solid media, 1.5% agar powder was added. For Escherichia coli, LB (Luria-Benani) medium was used: 0.5% yeast extract, 1% tryptone, 1% NaCl, adjusted to pH 7.4. For solid media, 1.5% agar was added. Myxococcus xanthus was cultured at 30°C, and E. coli strains were cultured at 37°C. Kanamycin (Kan) or ampicillin (Amp) was added to the solid or liquid media at a final concentration of 33 mg / L, as needed.

[0062] 1.2 Mutation and overexpression of Myxococcus xanthus genes

[0063] The imuB gene in Myxococcus xanthus DK1622 was replaced with the recA1 gene coding region using the pBJ113 plasmid. This plasmid contains a kanamycin resistance cassette for the first round of screening and a galK gene for negative selection. Given that imuB resides within a four-gene cluster, to minimize potential interference with upstream and downstream gene expression, the N-terminal 54bp and C-terminal 99bp of the imuB gene coding region were retained, and the intervening sequence was replaced with the recA1 gene coding region. The primers used for this genetic manipulation are as follows:

[0064]

[0065] The experimental procedures were as follows: Using the DK1622 genome as a template, DNA fragments encoding the upstream (FAup / R89), recA coding region (F89 / R91), and downstream (F91 / RAdown) genes were amplified. PCR reactions consisted of 35 cycles of denaturation at 94°C for 20 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 70 seconds. The three PCR products were mixed and annealed at 57°C. The annealed product was then used as a template to amplify the full-length 89-recA1-91 DNA fragment using primers FAup / RAdown. This fragment was inserted into the EcoRI / HindIII sites of pBJ113. The resulting plasmid was introduced into Myxococcus aureus DK1622 by electroporation (1.25 kV, 200 W, 25 mF, 1 mm cuvette gap). The strains were then plated on solid CYE plates containing 33 mg / L kanamycin to screen for kan-resistant strains. The resulting kan-resistant strains were then plated on CYE plates containing 1% galactose for a second round of screening. The resulting recombinant strain was identified and verified by PCR amplification and sequencing (designated 2K7).

[0066] Restriction enzymes, DNA ligase, and other enzymes were used according to the manufacturers' recommendations. All DNA products were verified by DNA sequencing.

[0067] 1.3 Growth and mutation rate analysis

[0068] DK1622 cells in the exponential growth phase were used to determine cell growth curves. For UV irradiation, a 15 ml cell suspension in a 130 mm glass dish was gently stirred with a magnetic rod and irradiated with UV light (UV235) at room temperature using a gradient dose. The irradiated cells were then diluted in fresh culture medium and incubated at 30°C. Cell density was measured every 12 hours to generate growth curves.

[0069] The mutation rate was determined by screening nalidixic acid-resistant strains. Briefly, approximately 5 × 10 9 10 cells of Myxococcus xanthus were plated on CYE agar containing 40 mg / L nalidixic acid. The nalidixic acid-resistant colonies were counted, and the mutation rate was calculated using the following formula: Mutation rate = number of nalidixic acid-resistant colonies / 5 × 10 9 .

[0070] 1.4 RNA extraction, RT-PCR, and RNA sequencing

[0071] Total RNA from Myxococcus xanthus cells was extracted using RNAiso Plus reagent (Takara, Beijing) according to the manufacturer's protocol. RNA concentration was quantified using a Nanodrop 2000 (Thermo Fisher Scientific, USA). cDNA was synthesized using the PrimeScript RT kit (Takara, Beijing). Genomic DNA (gDNA) was removed from the RNA samples using gDNA Eliminator (Takara, Beijing). First-strand cDNA was synthesized using PrimeScript RT enzyme with random primers according to the manufacturer's instructions.

[0072] Synthesized cDNA samples were diluted 5-fold before RT-PCR. RT-PCR was performed on an ABI StepOnePlus real-time PCR system (Thermofisher Scientific, USA) using a SYBR premix Ex Taq kit (Takara, Beijing). The gene gapA was used as an internal reference in this analysis. Genes were normalized to gapA expression and calculated using the following equation: Change (x-fold) = 2 -ΔΔCt .

[0073] 2 Results and Discussion

[0074] 2.1. ImuA-ImuB-DnaE2 deletion significantly reduced the spontaneous mutation rate of the strain

[0075] In the previous work, single gene mutants of imuA, imuB and dnaE2 were constructed in the model bacteria of myxobacteria, Myxococcus xanthus. Spontaneous mutation rate detection showed that direct deletion of ImuA-ImuB-DnaE2 can reduce the spontaneous mutation rate of bacteria ( Figure 4 A), but it also affects the ability to repair DNA damage ( Figure 4 B), which is consistent with previous literature demonstrating that ImuA-ImuB-DnaE2 is a key gene in the post-replication repair pathway. A reduction in repair capacity will affect the delay phase in bacterial growth curves, as demonstrated by growth curve tests. The effect of deletion mutants on growth was primarily a prolongation of the delay phase, while the logarithmic phase showed no significant change ( Figure 4 C).

[0076] 2.2. Expression of recAl inhibits the mutation rate of Myxococcus xanthus

[0077] As mentioned in the introduction, the TS pathway catalyzed by RecA is one of the two high-fidelity post-replication repair pathways. In theory, overexpression of RecA can promote the TS pathway and reduce the spontaneous mutation rate of cells ( Figure 3Previous studies have shown that RecA1 of myxobacteria has DNA recombination ability. Here, deletion and overexpression of RecA1 have been shown to reduce the mutation rate. Figure 5 ), which is consistent with expectations.

[0078] 2.3 Genetic modification of Myxococcus xanthus using simultaneous imuB deletion and recA1 overexpression as an expression chassis

[0079] According to previous research results [8,14], the main reason for the instability of the genome of Myxococcus aureus is the mutation system, which replaces imuB ( Figure 6 A), disrupting the myxobacterial TLS (imuA-imuB-dnaE2) pathway, reducing the spontaneous mutation rate, while overexpressing recA1 to improve the myxobacterial TS pathway. Theoretically, by balancing the two post-replication repair pathways, the normal replication fork mechanism in the cell can be achieved. The results showed that compared with the wild type (DK1622), the spontaneous mutation rate of the genome of the transformed strain (2K7) was significantly reduced ( Figure 6 B), relative to the wild type, the growth of the strain ( Figure 6 CD) and radiation resistance ( Figure 6 E) have all improved significantly.

[0080] 2.4 Transformation efficiency and plasmid stability of 2K7 strain

[0081] Plasmid pZJY41 (a laboratory-preserved shuttle plasmid) was transformed into strains DK1622 and 2K7, with pZJY41 serving as a control. In the absence of antibiotic selection, plasmid stability in the 2K7 strain was significantly improved compared to wild-type DK1622. However, the difference between the two became less pronounced with prolonged culture time, likely due to the myxobacteria entering a late stable phase, where large cell clusters affected the test results. Furthermore, transformation analysis using plasmid pZJY41 revealed improved transformation efficiency in the modified strains, with the probability of colony formation in the 2K7 strain significantly greater than in the wild-type strain. This may be due to the involvement of RecA in bacterial transformation.

[0082] Modified imuA operon sequence

[0083]

[0084]

[0085]

[0086] Applying the technical solution of the present invention, we modified the post-replication repair pathway of Myxococcus xanthus DK1622 and replaced the imuA gene (MXAN_3991) with recA1 (MXAN_1441), which not only destroyed the spontaneous mutation system of the myxobacterium, but also added a copy of the controllably expressed recA gene ( Figure 6 A). The transformed Myxococcus xanthus was named strain 2K7.

[0087] (1) The spontaneous mutation rate of the strain was significantly reduced

[0088] With reference to published literature, spontaneous mutations generated monoclonal colonies resistant to nalidixic acid as a method of detecting the frequency of random mutations. 9 10 cells of Myxococcus xanthus were plated on CYE agar containing 40 mg / L nalidixic acid. The nalidixic acid-resistant colonies were counted, and the mutation rate was calculated using the following formula: Mutation rate = number of nalidixic acid-resistant colonies / 5 × 10 9 The experimental results showed that the spontaneous mutation rate of 2K7 strain decreased by about 11.5 times compared with the model strain DK1622 ( Figure 6 B), the reduction of mutation rate improves the growth state of the strain,

[0089] (2) 2K7 strain grows faster

[0090] After 24-36 hours of activation culture, DK and 2K7 were transferred to 100 ml of CYE liquid medium respectively, and three groups were set up in parallel. Starting from 0 hours, 100 μl samples were taken every 12 hours, 6 times per bottle, and the OD was measured in a UV spectrophotometer. 600nm , until the OD value begins to decrease.

[0091] The experimental results showed that the growth of 2K7 was significantly improved, especially the delayed period of the growth curve was shortened ( Figure 6 C) It is generally believed that during the lag phase, bacteria need to repair damaged DNA to prepare for DNA replication in the subsequent logarithmic phase. Disruption of the spontaneous mutation system in myxobacteria reduces the incidence of DNA damage, explaining the shortened lag phase and accelerated growth of the 2K7 strain.

[0092] (3) The 2K7 strain has also been significantly improved in genetic manipulation

[0093] The DK1622 strain was used as a control to test the transformation efficiency of 2K7. 50 μl of early logarithmic phase bacteria were mixed with 5 μl of pZJY41 plasmid and placed in a 1 mm diameter electroporation cuvette. Transformation was performed by electroporation at 1250 V, 25 μF, and 400 Ω. The cells were shaken at 30°C for 6 h. The cells were then spread on CYE plates and CYE+Kam plates using the soft agar method and incubated inverted at 30°C for 5 days. Single colonies were counted and the transformation efficiency was calculated according to the following formula.

[0094]

[0095] Compared with DK1622, when the number of plasmids was 10 6 When the number of colonies formed by 2K7 was about 3.3 times that of DK1622, and even if the number of plasmids was doubled, the number of colonies formed by 2K7 was still 2.7 times that of the control strain, indicating a significant improvement in the transformation efficiency of the modified strain of the present invention. The recombination function of RecA is involved in the transformation of exogenous DNA, and the 2K7 strain has an additional copy of the RecA encoding gene.

[0096] (4) Determination of the copy number of plasmid pZJY41 in 2K7

[0097] As an ideal chassis, plasmid stability is a key factor. Genomic DNA was extracted from 2K7 cells and electrophoresed at 150V, 200mA, for 25 minutes. Software was used to analyze grayscale values ​​and calculate plasmid copy number.

[0098]

[0099] The results showed that the plasmid was more stable in 2K7 than in the control strain, especially in the middle and late logarithmic stages (72-96h), and the number of plasmids retained in 2K7 cells was significantly higher than that in the control strain DK1622.

[0100] (5) 2K7 was used to successfully express the myxobacterium MXAN_2477 gene, which cannot be expressed in the E. coli expression system.

[0101] The Myxococcus MXAN_2477 gene encodes a 635-amino acid membrane protein with a molecular weight of approximately 68.5 kDa. We had previously expressed this gene in E. coli, but after numerous attempts, we were unsuccessful. However, using the Myxococcus 2K7 expression strain constructed using the present invention, we successfully expressed the protein (as shown in the right half of the figure below), with a clear band appearing around 68.5 kDa, consistent with the molecular weight of the target protein.

[0102] like Figure 8 As shown, lanes 1 and 2 represent expression of the gene in Escherichia coli BL21, and lanes 4-6 represent expression of the gene in Myxococcus xanthus 2K7. C, uninduced cells served as a control; WCL, whole-cell lysate from induced expression; MW, molecular weight.

[0103] The above description is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with this technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered by the scope of protection of the present invention.

Claims

1. A method for constructing a genetically stable myxobacterial expression chassis, characterized in that: The following steps are involved: S1, designed primers, using Myxococcus xanthus genomic DNA as a template, to amplify the recA1 gene fragment with the upstream and downstream sequences of the imuB gene at both ends by overlapping PCR, wherein the terminal 45 bases of the imuB gene were retained to maintain the integrity of downstream gene expression; S2, the obtained DNA fragment was ligated to the pbj113 plasmid, electroporated into Escherichia coli, and cultured on LB plates containing 50 mg / L kanamycin at 37°C for 1 day. The drug-resistant monoclonal strain was selected and the plasmid was extracted; S3, electroporating the recombinant plasmid into wild-type Myxococcus xanthus DK1622 strain, culturing the strain at 30°C on a CYE plate containing 30 mg / L kanamycin for 5 days, picking a single clone, diluting it and coating it on a CYE plate containing 1% galactose for counter-screening, screening for mutants that are not resistant to kanamycin, and verifying the results by PCR and sequencing; S4, the above method was used to construct a Myxococcus xanthus expression chassis lacking imuB and overexpressing recA1 to reduce the spontaneous mutation rate and maintain genome stability.

2. The method according to claim 1, wherein The recA1 gene is a recombinase gene that was first demonstrated to have recombination activity in Myxococcus, and is used to compensate for the decreased post-replication repair ability caused by the loss of imuB.

3. The method according to claim 1, wherein The recA1 gene is expressed under the control of the original imuB promoter to achieve controllable regulation of its expression level and avoid genome instability caused by its disordered expression.

4. The method according to claim 1, wherein The imuB gene is a key element in the DnaE2-dependent post-transcriptional repair pathway, and its deletion is used to inhibit the error-prone mutation-sensitive repair mechanism (TLS).

5. The method according to claim 1, wherein The recA1 gene is conservatively connected to the upstream and downstream sequences of imuB via 45 bases, so as to maintain the integrity of the operon structure and avoid affecting the expression of downstream genes.

6. A genetically stable myxobacterium expression chassis strain constructed by the method according to any one of claims 1 to 5, characterized in that: The construct has imuB gene deletion and recA1 controlled expression under the imuB promoter.

7. Use of the strain according to claim 6 in expressing heterologous genes or gene clusters derived from high GC content, wherein the high GC content source comprises Streptomyces, Myxobacteria and other actinomycetes.

8. A system for constructing a genetically stable myxobacterial expression chassis, characterized in that: include: Primer design module, used to design primers for amplifying the recA1 gene and the upstream and downstream sequences of imuB; Amplification and construction modules for overlapping PCR amplification, plasmid construction, and E. coli transformation; Electroporation module, used to transfer the recombinant plasmid into Myxococcus aureus and perform resistance screening and counter-screening; Verification module, used to verify imuB gene deletion and recA1 recombination by PCR and sequencing.

9. The system according to claim 8, wherein The primer design module designs a connection segment based on the known base overlap information of imuB of Myxococcus xanthus DK1622 and its operon downstream gene to ensure the integrity of expression regulation.

10. Industrial application of the strain according to any one of claims 6 to 7 in the synthesis of natural products, antibiotics, signal molecules or other secondary metabolites.

Images