Application of GhDCP5L gene in creating high-temperature response cotton germplasm

Abstract

The invention belongs to the technical field of molecular biology breeding, and particularly relates to application of a GhDCP5L gene in creation of high-temperature response cotton germplasm, and an amino acid sequence of a protein coded by the GhDCP5L or a homologous gene thereof is as shown in SEQ ID NO.2 or SEQ ID NO.4. The invention provides a novel thermal response gene, a gene resource library of high-temperature response of cotton is enriched, the GhDCP5L gene and a homologous gene thereof are applied to plant genetic engineering breeding, and new germplasm of high-temperature-resistant or sensitive high-temperature-resistant cotton can be accurately created by regulating and controlling the expression of the gene, so that the high-temperature-resistant or sensitive high-temperature-resistant cotton is obtained. The method provides technical support for coping with stable yield of cotton under the background of global warming climate, can be used for preparing male sterile line cotton germplasm by performing high-temperature treatment on the high-temperature-sensitive material, has good application value in the aspects of cotton hybrid seed production, promotion of hybrid cotton development and the like, and is beneficial to improving the economic benefit of the cotton industry.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology breeding technology, in particular to the GhDCP5L gene or its homologous gene, and to the application of the aforementioned gene in creating high-temperature responsive cotton germplasm, especially in preparing high-temperature sensitive and male sterile cotton germplasm based on high-temperature treatment. Background Art

[0002] Cotton (Gossypium spp.) is a dicotyledonous plant, an important textile raw material, and one of the most important economic crops worldwide. Upland cotton (Gossypium hirsutum) is the most widely cultivated variety. In recent years, global warming has led to frequent extreme high temperatures, severely impacting cotton growth and development. Cotton is particularly sensitive to high temperatures during its reproductive process. High-temperature stress can affect the normal development of cotton buds and bolls, leading to abnormal anther development, reduced pollen grain activity, impaired pollination and fertilization, and decreased seed set, resulting in significant yield and quality reductions. Therefore, exploring cotton's resistance to heat stress and cultivating heat-tolerant cotton varieties are key goals in current cotton breeding.

[0003] The response of plants to high temperatures is a complex biological process. Studying the response mechanism and feedback mechanism of plants to high temperature stress and exploring the key response genes involved in the high temperature stress response process will provide an effective way to improve crops using molecular breeding and biotechnology methods and alleviate the plant growth and development stunting and yield reduction caused by high temperatures. For example, in the field of cotton heat resistance research, CRISPR / Cas9-based gene editing technology has been successfully used to regulate the expression level of heat shock protein genes (such as HSP70), thereby improving the high temperature tolerance of cotton by enhancing the heat shock response pathway. However, in the long-term artificial breeding process, most cotton varieties have mainly focused on improving traits such as yield and quality, and the selection and retention of high temperature resistance traits have been insufficient, resulting in limited genetic resources that can be used for high temperature response. Therefore, it is of great significance to develop and find new heat-responsive genes and develop corresponding molecular breeding technologies. Summary of the Invention

[0004] In response to the above-mentioned technical problems in the prior art, the present invention provides a new type of heat-responsive gene - the GhDCP5L gene and its homologous genes. By knocking out two gene fragments at the same time, it was found that the plants were more sensitive to high temperatures, indicating that the gene is regulating the high temperature resistance of cotton plants, and its normal expression is a necessary condition for maintaining the fertility of cotton under high temperatures. By regulating the expression of this gene, new high-temperature resistant or high-temperature sensitive cotton germplasms can be accurately created, providing technical support for the stable production of cotton in response to global warming. Therefore, the present invention provides the use of the aforementioned GhDCP5L gene or its homologous gene in creating high-temperature responsive germplasm, especially in preparing high-temperature sensitivity and preparing male sterile cotton germplasm based on high-temperature treatment.

[0005] The present invention is specifically implemented through the following technical solutions:

[0006] The first aspect of the present invention provides an application of the GhDCP5L gene or a homologous gene thereof in cotton breeding, wherein the application is selected from one of the following (1)-(2):

[0007] (1) Application in the preparation of high temperature responsive cotton germplasm;

[0008] (2) Application in the preparation of male sterile cotton germplasm;

[0009] The amino acid sequence of the protein encoded by the GhDCP5L gene is shown as SEQ ID NO.2, or the amino acid sequence of the protein encoded by a homologous gene of the GhDCP5L gene is shown as SEQ ID NO.4.

[0010] Furthermore, the nucleotide sequence of the GhDCP5L gene is shown as SEQ ID NO.1, or the nucleotide sequence of a homologous gene of the GhDCP5L gene is shown as SEQ ID NO.3.

[0011] Furthermore, the application includes: reducing the expression level of the GhDCP5L gene and its homologous genes, so that the fertility of the cotton anthers is reduced under high temperature.

[0012] Furthermore, the agent for reducing the expression level of the GhDCP5L gene and its homologous genes is selected from one of the following (A)-(D):

[0013] (A) sgRNA for knocking out the GhDCP5L gene and its homologous genes, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.5;

[0014] (B) a nucleic acid molecule comprising the sgRNA described in (A), wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO. 6;

[0015] (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B);

[0016] (D) A recombinant microorganism comprising the editing vector described in (C).

[0017] Furthermore, reducing the expression level of the GhDCP5L gene and its homologous genes in cotton includes the following steps: preparing an editing vector targeting the GhDCP5L gene and its homologous genes, transforming wild-type cotton plants, and cultivating transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes.

[0018] Furthermore, the preparation method of the editing vector includes the following steps: connecting the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6 to the pRGEB32-GhU6.9-NPT II expression vector through a homologous recombination reaction to obtain the editing vector.

[0019] Furthermore, the cotton is upland cotton.

[0020] A second aspect of the present invention provides a method for preparing high-temperature sensitive cotton germplasm, comprising the following steps:

[0021] An editing vector targeting the GhDCP5L gene and its homologous genes is prepared, and wild-type cotton plants are transformed to obtain transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes. The editing vector contains the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6.

[0022] A third aspect of the present invention provides a method for preparing male sterile cotton germplasm, comprising the following steps:

[0023] Prepare an editing vector targeting the GhDCP5L gene and its homologous genes, transform wild-type cotton plants, and cultivate transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes, wherein the editing vector comprises the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6;

[0024] The transgenic cotton plants are placed at a temperature of 35° C. or above for 3 days or more to obtain male sterile cotton plants.

[0025] The fourth aspect of the present invention provides the use of an agent for reducing the expression level of the GhDCP5L gene and its homologous genes in cotton breeding, wherein the use is selected from one of the following (1)-(2):

[0026] (1) Application in the preparation of high temperature sensitive cotton germplasm;

[0027] (2) Application in the preparation of male sterile cotton germplasm;

[0028] Wherein, the agent for reducing the expression level of the GhDCP5L gene and its homologous genes is selected from one of the following (A)-(D):

[0029] (A) sgRNA for knocking out the GhDCP5L gene and its homologous genes, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.5;

[0030] (B) a nucleic acid molecule comprising the sgRNA described in (A), wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO. 6;

[0031] (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B);

[0032] (D) A recombinant microorganism comprising the editing vector described in (C).

[0033] The advantages and positive effects of the present invention are:

[0034] The present invention provides a novel heat-responsive gene, the GhDCP5L gene, which enriches the gene resource library of cotton high-temperature response and is an important gene resource that can be used for cotton breeding resistant to high-temperature stress. The GhDCP5L gene and its homologous genes are applied to plant genetic engineering breeding. By positively regulating the expression of the gene, it is of great significance to creating new high-temperature-resistant cotton germplasm and guiding the improvement of cotton high-temperature resistance. By negatively regulating the expression of the gene, the sensitivity of the plant to high temperature is enhanced, and a new high-temperature-sensitive cotton germplasm can be created. The created temperature-sensitive mutants are easy to identify, and high-temperature-sensitive materials are subjected to high-temperature treatment to prepare male sterile cotton germplasm. The gene has good application value in cotton hybrid seed production, promoting hybrid cotton development, etc., and is conducive to improving the economic benefits of the cotton industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0036] Figure 1 This is a sequence edited image of a T0 generation cotton plant mutant with GhDCP5L and its homologous genes knocked out in the embodiment of the present invention;

[0037] Figure 2 This is a graph showing the editing efficiency detection of individual cotton plants in the T0 generation with GhDCP5L and its homologous genes knocked out in the examples of the present invention;

[0038] Figure 3 Figures 1 and 2 are phenotypes of anthers and pollen activity of individual T0 generation mutant cotton plants with GhDCP5L and its homologous genes knocked out in the examples of the present invention; wherein, Figures A and C are anthers of individual wild-type Jin 668 plants under normal temperature and high temperature treatments, Figures B and D are anthers of individual GhDCP5L and its homologous gene knocked out mutant cotton plants under normal temperature and high temperature treatments, Figures a and c are staining images of pollen activity of individual wild-type Jin 668 plants under normal temperature and high temperature treatments, respectively, and Figures b and d are staining images of pollen activity of individual wild-type GhDCP5L and its homologous gene knocked out mutant cotton plants under normal temperature and high temperature treatments, respectively.

[0039] Figure 4 This is a sequence edited image of a single cotton plant in the T1 generation with GhDCP5L and its homologous genes knocked out in the embodiment of the present invention;

[0040] Figure 5 This is a graph showing the editing efficiency detection of individual cotton plants in the T1 generation of mutants with GhDCP5L and its homologous genes knocked out in the examples of the present invention;

[0041] Figure 6 These are the anther and pollen activity phenotypes of individual T1-generation mutant cotton plants with GhDCP5L and its homologous genes knocked out in the examples of the present invention; wherein, Figures A and C are anthers of individual wild-type Jin 668 plants under normal temperature and high temperature treatments, respectively; Figures B and D are anthers of individual mutant cotton plants with GhDCP5L and its homologous genes knocked out under normal temperature and high temperature treatments, respectively; Figures a and c are pollen activity staining images of individual wild-type Jin 668 plants under normal temperature and high temperature treatments, respectively; and Figures b and d are pollen activity staining images of individual wild-type mutant cotton plants with GhDCP5L and its homologous genes knocked out under normal temperature and high temperature treatments, respectively.

[0042] Figure 7 This is a toluidine blue-stained image of anther tissue section of a single T1-generation mutant cotton plant with GhDCP5L and its homologous genes knocked out in the examples of the present invention, wherein TS: tetrad stage, TDS: tapetum degradation stage, ADS: anther dehiscence stage, T: tapetum, Msp: microspore, En: inner wall of the anther chamber, St: fissure, PG: pollen grain, Tds: tetrad, ML: middle layer, E: epidermis; scale bar: 50 μm. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0044] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0045] For a better understanding of the present invention and not to limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to express amounts, percentages, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant digits and by conventional rounding methods.

[0046] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those skilled in the art.

[0047] The terms "include", "comprising", "containing", "having" and the like are non-limiting in meaning, that is, other steps and other components that do not affect the results may be added.

[0048] The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0049] The term "gene" is the entire nucleotide sequence required to produce a polypeptide chain or functional RNA. Thus, gene expression includes transcription and the stable accumulation of coding RNA (mRNA) or functional RNA derived from the gene, and can also refer to the translation of mRNA into a polypeptide or protein.

[0050] The term "cDNA" refers to a DNA molecule that is reverse-transcribed and complementary to an RNA molecule (such as mRNA) (first-strand cDNA) or a DNA molecule that has the same sequence as an RNA molecule except that U is replaced by T (second-strand cDNA). cDNA is a sequence with no introns and only exons.

[0051] The term "vector" refers to a self-replicating DNA molecule that transfers an exogenous gene of interest into a host organism, often in the form of a circular double-stranded DNA molecule. A vector containing a gene of interest is a recombinant vector. Typical vectors include plasmids, viruses, bacteriophages, cosmids, and minichromosomes. Plasmids are the most common form of vector; therefore, in the context of this invention, the terms plasmid and vector are used interchangeably.

[0052] The term "expression vector" allows an exogenous target gene inserted into the vector to be expressed in a host organism. When the expression vector is introduced into a suitable host organism, the inserted target gene can be expressed.

[0053] The term "introduction" or "transfer" refers to the transfer of a target gene or nucleic acid molecule (such as an editing vector targeting the GhDCP5L gene) into a host organism, resulting in genetically stable inheritance. The imported nucleic acid molecule can be in the form of a plasmid retained in the host organism, or can be integrated into the host organism genome. Host organisms containing the introduced gene are referred to as "transgenic" or "recombinant" or "transformed" organisms or "engineered" organisms. The introduction of expression vectors into host organisms can be carried out using conventional techniques well known to those skilled in the art.

[0054] The terms "knockout," "silencing," or "inhibition" and similar expressions have the same meaning, referring to the reduction of gene expression below normal levels or the inability to express a gene normally. This is often achieved by inserting or deleting a portion of a nucleic acid sequence, causing a frameshift mutation, which in turn inhibits target gene expression and leads to phenotypic changes in the organism. Common methods for gene knockout include homologous recombination, CRISPR / Cas9, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs).

[0055] The term "high temperature stress" refers to a high temperature environment that is not conducive to plant growth and development, and even inhibits plant life activities. When the ambient temperature exceeds the temperature range that the plant can adapt to and lasts for a period of time, it will cause irreversible damage to the growth and development of the plant, which is also called high temperature injury or heat damage. High temperature is a major abiotic stress factor. High temperature refers to a temperature that is more than 5°C higher than the suitable growth temperature of the plant. For example, the suitable growth temperature of cotton is 25-30°C, and the weather phenomenon in which the maximum daily temperature reaches or exceeds 35°C is generally called high temperature. Continuous high temperatures above 35°C will seriously affect the development of pollen in cotton buds, causing male sterility problems such as pollen grain deformity, anther failure, and pollen abortion, affecting the pollination and fertilization process.

[0056] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0057] Earlier transcriptome analysis revealed that GhDCP5L (CottonMD gene ID: Ghir_D05G021310) is significantly upregulated during the anther tetrad stage under high temperature conditions. However, the function of the cotton gene GhDCP5L and its role in regulating high temperature tolerance have not yet been reported.

[0058] The present invention utilizes the CRISPR / Cas9 gene editing system to construct loss-of-function mutants of the GhDCP5L gene and its homologous genes in upland cotton. The results show that transgenic upland cotton plants are essentially identical to wild-type phenotypes at room temperature. However, after three days of high-temperature treatment at 35°C, the pollen activity and anther dehiscence index of the transgenic upland cotton plants are significantly lower than those of the wild-type. When their pollen mother cells develop to the tetrad stage, they exhibit abnormal tetrad morphology, and pollen structure is abnormal during the tapetum degradation and anther dehiscence stages, ultimately leading to pollen abortion. These results reveal from a reverse genetics perspective that the GhDCP5L gene positively regulates cotton's high-temperature resistance and is essential for maintaining cotton fertility under high temperatures. Its normal expression helps alleviate the adverse effects of high temperatures on cotton's phenotypic growth and development, such as flowering and bud formation. Knocking out this gene reduces cotton's tolerance to high-temperature stress, manifesting as pollen sensitivity to high temperatures. Pollen activity and anther dehiscence rates are significantly reduced after high-temperature stress, resulting in decreased plant fertility and even male sterility.

[0059] The present invention provides a new type of heat-responsive gene, which enriches the gene resource library of cotton high-temperature response and is an important gene resource that can be used for cotton breeding resistant to high-temperature stress. The GhDCP5L gene and its homologous genes are applied to plant genetic engineering breeding, which can accurately create new cotton germplasms with different high-temperature tolerance, and provide technical support for the stable production of cotton in response to global climate warming. Specifically, by positively regulating the expression of this gene, it is of great significance to create new high-temperature resistant cotton germplasms and guide the improvement of cotton high-temperature resistance, while by negatively regulating the expression of this gene, sensitive high-temperature cotton germplasms can be created, and after a period of high-temperature treatment of the sensitive high-temperature cotton germplasm, a new male sterile cotton germplasm can be prepared, which has good application value in cotton hybrid seed production, promoting the development of hybrid cotton, etc., and is conducive to improving the economic benefits of the cotton industry.

[0060] On this basis, an embodiment of the present invention provides a GhDCP5L gene or a homologous gene thereof, wherein the amino acid sequence of the protein encoded by the GhDCP5L gene is shown as SEQ ID NO.2, or the amino acid sequence of the protein encoded by the homologous gene of the GhDCP5L gene is shown as SEQ ID NO.4.

[0061] The nucleotide sequence of a gene can usually be deduced based on the amino acid sequence of a protein through conventional means such as codon encoding rules.

[0062] Optionally, the nucleotide sequence of the GhDCP5L gene is shown as SEQ ID NO.1, or the nucleotide sequence of a homologous gene of the GhDCP5L gene is shown as SEQ ID NO.3.

[0063] Those skilled in the art will understand that due to the degeneracy of the genetic code, nucleotide sequences different from the above examples can also encode the protein of the present invention. Therefore, the above examples of nucleotide sequences should not be used as a limitation on the scope of protection of the present invention.

[0064] The present invention also provides an embodiment of the application of the GhDCP5L gene or its homologous gene in cotton breeding, wherein the application is selected from one of the following (1)-(2): (1) application in preparing high temperature responsive cotton germplasm; (2) application in preparing male sterile cotton germplasm.

[0065] The present invention analyzes how the GhDCP5L gene or its homologous genes act as positive regulatory factors to regulate high-temperature resistance in cotton. By enhancing the expression of the GhDCP5L gene and its homologous genes, it is beneficial to create new high-temperature-resistant cotton germplasm. By reducing or inhibiting the expression of the GhDCP5L gene and its homologous genes, the plant's sensitivity to high temperatures will be enhanced, and the temperature-sensitive mutants created by the present invention are easy to identify. Field observations show that plants in which the GhDCP5L gene and its homologous genes were knocked out using gene editing technology have anthers that do not open or release pollen after being subjected to high-temperature stress, and the anthers and stigmas are smooth, showing significant phenotypic differences compared to wild-type plants and making them easy to distinguish. In addition, due to abnormal anther development, the fertility of the high-temperature-sensitive cotton germplasm of the present invention is significantly reduced at high temperatures. Therefore, it can be used to create male sterile cotton germplasm.

[0066] The application includes: reducing the expression level of the GhDCP5L gene and its homologous genes, thereby reducing the fertility of cotton anthers under high temperature; wherein, reducing the expression level of the GhDCP5L gene and its homologous genes includes knocking out the GhDCP5L gene and its homologous genes in cotton or reducing the content of GhDCP5L protein in cotton.

[0067] Optionally, the reagents for reducing the expression level of the GhDCP5L gene and its homologous genes include but are not limited to: (A) sgRNA for knocking out the GhDCP5L gene and its homologous genes, the nucleotide sequence of the sgRNA being shown as SEQ ID NO.5; (B) a nucleic acid molecule comprising the sgRNA in (A), the nucleotide sequence of the nucleic acid molecule being shown as SEQ ID NO.6; (C) an editing vector comprising the sgRNA in (A) or the nucleic acid molecule in (B); (D) a recombinant microorganism comprising the editing vector in (C).

[0068] Specifically, reducing the expression level of the GhDCP5L gene and its homologous genes in cotton includes the following steps: preparing an editing vector targeting the GhDCP5L gene and its homologous genes, transforming wild-type cotton plants, and cultivating transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes.

[0069] More specifically, the method for preparing the editing vector includes the following steps: connecting the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6 to the pRGEB32-GhU6.9-NPT II expression vector through a homologous recombination reaction to obtain the editing vector.

[0070] The above-mentioned editing vector is used to transform wild-type cotton plants using conventional techniques well known to those skilled in the art. Specifically, it can be introduced into cotton cells or tissues by using the following DNA transfection methods: calcium phosphate co-precipitation method, Ti plasmid method, Ri plasmid method, viral vector method, gene gun method, microinjection method, electroporation method or Agrobacterium-mediated method, etc.

[0071] Another embodiment of the present invention provides a method for preparing high-temperature sensitive cotton germplasm, comprising the following steps:

[0072] An editing vector targeting the GhDCP5L gene and its homologous genes is prepared, and wild-type cotton plants are transformed to obtain transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes. The editing vector contains the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6.

[0073] Another embodiment of the present invention provides a method for preparing male sterile cotton germplasm, comprising the following steps:

[0074] Prepare an editing vector targeting the GhDCP5L gene and its homologous genes, transform wild-type cotton plants, and cultivate transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes, wherein the editing vector comprises the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6;

[0075] The transgenic cotton plants are placed at a temperature of 35° C. or above for 3 days or more to obtain male sterile cotton plants.

[0076] In the present invention, the cotton variety is Gosspyium hirsutum, and the high temperature is a temperature 25-30°C higher than the suitable growth temperature of cotton, for example, 35°C.

[0077] Another embodiment of the present invention provides an application of a reagent for reducing the expression level of the GhDCP5L gene and its homologous genes in cotton breeding, wherein the application is selected from one of the following (1)-(2): (1) application in preparing high-temperature sensitive cotton germplasm; (2) application in preparing male sterile cotton germplasm;

[0078] Among them, the reagent for reducing the expression level of the GhDCP5L gene and its homologous genes is selected from one of the following (A)-(D): (A) sgRNA for knocking out the GhDCP5L gene and its homologous genes, the nucleotide sequence of the sgRNA being shown as SEQ ID NO.5; (B) a nucleic acid molecule comprising the sgRNA in (A), the nucleotide sequence of the nucleic acid molecule being shown as SEQ ID NO.6; (C) an editing vector comprising the sgRNA in (A) or the nucleic acid molecule in (B); (D) a recombinant microorganism comprising the editing vector in (C).

[0079] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0080] Example

[0081] Plant materials: The cotton material used for the transformation and editing vector is Gossypium hirsutum Jin668, a heat-resistant germplasm resource derived from the Cotton Reproductive Development Group of the National Key Laboratory of Crop Genetic Improvement. The public can obtain relevant germplasm resources from the applicant for use only in repeating the experiments of this invention and may not be used for other purposes.

[0082] Genes and primers: The sequences of relevant primers used in the construction of GhDCP5L and its homologous genes, encoded proteins, and gene editing vectors are shown in Table 1.

[0083] Table 1 Sequences of GhDCP5L and its homologous genes and related primers in the examples of the present invention

[0084]

[0085] 1. GhDCP5L gene and its homologous genes

[0086] In preliminary studies of this invention, transcriptome comparisons were conducted between pollen and anthers of the heat-sensitive upland cotton line 'H05' and other tissue types under normal temperature conditions. The differentially expressed genes in 'H05' pollen under normal and high temperature conditions were analyzed. Transcriptome analysis revealed that GhDCP5L was significantly upregulated during the anther tetrad stage under high temperature conditions. However, the function of the cotton gene GhDCP5L and its role in regulating heat tolerance have not yet been reported.

[0087] In the Cotton Multi-Omics Database (CottonMD), the GhDCP5L gene ID is Ghir_D05G021310, and its homologous gene ID is Ghir_A05G026930. The corresponding nucleotide sequences are shown in SEQ ID NOs. 1-2, respectively. Because this gene shares high homology with the AT1G26110 gene (NCBI accession number NP_564239.1) in Arabidopsis, which encodes the DCP5 protein involved in flowering regulation, the gene was named Gossypium hirsutum DCP5 Like (abbreviated as GhDCP5L) based on their similarity.

[0088] 2. Design of sgRNA targeting GhDCP5L gene and its homologous genes

[0089] The conserved region of the GhDCP5L gene in upland cotton was selected to design the target site sgRNA, the nucleotide sequence of which was GGTGGTGGTGTAGGCAATAAGGG (see SEQ ID NO. 5), and the bases in bold were the protospacer adjacent motifs (PAM).

[0090] 3. Construction of editing vector targeting GhDCP5L gene

[0091] The above-mentioned sgRNA is connected to the expression vector through a polycistronic tRNA-gRNA method to obtain an editing vector, which carries a tRNA-gRNA fusion fragment (nucleotides are shown in SEQ ID NO.6). The editing vector and the Cas9 encoding gene are then co-transformed into the host cell to achieve gene editing. This is a routine technique in the art and will not be described in detail here.

[0092] The present invention preferably constructs the tRNA-gRNA fusion fragment into the pRGEB32-GhU6.7-NPT II vector containing the Cas9 encoding gene. The construction method of the expression vector pRGEB32-GhU6.9-NPT II is described in the literature "Wang P, Zhang J, Sun L, et al. High efficiency multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR / Cas9 system [J]. Plant Biotechnology Journal, 2018, 16(1): 137-150" and the patent "CN108203714A A cotton gene editing method (publication date: 2018-06-26)". Of course, those skilled in the art can also construct the sequence shown in SEQ ID NO.6 into other expression vectors.

[0093] Using the expression vector pRGEB32-GhU6.9-NPTII as an example, forward primer P1 and reverse primer P2 (nucleotide sequences shown in SEQ ID NOs. 7-8) were first amplified to obtain the tRNA-gRNA product (nucleotide sequence: aagcatcagatgggcaAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTAC AGACCCGGGTTCGATTCCCGGCTGGTGCAGGTGGTGGTGTAGGCAATAAGGGGTTTTAG AGCTAGAA, where lowercase bases indicate sequences homologous to the vector). The amplification system included: Buffer 2 μL, dNTPs (10 mM) 0.3 μL, forward primer P1 (10 μM) 0.2 μL, reverse primer P2 (10 μM) 0.2 μL, Taq Enzyme 0.2 μL, PGTR plasmid 1 μL, and double-distilled water 16.1 μL; the total volume was 20 μL. PCR conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 20 sec, for a total of 3 cycles; then 95℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 20 sec, for a total of 27 cycles, 72℃ extension for 5 min, and the resulting PCR product was stored. The relevant research results of PGTR plasmid were published in the literature "Xie K, Minkenberg B, Yang Y. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system [J]. Proceedings of the National Academy of Sciences of the United States of America, 2015, 112 (11): 3570-3575."

[0094] The amplified product was then constructed into the pRGEB32-GhU6.9-NPT II expression vector using a one-step cloning method based on homologous recombination. The expression vector was digested with BsaI (purchased from Beijing NEB, Cat. No. R3733L), and the linearized pRGEB32-GhU6.9-NPT II expression vector and the tRNA-gRNA amplified product were ligated using the ClonExpress Entry Step Cloning Kit (purchased from Nanjing Novozymes Biotechnology Co., Ltd.) to obtain editing vectors for the GhDCP5L gene and its homologous genes. The ligation system consisted of 100 ng of tRNA-gRNA amplified product, 100 ng of linearized pRGEB32-GhU6.9-NPTII expression vector, 0.5 μL of Exnase enzyme, and 1.0 μL of CE buffer. The mixture was incubated at 37°C for 30 min and placed on ice for 5 min to obtain the ligated editing vectors. The editing vector was transformed into Agrobacterium GV3101 competent cells, and positive clones were identified by PCR after kanamycin resistance screening. Finally, sequencing was performed using U6-7-F as the forward primer and 1310-R as the reverse primer (nucleotide sequence shown in SEQ ID NO.9-10) to verify that the vector construction was correct.

[0095] 4. Agrobacterium-mediated transformation of cotton cells with the editing vector targeting the GhDCP5L gene

[0096] The constructed editing vector was introduced into the host cells of upland cotton Jin 668 through Agrobacterium-mediated transformation. The specific transformation steps are as follows: (1) Select plump and healthy seeds of upland cotton Jin 668, peel off the seed coat, soak them in 0.1% HgCl2 for 10 minutes, and then wash them with sterile water three times. The sterilized cotton seeds are inoculated on sterile seedling germination medium and cultured in a 28°C constant temperature box under dark conditions for 4-6 days; (2) Take the hypocotyls of sterile seedlings, cut them into 0.5-0.8 cm small segments, and inoculate them in Agrobacterium liquid with an OD value of 0.5. After infection for 10 minutes, use sterile filter paper to dry the liquid on the surface of the hypocotyls; (3) Inoculate the hypocotyls in co-cultivation medium and co-cultivate them at 21°C for 48 hours; transfer them to selection medium and subculture them once every month until embryonic callus tissue is obtained; transfer the embryonic callus tissue to differentiation medium to obtain a large number of embryoids; (4) Transfer the obtained embryoids to embryo germination and seedling culture medium until transgenic plant seedlings are obtained.

[0097] Transformation medium components and preparation methods: (1) sterile seedling germination medium: 1 / 2 Murashige and Skoog medium (1 / 2 MS medium), 15g / L glucose, 2.5g / L Phytagel; pH value is 6.1-6.2; (2) callus induction medium: Murashige and Skoog minimal medium + B5 vitamins (MSB medium), 2,4-dichlorophenoxyacetic acid (2,4-D) 0.1 mg / L, kinetin (KT) 0.1 mg / L, 3% glucose, 0.3% phytagel; pH value is 5.85-5.95; (3) Agrobacterium activation medium: tryptone 5 g / L, sodium chloride (NaCl) 5 g / L, magnesium sulfate heptahydrate (MgSO4·7H2O) 0.1 g / L, potassium dihydrogen phosphate (KH2PO4) 0.25 g / L, mannitol 5 g / L, glycine 1.0 g / L; pH value is 5.85-5.95; (4) co-culture medium: MSB medium, 2,4-D 0.1 mg / L, KT 0.1mg / l, 50mg / L acetosyringone (AS), 3% Glucose, 0.25% Phytagel, pH 5.8; (5) Selection medium: MSB medium, 2,4-D 0.1mg / L, KT0.1mg / L, 3% Glucose, 0.3% Phytagel, kanamycin 50mg / L, cephalosporin 400mg / L; pH 5.85-5.95; (6) Differentiation medium: remove ammonium nitrate (NH4NO3) from MSB medium, double the amount of potassium nitrate (KNO3), glutamine (Gln) 1.0g / L, asparagine (Asn) 0.5g / L, indolebutyric acid (IBA) 0.5mg / L, KT 0.15mg / L, 3% Glucose, 0.25% Phytagel; pH value is 6.1-6.2; (7) Rooting medium: 1 / 2MS medium, B5 organic matter, 15g / L glucose, 2.5g / L Phytagel; pH value is 5.90-5.95.

[0098] 5. Detection of editing efficiency in T1 transgenic cotton plants

[0099] To confirm whether the mutations generated by the edited T0 cotton plants were inherited by the T1 generation, DNA was extracted from each T1 plant. Using the DNA from each plant as a template, PCR amplification was performed using the Cas9 gene detection primers Cas9-F and Cas9-R (nucleotide sequences shown in SEQ ID NOs. 11-12). The PCR products were electrophoresed on a 1.0% TAE agarose gel (5 μL sample volume). A band of approximately 600 bp was amplified, indicating that the plant was edited. A total of 66 positive plants and 24 negative plants were obtained, for a positive rate of 73.3%.

[0100] 6. Detection of editing effects in T0-T1 generation transgenic cotton plants and phenotypic changes under high temperature stress

[0101] In order to detect the gene editing status of the regenerated plants, primers were designed to amplify the flanking sequences of sgRNA, and the products were sequenced by high-throughput sequencing. The relevant primer sequences used for amplification were forward primer P3 and reverse primer P4 (nucleotide sequences are shown in SEQ ID NO.13-14).

[0102] Figure 1 The figure shows the editing status of genes in T0 cotton plants, with the sgRNA target site and PAM region highlighted in green and red backgrounds, respectively, and the number of base deletions indicated on the right. The figure shows that all mutations are base deletions, ranging from 1 to 13 bases (bp). The statistical results are shown in Table 2. The left column of the table shows the T0 plant number, and the right column shows the number of base deletions that occurred after the plants were edited. "-" indicates deletions.

[0103] Table 2 Statistics of editing status of different single plants at T0

[0104]

[0105] The transgenic cotton material CRGhDCP5L-44-7 with high editing efficiency in the T0 generation was selected (see Figure 2 , where "Substitutions" represents substitutions, "Inertions" represents insertions, "Deletions" represents deletions, and "Predicted cleavage positions" represents predicted cleavage positions) and wild-type Jin 668 were subjected to high-temperature treatment. The treatment conditions were as follows: Plants in the flowering stage were considered to have been subjected to high-temperature treatment if they were exposed to an ambient temperature greater than 35°C for three consecutive days. Plants treated at room temperature (ambient temperature below 35°C) served as controls.

[0106] Observe pollen activity and anther dehiscence phenotypes at room temperature and high temperature. Pollen activity was observed using the TTC staining method. For specific procedures, see patent "CN109752226A A method for rapid quantification of pollen activity at room temperature or high temperature and its application (publication date: 2019-05-14)". The brief steps are as follows: Take 8 grams of TTC (2,3,5-triphenyltetrazolium chloride, molecular weight 334.8) and dissolve it in 1L of phosphate buffer (26.6g of dipotassium hydrogen phosphate trihydrate and 10.2g of dipotassium hydrogen phosphate) to prepare a 2% working solution. Store at 4°C in the dark. When used, divide the solution into 2mL centrifuge tubes, insert the anthers, darken for 30 minutes, and then remove and observe under a microscope.

[0107] The results of anther and pollen activity phenotypes of wild type and T0 generation mutant cotton are shown in Figure 3 , where NT stands for normal temperature and HT stands for high temperature. Figures AD show the anthers of wild-type (WT) Jin 668 and mutant cotton plants with GhDCP5L and its homologous genes knocked out under normal and high temperature treatments, respectively. The scale bar is 1 cm. Figures ad show the TTC staining of pollen viability of WT and mutant cotton plants under normal and high temperature treatments, respectively. The scale bar is 100 μm. It can be seen that under normal temperature conditions, the pollen viability and anther dehiscence phenotype of the gene-edited plant CRGhDCP5L-44-7 are consistent with those of Jin668 and are normal. However, after three days of high temperature treatment above 35°C, the pollen viability and anther dehiscence index of the gene-edited plant CRGhDCP5L-44-7 were significantly lower than those of Jin668, showing a male sterile phenotype.

[0108] The edited materials with obvious phenotypes were self-pollinated to obtain T1 generation plants, and high-throughput sequencing technology was used to further detect the editing status of the T1 generation. Figure 4 The editing status of genes in T1 generation cotton is shown. The statistical results of all edited plants in T1 generation are shown in Table 3. The results show that T1 generation has the same editing status as T0 generation, but some new editing types have been generated, and the editing types are still mainly deletions.

[0109] Table 3 Statistics of editing status of different T1 plants

[0110]

[0111]

[0112] At the same time, the plant CRGhDCP5L44-7-25 with higher editing efficiency in the T1 generation was selected (see Figure 5 ). The pollen activity and anther dehiscence phenotype were observed at room temperature and high temperature. Figure 6NT stands for normal temperature, and HT stands for high temperature. Figures A to D show individual anthers of wild-type (WT) Jin 668 and T1-generation mutant cotton plants with GhDCP5L and its homologous genes knocked out under normal and high temperature treatments, respectively. Scale bar: 1 cm. Figures A to D show TTC staining of pollen viability of individual WT and T1-generation mutant cotton plants under normal and high temperature treatments, respectively. Scale bar: 100 μm. As can be seen, under high temperature conditions, the pollen viability and anther dehiscence phenotype of the gene-edited plant CRGhDCP5L44-7-25 were significantly lower than those of the wild-type Jin668. After three days of exposure to temperatures exceeding 35°C, the gene-edited plant CRGhDCP5L-44-7-25 produced almost no pollen, and its anthers did not dehiscence at all.

[0113] 7. Observation of anther sections of T0-T1 transgenic cotton plants

[0114] The specific steps of paraffin tissue sectioning are as follows: (1) Fixation: Take flower buds of different lengths and fix them in 1L of 50% FAA prepared in ddH2O (37% formaldehyde: glacial acetic acid: anhydrous ethanol: ddH2O = 250:25:225:500, unit: mL), after 4 times of 5 minutes of vacuum, fix at 4 ° C for 12-16 hours; (2) Dehydration: Dehydrate with different gradients of tert-butyl alcohol (10% → 20% → 35% → 50% → 75% → 100%), each level for 2 hours (3) Preheat tert-butyl alcohol at 65°C to melt paraffin wax, pour out the tert-butyl alcohol liquid in the centrifuge tube and replace it with 50% tert-butyl alcohol + 50% paraffin wax mixed penetrant. After treatment, place it in a 65°C oven and bake for at least 24 hours. (4) Wax dipping: replace all 50% tert-butyl alcohol + 50% paraffin wax in the centrifuge tube with paraffin wax, and change it at least 4 times to ensure that the paraffin wax is completely immersed in the tissue. (5) Embedding: Pre-fold a paper box of appropriate size according to the sample, melt fresh paraffin wax on an induction cooker and place it in a constant temperature box at 60°C for 24 hours. The temperature of the embedded liquid paraffin should not be too high to avoid burning the tissue. When embedding, first spread a layer of embedding wax about 1 cm thick. If the wax block is too thick, it will be difficult to trim the block. Then pour the sample into a paper box and use tweezers to arrange the sample evenly. Let the material cool naturally. The wax block can be stored for a long time. (6) Trimming: Take the wax block out of the paper box and trim the sample wax block into a horizontal or vertical direction as needed. The cut surface of the microtome blade should be rectangular, otherwise it will be difficult to form a wax strip. (7) Slicing: Wipe the blade with xylene and slice. The thickness is 10 μm. 2 mg / mL poly-lysine is coated on the glass slide. 60°C preheated water is added on top. A wax sheet is placed on the wax sheet. Excess water is absorbed from the wax sheet and the sheet is quickly placed in a 45°C oven for at least 24 hours. (8) Staining: Stain with 0.5% toluidine blue for 20 minutes. (9) Sealing: Operate in a fume hood. Use a pipette to take neutral gum and drop it on the dried slice. Cover with a coverslip and place in a 37°C constant temperature box for more than 12 hours. After the gum solidifies, observe under a microscope.

[0115] from Figure 3 and Figure 6 The phenotypic results of gene-edited T0 and T1 plants showed that the pollen of the edited transgenic material had poor viability after TTC staining, while the wild type had good viability after TTC staining. Anther sections of wild type and T1 high-editing efficiency plants were observed at three important stages (tetrad stage (TS), tapetum degradation stage (TDS), and anther dehiscence stage (ADS)). Figure 7 , where TS represents the tetrad stage, TDS represents the tapetum degradation stage, ADS represents the anther dehiscence stage, T represents the tapetum, Msp represents microspores, En represents the inner wall of the anther lining, St represents the fissure, PG represents pollen grains, Tds represents the tetrad, ML represents the middle layer, and E represents the epidermis. Scale bar: 50 μm. The results further showed that, at room temperature, high-editing-efficiency accessions showed no morphological differences compared to the control and were able to form normal pollen grains. However, under high-temperature stress, tetrad morphology was abnormal during tetrad development, and pollen structure was abnormal during the tapetum degradation and anther dehiscence stages, ultimately leading to pollen abortion.

[0116] In summary, the GhDCP5L gene and its homologous genes in cotton positively regulate the high temperature resistance of cotton anthers. By simultaneously knocking out the GhDCP5L gene and its homologous gene fragments in cotton, single plants that are more sensitive to high temperature can be created. After high temperature treatment, the mutant single plants exhibit a male sterile phenotype with pollen abortion.

[0117] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of the GhDCP5L gene or its homologous gene in cotton breeding, characterized in that: The application is selected from one of the following (1)-(2): (1) Application in the preparation of high temperature responsive cotton germplasm; (2) Application in the preparation of male sterile cotton germplasm; The amino acid sequence of the protein encoded by the GhDCP5L gene is shown as SEQ ID NO.2, or the amino acid sequence of the protein encoded by a homologous gene of the GhDCP5L gene is shown as SEQ ID NO.

4.

2. The use of the GhDCP5L gene or its homologous gene in cotton breeding according to claim 1, characterized in that: The nucleotide sequence of the GhDCP5L gene is shown as SEQ ID NO.1, or the nucleotide sequence of a homologous gene of the GhDCP5L gene is shown as SEQ ID NO.

3.

3. The use of the GhDCP5L gene or its homologous gene in cotton breeding according to claim 1, characterized in that: The application includes: reducing the expression level of the GhDCP5L gene and its homologous genes, so as to reduce the fertility of the cotton anthers under high temperature.

4. The use of the GhDCP5L gene or its homologous gene in cotton breeding according to claim 3, characterized in that: The agent for reducing the expression level of the GhDCP5L gene and its homologous genes is selected from one of the following (A) to (D): (A) sgRNA for knocking out the GhDCP5L gene and its homologous genes, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.5; (B) a nucleic acid molecule comprising the sgRNA described in (A), wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO. 6; (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B); (D) A recombinant microorganism comprising the editing vector described in (C).

5. The use of the GhDCP5L gene or its homologous gene in cotton breeding according to claim 3, characterized in that: Reducing the expression level of the GhDCP5L gene and its homologous genes in cotton comprises the following steps: An editing vector targeting the GhDCP5L gene and its homologous genes is prepared, and wild-type cotton plants are transformed to cultivate transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes.

6. Use of the GhDCP5L gene or its homologous gene in cotton breeding according to claim 6, characterized in that: The preparation method of the editing vector comprises the following steps: The sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6 was connected to the pRGEB32-GhU6.9-NPT II expression vector through homologous recombination reaction to obtain the editing vector.

7. Use of the GhDCP5L gene or its homologous gene in cotton breeding according to any one of claims 1 to 6, characterized in that: The cotton is upland cotton.

8. A method for preparing high temperature sensitive cotton germplasm, characterized in that: The following steps are involved: An editing vector targeting the GhDCP5L gene and its homologous genes is prepared, and wild-type cotton plants are transformed to obtain transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes. The editing vector contains the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.

6.

9. A method for preparing male sterile cotton germplasm, characterized in that: The following steps are involved: Prepare an editing vector targeting the GhDCP5L gene and its homologous genes, transform wild-type cotton plants, and cultivate transgenic cotton plants with reduced expression levels of the GhDCP5L gene and its homologous genes, wherein the editing vector comprises the sgRNA shown in SEQ ID NO.5 or the nucleic acid molecule shown in SEQ ID NO.6; The transgenic cotton plants are placed at a temperature of 35° C. or above for 3 days or more to obtain male sterile cotton plants.

10. Use of an agent for reducing the expression level of the GhDCP5L gene and its homologous genes in cotton breeding, characterized in that: The application is selected from one of the following (1)-(2); (1) Application in the preparation of high-temperature sensitive cotton germplasm; (2) Application in the preparation of male sterile cotton germplasm; Wherein, the agent for reducing the expression level of the GhDCP5L gene and its homologous genes is selected from one of the following (A)-(D): (A) sgRNA for knocking out the GhDCP5L gene and its homologous genes, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.5; (B) a nucleic acid molecule comprising the sgRNA described in (A), wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO. 6; (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B); (D) A recombinant microorganism comprising the editing vector described in (C).

Images