Application of KCNQ5 molecular marker in preparation of early depression diagnostic kit

Abstract

The invention discloses application of a KCNQ5 molecular marker in preparation of an early depression diagnosis kit, and belongs to the technical field of gene detection. The KCNQ5 gene is screened out through a transcriptomics technology for the first time to serve as a potential marker of early-stage depression, and a new direction and target spot are provided for pathogenesis research of early-stage depression. A high-sensitivity ELISA detection method is adopted, accurate and efficient detection of KCNQ5 gene expression related protein in plasma can be achieved, and the blank of early depression diagnosis kits in the current market is filled. The clinical application of the depression early diagnosis kit developed on the basis of the KCNQ5 gene is helpful for realizing early discovery and early treatment of depression, improves the cure rate and life quality of patients, and has important clinical significance and social value.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and specifically relates to the application of KCNQ5 molecular markers in the preparation of a diagnostic kit for early depression. Background Art

[0002] Depression is a common psychiatric disorder characterized by a significant and persistent low mood, accompanied by psychological symptoms such as loss of interest and anhedonia, as well as physical symptoms such as sleep disorders and appetite disorders. However, the current diagnosis of depression relies mainly on clinical symptoms and depression rating scales, which are difficult to accurately detect during the incubation period and early stages of the disease, leading to delays in treatment. Therefore, the development of a test that can accurately diagnose early-stage depression is of great significance.

[0003] Currently, standardized self-report and clinical scales commonly used in clinical practice, such as the PHQ-9, SDS, BDI, and QIDS-SR, can be used to assess the severity of depressive symptoms, but they lack diagnostic tools for early-stage depression. KCNQ potassium channels are a class of voltage-gated potassium channels, with genes encoding five isoforms (KCNQ1 to KCNQ5). Different KCNQ isoforms differ in tissue distribution, physiological, and pathological functions. KCNQ1 is primarily distributed in the myocardium; KCNQ2 / 3 are primarily distributed in the nervous system; KCNQ4 and KCNQ5 are highly expressed in visceral tissues and are considered drug targets for diseases such as visceral pain. KCNQ4 is also distributed in inner ear hair cells, and mutations in this gene can cause hereditary deafness. KCNQ2 / 3 form the molecular basis of the M-type potassium channel in neurons, and mutations in their genes can lead to a range of neurological disorders, including benign familial neonatal epilepsy. Studies have shown that increasing KCNQ2 / 3 channel activity can improve depression symptoms, particularly anhedonia. However, studies have found that KCNQ2 / 3 protein expression does not change significantly in the early stages of depression, and therefore cannot be used as a diagnostic marker for early-stage depression. Studies on the KCNQ5 gene in early-stage depression have not been reported, and existing ELISA test kits on the market are unable to meet the requirements for accurate and efficient detection of the KCNQ5 gene in plasma. Summary of the Invention

[0004] To address the above issues, the present invention provides the use of the KCNQ5 molecular marker in the preparation of an early depression diagnostic kit. The kit can detect early depression, which will help achieve early detection and early treatment of depression, and improve the cure rate and quality of life of patients.

[0005] The present invention is achieved through the following technical solutions: The present invention discloses the application of a KCNQ5 molecular marker in preparing a diagnostic kit for early depression.

[0006] Furthermore, the early depression kit diagnoses or screens patients with early depression by detecting the expression level of KCNQ5 mRNA or KCNQ5 protein in peripheral blood plasma.

[0007] Furthermore, the early depression diagnosis kit is a real-time fluorescence quantitative PCR detection kit or an ELISA enzyme-linked immunosorbent assay kit.

[0008] Furthermore, the real-time fluorescence quantitative PCR detection kit includes upstream primers and downstream primers for specifically amplifying the KCNQ5 molecular marker, and the gene sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0009] Furthermore, the real-time fluorescence quantitative PCR detection kit also includes an internal reference gene upstream primer and an internal reference gene downstream primer, and the gene sequences are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0010] Furthermore, the ELISA enzyme-linked immunosorbent assay kit includes an antibody that specifically binds to the molecular marker.

[0011] Beneficial effects (1) This paper screened the KCNQ5 gene as a potential marker for early depression for the first time through transcriptomics technology, providing a new direction and target for the study of the pathogenesis of early depression.

[0012] (2) The present invention develops an early diagnosis kit for depression based on the KCNQ5 gene. It adopts a highly sensitive ELISA detection method and can achieve accurate and efficient detection of proteins related to KCNQ5 gene expression in plasma, filling the gap in the current market for early diagnosis kits for depression.

[0013] (3) The clinical application of the depression early diagnosis kit developed based on the KCNQ5 gene of the present invention will help to achieve early detection and early treatment of depression, improve the cure rate and quality of life of patients, and has important clinical significance and social value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The top 50 protein profiles were screened for proteomics in Example 1; Figure 2 This is a graph showing the difference in KCNQ5 protein expression between normal subjects and patients with early-stage depression in Example 1; Figure 3 This is a graph showing the difference in KCNQ5 mRNA expression between healthy plasma and plasma from patients with depression detected by qPCR; Figure 4This is the standard curve for ELISA detection of KCNQ5 expression protein Figure 5 This is the difference in KCNQ5 protein expression between the plasma of healthy individuals and the plasma of people with early depression potential detected by ELISA; Figure 6 This is the ROC plot of ELISA detection of KCNQ5 protein expression in the plasma of healthy subjects and potential early depression patients. DETAILED DESCRIPTION

[0015] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions or as recommended by the manufacturer.

[0016] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. The reagents and raw materials used in the present invention can be purchased through conventional channels. Unless otherwise specified, the reagents and raw materials used in the present invention are used in accordance with conventional methods in the art or in accordance with the product instructions. The present invention will be further described in conjunction with the accompanying drawings and specific embodiments.

[0017] Example 1 Proteomic screening (1) Construction of an animal model of early-stage depression: The chronic unpredictable mild stress (CUMS) method was used to construct an animal model of early-stage depression. Experimental animals (rats) were randomly divided into a control group and a model group. The model group received CUMS stimulation for 4 weeks, including fasting, water deprivation, day and night reversal, humid environment, restraint and other stress stimuli. The control group animals were raised normally. After the stress stimulation, the depressive state of the animals was evaluated through behavioral tests (such as open field test, sucrose preference test, tail suspension test) to determine whether the animal model of early-stage depression was successfully constructed.

[0018] Depression score: 1) Open field test: The severity of depression was scored by the open field test. Briefly, an open box with a square bottom of 80cm*80cm*40cm was used. The bottom and four walls were black, and the bottom was divided into 8*8 small squares with white lines. On the second day after the model of each group was established, all mice were moved to a dark and quiet room for testing 1 hour in advance. Each mouse was placed from the middle of the bottom of the open box and recorded with a camera. Each mouse was tested for 5 minutes, and the activity of the mouse was recorded. Each small grid crossed was scored as 1 point, and each 10cm walked along the line was scored as 1 point. By comparing the relevant data of the experimental group mice with the normal control group, the presence of depressive-like behavior and the degree of behavioral tendency were judged based on whether there was a significant statistical difference (such as P < 0.05); 2) Sucrose preference experiment: Mice were housed in individual cages and trained to drink sucrose for 48 hours. They were given 1% to 2% sucrose water and drinking water throughout the training period (with the two water bottles swapped midway). After the training period, the mice were deprived of water (but not food) for 9 to 16 hours. The amount of water (g) consumed by the mice from the two bottles was measured over a period of 8 to 15 hours (with the bottles swapped once midway). Sucrose preference was used as the evaluation indicator: sucrose preference (%) = sucrose water consumption / (sucrose water consumption + drinking water consumption) × 100%. Depressive behavior was judged as follows: sucrose preference was less than 0.4 or significantly reduced compared to the control group (P < 0.05). 3) Tail Suspension Test: Use tape to secure the mouse's tail approximately 1 cm above the magnet, allowing the head to droop. Ensure that no other part of the mouse's body, except the tail and the instrument, comes into contact with the tail suspension. A series of parameters are recorded during the period of immobility in this setting. Key outcome measures include resting time, active time, percentage of resting time, and percentage of active time. The presence and severity of depressive-like behavior are determined by comparing the relevant data of the experimental group with those of the control group. Significant statistical differences (e.g., P < 0.05) are used to determine the presence and severity of depressive-like behavior.

[0019] (2) Sample collection: According to the above standards, after the early depression animal model is successfully established, brain tissue samples from the model group and the control group animals are quickly collected; the collected brain tissue samples are quickly frozen in liquid nitrogen and then stored in a -80°C refrigerator for future use.

[0020] (3) Proteomic sequencing: The preserved brain tissue samples are subjected to proteomic sequencing, and the samples are processed using high-throughput sequencing technology to obtain proteomic data.

[0021] (4) Data analysis: Use bioinformatics software to analyze sequencing data: First, perform protein expression differential analysis to screen out proteins that are significantly upregulated or downregulated in early depression animal models; then, perform functional annotation and enrichment analysis on the differentially expressed proteins to determine the biological processes and signaling pathways in which the differentially expressed proteins participate. Proteomics screening of the top 50 proteins such as Figure 1 As shown, through Figure 1 Through analysis, we found that there was no significant difference in the protein expression of KCNQ2 and KCNQ3 genes between the control group and the model group, and they could not be used as markers for early depression detection. However, the changes in KCNQ5 were more significant, and we finally identified KCNQ5 as a candidate marker for early depression.

[0022] Example 2 Fluorescence quantitative PCR detection: (1) Sample collection: Peripheral blood samples were collected from 20 patients with early depression and 20 healthy controls. The collected peripheral blood samples were placed in a blood collection tube containing EDTA anticoagulant, gently inverted to mix, and then centrifuged at low temperature (4°C, 3000 rpm, 15 minutes) within 2 hours to separate the plasma. The separated plasma was transferred to a sterile cryotube and stored in a -80°C refrigerator for later use.

[0023] (2) RNA extraction: Total RNA was extracted from plasma samples using the Qiagen miRNeasy Serum / Plasma Kit. The specific operation steps were carried out according to the kit instructions. After extraction, the concentration and purity of RNA were detected using a Nanodrop nucleic acid detector to ensure that the RNA concentration was ≥50 ng / μL and the OD260 / OD280 ratio was between 1.8 and 2.0.

[0024] (3) Reverse transcription: The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit (Thermo Scientific RevertAid First Strand cDNA Synthesis Kit); the reverse transcription reaction system was as follows: 5× Reaction Buffer (4 μL), Random Hexamers (100 μM, 1 μL), dNTP Mix (10 mM, 1 μL), RevertAid M-MuLV Reverse Transcriptase (200 U / μL, 1 μL), RNase Inhibitor (40 U / μL, 0.5 μL), Total RNA (1 μg), and RNase-free water to 20 μL; the above reaction system was reverse transcribed on a PCR instrument according to the following program: 25°C for 5 minutes, 42°C for 60 minutes, and 70°C for 5 minutes. After the reaction, the obtained cDNA product was stored in a -20°C refrigerator for use.

[0025] (4) Primer design and synthesis: Using KCNQ5 as a molecular marker, upstream primers and downstream primers for specific amplification of the molecular marker were designed, and the gene sequences were shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The upstream primers and downstream primers for the internal reference gene, and the gene sequences were shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, are as follows: SEQ ID NO.1 (Kcnq5-F):ACAGTTTTCAGGCAGCGAGT; SEQ ID NO.2 (Kcnq5-R): ATGACCGTGACCTTCCAGTC; SEQ ID NO.3 (Gapdh-F):ACCCAGAAGACTGTGGATGG; SEQ ID NO.4 (M-Gapdh-R): CACATTGGGGGTAGGAACAC; The above primers were diluted with TE buffer to a working concentration of 10 μM and stored in a -20°C refrigerator for use.

[0026] (5) qPCR reaction: qPCR reaction was performed using the SYBR Green fluorescent dye method; the qPCR reaction system was as follows: 2×SYBR Green Master Mix: 10 μL, upstream primer (10 μM): 0.5 μL, downstream primer (10 μM): 0.5 μL, cDNA template: 2 μL, ddH2O: make up to 20 μL; the above reaction system was added to a 96-well plate, with 3 replicate wells for each sample; the reaction was performed on a qPCR instrument according to the following program: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. Fluorescence signals were collected in real time during the reaction, and the Ct value was automatically generated after the reaction was completed (the corresponding internal reference genome was used as a negative control to monitor the stability and reliability of the experimental process and to correct errors).

[0027] (6) Data analysis: Calculation of the relative expression of KCNQ5 gene: Using the KCNQ5 gene expression level of the healthy control group as a calibrator, the relative expression level of KCNQ5 mRNA in the early depression patient group was calculated. The results are as follows: Figure 3 Statistical analysis was performed using GraphPad 8.0 software, and the two groups were compared using the independent sample t-test. P < 0.05 indicated a statistically significant difference.

[0028] Example 3 ELISA enzyme-linked immunosorbent assay: (1) Coating: Dilute the commercial KCNQ5 capture antibody to different concentrations (e.g., 1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) with coating buffer (0.05 M carbonate buffer, pH 9.6). Then add the diluted antibody to the microwells of the ELISA plate, 100 μL per well, and coat overnight at 4°C.

[0029] (2) Blocking: Discard the coating buffer and wash the ELISA plate three times with PBST buffer (0.01M PBS, containing 0.05% Tween-20), each time for 3 minutes, then add 200 μL of blocking solution (5% skim milk powder-PBST solution) to each well and block at 37°C for 2 hours.

[0030] (3) Sample addition: Discard the blocking solution and wash the ELISA plate three times with PBST buffer for 3 minutes each time. Then add the plasma sample, serially diluted standard (commercial KCNQ5 recombinant protein, concentrations of 12500 pg / mL, 6250 pg / mL, 3125 pg / mL, 1563 pg / mL, 780 pg / mL, 390 pg / mL, 195 pg / mL, 0 pg / mL) and positive and negative controls to the microwells of the ELISA plate, 100 μL per well, and incubate at 37°C for 1 hour.

[0031] (4) Washing: Discard the liquid in the wells and wash the ELISA plate with PBST buffer 5 times, 3 minutes each time.

[0032] (5) Add enzyme-labeled secondary antibody: Dilute HRP-labeled KCNQ5 secondary antibody to an appropriate concentration with diluent (1% BSA-PBST solution), then add 100 μL to each well and incubate at 37°C for 1 hour.

[0033] (6) Washing: Discard the liquid in the wells and wash the ELISA plate with PBST buffer 5 times, 3 minutes each time.

[0034] (7) Color development: Add 100 μL of substrate color development solution (TMB substrate solution) to each well and develop the color at 37°C in the dark for 15-20 minutes. When the color changes to an appropriate degree, add 50 μL of stop solution (2M H2SO4 solution) to each well to terminate the reaction.

[0035] (8) Reading: Use an enzyme-labeled instrument to read the absorbance value at a wavelength of 450 nm; draw a standard curve with the concentration of the standard as the horizontal axis and the absorbance as the vertical axis. The standard curve is as follows: Figure 4 As shown; the content of KCNQ5 gene expression-related proteins in the samples was calculated according to the standard curve.

[0036] (9) 50 clinical samples of potential early depression patients and 50 healthy controls were collected and tested according to the above method. The absorbance values ​​(OD 450 value) were read at a wavelength of 450 nm as follows: Figure 5 As shown in Figure 2, the ROC curve for detecting KCNQ5 gene protein expression is as follows: Figure 6 As shown. Figure 5 and Figure 6 It can be seen that there are significant differences in KCNQ5 gene protein expression between healthy controls and people with potential for early depression, with an AUC of 0.901, a sensitivity of 0.92, and a specificity of 0.94.

Claims

1. Application of KCNQ5 molecular marker in the preparation of early depression diagnostic kit.

2. Use of the KCNQ5 molecular marker according to claim 1 in preparing a diagnostic kit for early depression, characterized in that: The early depression kit diagnoses or screens patients with early depression by detecting the expression level of KCNQ5 mRNA or KCNQ5 protein in peripheral blood plasma.

3. Use of the KCNQ5 molecular marker according to claim 1 in preparing a diagnostic kit for early depression, characterized in that: The early depression diagnosis kit is a real-time fluorescence quantitative PCR detection kit or an ELISA enzyme-linked immunosorbent assay kit.

4. Use of the KCNQ5 molecular marker according to claim 3 in preparing a diagnostic kit for early depression, characterized in that: The real-time fluorescence quantitative PCR detection kit includes upstream primers and downstream primers for specifically amplifying the KCNQ5 molecular marker, and the gene sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively.

5. Use of the KCNQ5 molecular marker according to claim 3 in preparing a diagnostic kit for early depression, characterized in that: The real-time fluorescence quantitative PCR detection kit further includes an internal reference gene upstream primer and an internal reference gene downstream primer, and the gene sequences are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

6. Use of the KCNQ5 molecular marker according to claim 3 in preparing a diagnostic kit for early depression, characterized in that: The ELISA enzyme-linked immunosorbent assay kit comprises an antibody that specifically binds to the molecular marker.

Images