Application of molecular marker related to daily gain character of pigs at 30-120 kg stage

Abstract

The invention relates to application of a molecular marker related to daily gain of pigs at the stage of 30kg-120kg. The invention discloses a method for identifying the daily gain of pigs at the stage of 30 kg to 120 kg and a breeding method for breeding the pigs with the daily gain at the stage of 30 kg to 120 kg. According to the method, by detecting the genotype of a to-be-detected pig at the 161610871th site of a chromosome 1 in a pig reference genome Susscrofa.Sscrofa11.1, the daily gain of the pig at the stage of 30 kg to 120 kg is identified, the pig with the TT genotype is higher than the pig with the CT genotype, and the pig with the CT genotype is higher than the pig with the CC genotype. In actual breeding work, a to-be-detected pig with the genotype of the C161610871T site being TT can be selected as a parent for breeding, and the method has important significance on selection of pigs with high feed intake and high feed utilization efficiency.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of molecular markers related to daily weight gain traits of pigs in the 30kg-120kg stage. Background Art

[0002] Statistics from the Food and Agriculture Organization (FAO) show that pork consumption accounts for one-third of all human meat consumption, and pork production is closely related to human protein intake. Daily weight gain refers to the average daily weight gain of pigs during the fattening stage. Generally, companies choose the 30kg-120kg stage as the fattening stage. The daily weight gain in the 30kg-120kg stage directly represents the production value of pigs and can directly affect the profits of pig farms. The breeding goals of major domestic and foreign companies all have daily weight gain or traits similar to daily weight gain, such as reaching a weight of 120kg per day. In my country's new round of genetic improvement plan (2021-2035), daily weight gain in the 30kg-120kg stage has become one of the main performance indicators for lean pigs.

[0003] Because measuring daily gain requires specialized equipment and spans the entire fattening period, it increases breeding costs and is extremely difficult to implement. The rapid development of molecular biotechnology and porcine genome association analysis has provided methods for the discovery and development of molecular markers for daily gain, enabling more accurate and rapid selection for quantitative traits like daily gain. Some studies have explored genes related to daily weight gain. For example, Zhou et al. (2021, reference: Zhou S, Ding R, Meng F, Wang X, Zhuang Z, Quan J, Geng Q, Wu J, Zheng E, Wu Z, Yang J, Yang JA meta-analysis of genome-wide association studies for average daily gain and lean meat percentage in two Duroc pig populations. BMC Genomics. 2021 Jan 6; 22(1): 12..) conducted a meta-analysis of daily weight gain of Duroc pigs and found 10 significantly associated polymorphic markers on chromosomes 1, 3, 7 and 14. Liao et al. (2022, Reference: Liao W, Wang Y, Qiao X, Zhang X, Deng H, Zhang C, Li J, Yuan X, Zhang H. APoly(dA:dT) Tract in the IGF1 Gene Is a Genetic Marker for Growth Traits in Pigs. Animals (Basel). 2022 Nov 27; 12(23): 3316..) showed that two mutations in the IGF1 gene could be candidate genes for growth rates such as daily weight gain. Because daily weight gain is a trait controlled by multiple genes, molecular markers related to its selection need to be further developed. Summary of the Invention

[0004] The present invention aims to provide an application of molecular markers related to daily weight gain of pigs in the 30kg-120kg stage;

[0005] Another object of the present invention is to provide a method for identifying or assisting in identifying the daily weight gain of pigs in the 30kg-120kg stage;

[0006] Another object of the present invention is to provide a breeding method for selecting pigs with high daily weight gain in the 30kg-120kg stage.

[0007] The present invention is achieved in that:

[0008] The application of molecular markers related to daily weight gain of pigs in the 30kg-120kg period is any one of the following A1) to A8):

[0009] A1) Detect or assist in detecting the daily weight gain of pigs between 30kg and 120kg;

[0010] A2) Identify and assist in the identification of daily weight gain of pigs between 30kg and 120kg;

[0011] A3) Pig breeding;

[0012] A4) detecting or assisting in detecting SNP polymorphism or genotype;

[0013] A5) preparing products for detecting or assisting in detecting daily weight gain in pigs between 30kg and 120kg;

[0014] A6) Prepare and identify products for daily weight gain in pigs between 30kg and 120kg;

[0015] A7) preparing products for pig breeding;

[0016] A8) preparing a product for detecting or assisting in detecting the polymorphism or genotype of a SNP;

[0017] The molecular marker corresponds to the 161610871 SNP site on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, as shown in the sequence SEQ ID NO: 1, and the nucleotide at the 155th bp of the DNA molecule is C or T.

[0018] A method for identifying or assisting in identifying the average daily weight gain of pigs in the 30kg-120kg period comprises the following steps:

[0019] S1 extracts the pig genomic DNA to be tested as a template;

[0020] S2 designed primers targeting the 155 bp site of the DNA molecule shown in SEQ ID NO.1 and performed PCR amplification;

[0021] S3 detects the genotype of the 155bp site of the SEQ ID NO.1 sequence of the tested pig;

[0022] S4 uses the genotype obtained in step S3 to identify or assist in identifying the daily weight gain of the pigs to be tested during the 30kg-120kg period. The pigs with the TT genotype are greater than the pigs with the CT genotype, and the pigs with the CT genotype are greater than the pigs with the CC genotype.

[0023] Preferably, the sequences of the primers in step S2 are shown as SEQ ID NO. 2 to SEQ ID NO. 3.

[0024] A breeding method for pigs with daily weight gain in the 30kg-120kg stage is to identify the genotype of the test pig according to the above method, and select the test pig with TT genotype as the parent for breeding, wherein the TT genotype is the homozygous type with T at the 155th bp of the SEQ ID NO.1 sequence.

[0025] Preferably, the aforementioned application of molecular markers related to daily weight gain of pigs in the 30kg-120kg stage is a kit.

[0026] The daily weight gain (ADG) of pigs during the 30-120 kg period described in the present invention is a method of expressing pig growth rate, referring to the daily weight gain of a pig. Specifically, the ADG of the pigs to be tested during the 30-120 kg period is used. The pig breeding method of the present invention is intended to select breeding pigs with higher ADG during the 30-120 kg period. The SNP is located at position 161610871 on chromosome 1 in the reference genome Sus_scrofa.Sscrofa11.1 and is designated as the C161610871T site. Those skilled in the art know that SEQ ID NO: 1 is composed of the nucleotide sequence of position 155 of the SNP site SEQ ID NO: 1 and its vicinity. The amount of nucleotide sequence near the SNP site should not be used as a limiting factor for the scope of protection of the present invention. It can be 25bp, 35bp, 45bp, 65bp, 85bp, 100bp, 150bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the position of the SNP on chromosome 1 of the pig reference genome. The before and after mentioned in the present invention should be defined in the direction recognized by those skilled in the art, such as the 5'-3' direction. The identification, auxiliary identification or improvement of the pig growth rate trait mentioned in the present invention includes but is not limited to identifying or assisting in identifying the pig to be tested whose genotype of the aforementioned SNP is TT for breeding or reproduction. In the above method, the partial region containing the aforementioned SNP in the pig genome can be amplified by PCR. For example, the PCR product containing SEQ ID NO: 1 is sequenced and the type of the deoxyribonucleotide at position 155 of SEQ ID NO: 1 is detected to detect the genotype of the SNP site in the pig genome to be tested.

[0027] The present invention uses a gene sequencing method to detect C161610871T. It only needs to perform a PCR reaction and sequencing to determine the genotype of the individual. The genotype determination is very accurate, the detection cost is not high, and it has a high breeding practice application value. The method of the present invention is used to select the daily weight gain trait of pigs, which can increase the daily weight gain of TT genotype pigs by about 0.12 kg / day compared with CC genotype pigs. The method provided by the present invention is used to breed pigs, and early screening of pigs to be selected can be performed, effectively alleviating the problem of a long time for selecting excellent breeding pigs in actual production, reducing breeding costs, and effectively improving the growth rate of pigs in actual production. The detection method of the present invention is simple to operate, inexpensive, highly accurate, and can realize automated direct detection. The present invention will play a huge role in pig breeding.

[0028] The beneficial effects of the present invention are as follows: the present invention discovered a C / T site at position 161610871 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, which has a significant effect on the daily weight gain of pigs in the 30kg-120kg stage; based on the SNP site, a method for identifying or assisting in identifying the daily weight gain of pigs in the 30kg-120kg stage is provided; a new molecular breeding marker is provided for marker-assisted breeding of the daily weight gain trait of pigs in the 30kg-120kg stage, which is beneficial to improving breeding efficiency, effectively shortening the breeding cycle, and is of great significance for selecting excellent pig breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 QQ graph representing the data structure of the genome-wide association analysis according to an embodiment of the present invention;

[0030] Figure 2 It is a Manhattan plot of the genome-wide association analysis according to an embodiment of the present invention. DETAILED DESCRIPTION

[0031] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0032] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0033] The data in the following examples were processed using SAS 9.0 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.05 (*) indicated a significant difference.

[0034] All animals in the following examples were sourced from Henan Yifa Animal Husbandry Co., Ltd.

[0035] The daily weight gain of 30 kg to 120 kg for pigs in the following examples refers to the daily weight gain of 30 kg to 120 kg from the time the pigs reach a body weight of 30 kg to the time the pigs reach a body weight of 120 kg.

[0036] Example 1. Determination of SNP sites on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1

[0037] The inventors previously conducted whole-genome sequencing on 300 pigs and conducted genome-wide association analysis of the 30kg-120kg daily weight gain trait. The model used was: Y = μ + G + B + P + e. Here, Y is the trait measurement value; μ is the population mean; G is the genotype effect; B is the measurement batch effect; and P is the field year and season effect. The results revealed 20 SNPs significantly associated with 30kg-120kg daily weight gain, such as Figure 1 and Figure 2 As shown, the inventors designed primers within the 200 bp range upstream and downstream of the five most significant sites for amplification and found that only the sequence of one site on stain No. 1 could achieve a good amplification effect.

[0038] After amplification, Seqman software was used for alignment to obtain a differential site (SNP site), named C161610871T site, located at the 161610871 nucleotide of chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, i.e., the 155th position of the sequence SEQ ID NO:1. The nucleotide type of the C161610871T site is T or C, and the genotype is TT, CC, or CT. The TT genotype is a homozygous body with the nucleotide at the C161610871T site being T. The CC genotype is a homozygous body with the nucleotide at the C161610871T site being C. The CT genotype is a heterozygous body with the nucleotide at the C161610871T site being T and C.

[0039] Example 2. Correlation analysis between the C161610871T site on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 and the daily weight gain of pigs in the 30kg-120kg stage

[0040] In order to determine whether the C161610871T site on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 is correlated with the daily weight gain of pigs in the 30kg-120kg stage, 1173 Large White pigs were used as experimental materials, the genotype of each SNP site in Example 1 and the daily weight gain of the individual from 30kg to 120kg were measured, and correlation analysis was performed.

[0041] I. Identification of genotype

[0042] 1. PCR amplification

[0043] Based on the SNP information on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, a pair of primers was designed as follows:

[0044] Upstream primer F: 5′-GTCTCTTGATTCCTAGTGGTATGT-3′ (SEQ ID NO: 2);

[0045] Downstream primer R: 5'-AAGTTCCATGTTGACAGTCTCA-3' (SEQ ID NO: 3).

[0046] The genomic DNA of each Large White pig was used as a template and PCR amplification was performed using the above primers to obtain PCR products.

[0047] 2. Cloning, sequencing and sequence analysis

[0048] Each individual PCR product was recovered and purified using an agarose gel extraction kit (Tiangen Biochemical Technology Co., Ltd.). The recovered DNA fragment was ligated into the pGEM-T vector (Promega) and transformed into Escherichia coli DH5α competent cells (Mingri Biotech (Beijing) Technology Co., Ltd.). Positive clones were screened for the carboxybean resistance marker on the vector to obtain a recombinant plasmid containing the recovered fragment. The nucleotide sequence of this recombinant plasmid was determined using primers encoding the T7 and SP6 promoter sequences on the vector (Invitrogen (Shanghai) Trading Co., Ltd.).

[0049] The genotypes of the pigs to be tested are:

[0050] TT genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains only a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 155th nucleotide of SEQ ID NO: 1 is T, and does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 155th nucleotide of SEQ ID NO: 1 is C, then the C161610871T genotype of chromosome 1 in the aforementioned pig reference genome Sus_scrofa.Sscrofa11.1 of the pig to be tested is TT.

[0051] CC genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 155th nucleotide of SEQ ID NO: 1 is T, and only contains a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 155th nucleotide of SEQ ID NO: 1 is C, then the C161610871T genotype of chromosome 1 in the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is CC.

[0052] CT genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains both a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 155th nucleotide of SEQ ID NO: 1 is C, and a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 155th nucleotide of SEQ ID NO: 1 is T, then the C161610871T genotype of chromosome 1 in the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is CT.

[0053] The results are shown in Table 2. Genotyping results for the C161610871T locus in 1,173 Large White pigs revealed that 304 had the TT genotype, 520 had the CC genotype, and 349 had the CT genotype. The genotype and allele frequencies for the C161610871T locus in the tested pig population are shown in Table 1. As can be seen from Table 1, this locus has a high heterozygosity, suggesting great potential for breeding.

[0054] Table 1. Genotype frequency and allele frequency of C161610871T locus in the tested pig population

[0055]

[0056] 2. Correlation Analysis between Pig Genotype and Daily Weight Gain of 30kg-120kg Pigs

[0057] The daily weight gain of pigs in the 30kg-120kg stage was measured using Osborne automatic measuring equipment. SAS software was used for association analysis between genotype and phenotype. Duncan's multiple test was used for significance test (P<0.05). Data were expressed as mean ± standard error, and P<0.05 was considered significant.

[0058] The results, as shown in Table 2, show that the SNP (C161610871T) locus significantly affects daily weight gain (DAG) in pigs between 30 kg and 120 kg. Pigs with the TT genotype gained more DAG than those with the CT genotype, which in turn gained more DAG than those with the CC genotype. Furthermore, pigs with the TT genotype gained significantly more DAG than those with the CC genotype (P < 0.05). In practical pig breeding, SNP C161610871T genotyping results can be used to assist in selection for DAG during the 30 kg to 120 kg period.

[0059] Table 2. Association analysis between single nucleotide polymorphisms on chromosome 1 and daily weight gain from 30kg to 120kg in the pig reference genome (Sus_scrofa.Sscrofa11.1)

[0060] genotype Number of samples 30kg-120kg daily weight gain TT 304 1051.40±117.69a CT 520 1012.62±108.63b CC 349 978.97±102.61b

[0061] Note: Different lowercase letters in the table indicate significant differences (P<0.05), the same letters indicate no significant differences (P>0.05), and the values ​​are mean ± standard error.

[0062] In summary, the genotype of the C161610871T site on chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) can be determined to assist in identifying the daily weight gain of pigs between 30kg and 120kg:

[0063] Pigs with the TT genotype gain 30-120 kg more daily than pigs with the CT genotype, and pigs with the CT genotype gain 30-120 kg more daily than pigs with the CC genotype. (See S4 of claim 2.) In actual breeding, pigs with the TT genotype at the SNP (C161610871T) can be selected as parents for breeding.

[0064] SEQ ID NO: 1

[0065] 5'-GTCTCTTGATTCCTAGTGGTATGTTCTTTTCACACTGTTCAAGCTTTCTAACATTTGTAAACTAGTAAAAATACATGACAGTTTTTAAAAAGAAAATATGCAAATCTTAGAGGTATTTGAAAAAGAACATTATGAGAATCAAAAAGTTGATTTGW CTTTTAAGCTGTAATCTCCTTGCTCCTGCCCCTTGAATTTCTAGTGTTGGTGGCAGCTTTAATTTTTTTGGCAGAGCTATTTCATCTTCAAAAGCTAAGGGGGGTATTAGAAGCCCCTAAAATTTAAAAGTTGAGACTGTCAACATGGAACTT-3'.

[0066] Wherein, the W is C or T.

[0067] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. The application of molecular markers related to daily weight gain in pigs between 30kg and 120kg, characterized in that: The application is any one of the following A1) to A8): A1) Detect or assist in detecting the daily weight gain of pigs between 30kg and 120kg; A2) Identify and assist in the identification of daily weight gain of pigs between 30kg and 120kg; A3) Pig breeding; A4) Detect or assist in detecting SNP polymorphism or genotype; A5) Prepare products to detect or assist in detecting daily weight gain in pigs between 30kg and 120kg; A6) Prepare and identify products for daily weight gain of pigs between 30kg and 120kg; A7) Preparation of pig breeding products; A8) Preparation of products for detecting or assisting in the detection of SNP polymorphisms or genotypes; The molecular marker corresponds to the 161610871 SNP site on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, as shown in the sequence SEQ ID NO: 1, and the nucleotide at the 155th bp of the DNA molecule is C or T.

2. A method for identifying or assisting in identifying the average daily weight gain of pigs in the 30kg-120kg stage, characterized in that: The steps include: S1 extracts the pig genomic DNA to be tested as a template; S2 designed primers targeting the 155 bp site of the DNA molecule shown in SEQ ID NO.1 and performed PCR amplification; S3 detects the genotype of the 155 bp site of the pig sequence SEQ ID NO.1 to be tested; S4 uses the genotype obtained in step S3 to identify or assist in identifying the daily weight gain of the pigs to be tested during the 30kg-120kg period. The pigs with the TT genotype are greater than the pigs with the CT genotype, and the pigs with the CT genotype are greater than the pigs with the CC genotype.

3. The method according to claim 2, characterized in that The sequences of the primers in step S2 are shown in SEQ ID NO. 2 to SEQ ID NO.

3.

4. A method for breeding pigs with daily weight gain in the 30kg-120kg stage, characterized in that: The genotype of the test pig is identified according to the method of claim 2 or 3, and the test pig with TT genotype is selected as a parent for breeding, wherein the TT genotype is a homozygous type in which the 155th bp of the SEQ ID NO.1 sequence is T.

5. The use of molecular markers related to daily weight gain in pigs in the 30kg-120kg stage according to claim 1, characterized in that: The product is a test kit.

Images