InDel molecular marker related to soybean grain weight, fat content and isoflavone content and application

Abstract

The invention discloses an InDel molecular marker related to soybean grain weight, fat content and isoflavone content and application, and relates to the technical field of molecular detection. The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID NO. 4. Whole genome association analysis finds that insertion / deletion variation of 16bp and 11bp exists in a specific region of a No.13 chromosome of soybean, and an InDel molecular marker related to soybean grain weight, fat content and isoflavone content is provided based on the insertion / deletion variation of 16bp and 11bp. By utilizing the InDel molecular marker, the genotype of a target site can be rapidly and accurately detected, and soybean materials with different genetic backgrounds can be distinguished, so that soybean varieties with excellent grain weight, fat and isoflavone content characters can be effectively screened in an auxiliary manner. According to the method, the breeding selection accuracy and efficiency are remarkably improved, and a powerful tool is provided for accelerating the soybean genetic improvement process.

Description

Technical Field

[0001] The present invention relates to the field of molecular detection technology, and in particular to an InDel molecular marker related to soybean grain weight, fat content and isoflavone content and its application. Background Art

[0002] Soybean (Glycine max L. Merr.) is an important food and oil crop and a major source of plant protein for humans and livestock feed protein. Furthermore, bioactive substances such as soy protein, oil, vitamins, and flavonoids have important pharmacological effects in anti-cancer, antioxidant, immunomodulatory, and cardiovascular disease prevention and treatment. With economic development, rising living standards, and improved dietary patterns, demand for soybeans continues to grow. Currently cultivated soybeans have a relatively low oil content. Improving soybean yields and cultivating soybean varieties with high fat and nutrient content are pressing challenges in soybean breeding.

[0003] Marker-assisted selection (MAS) technology provides a powerful tool for traditional crop genetic breeding. Due to its advantages of early selection, environmental independence, accuracy, speed, and efficiency, MAS has been extensively utilized in various crops. This invention proposes the development of novel molecular markers related to soybean grain weight, fat content, and isoflavone content to accurately identify these factors or assist in breeding. Summary of the Invention

[0004] The present invention aims to provide an InDel molecular marker related to soybean grain weight, fat content, and isoflavone content, and its application, to address the aforementioned problems of the prior art. This InDel molecular marker can rapidly and accurately detect the genotype of the target locus, distinguishing soybean materials of different genetic backgrounds, and effectively assisting in the screening of soybean varieties with excellent grain weight, fat content, and isoflavone content.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides an InDel molecular marker related to soybean grain weight, fat content and isoflavone content. The nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO.4.

[0007] The present invention also provides the use of the above-mentioned InDel molecular marker in identifying soybean grain weight, fat content and / or isoflavone content traits.

[0008] The present invention also provides a primer pair for detecting the above-mentioned InDel molecular marker, comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6.

[0009] The present invention also provides the use of the primer pair in preparing a product for identifying soybean grain weight, fat content and / or isoflavone content.

[0010] Furthermore, the product is a kit.

[0011] The present invention also provides a product for identifying soybean grain weight, fat content and / or isoflavone content, comprising the above primer pair.

[0012] Furthermore, the product is a kit.

[0013] The present invention also provides the use of the primer pair in identifying soybean grain weight, fat content and / or isoflavone content.

[0014] The present invention also provides the use of the above product in identifying soybean grain weight, fat content and / or isoflavone content.

[0015] The present invention also provides a method for identifying soybean grain weight, fat content and / or isoflavone content, comprising the following steps:

[0016] PCR amplification is performed on the soybean material DNA to be tested using the above primers to obtain a PCR amplification product;

[0017] The PCR amplification products were subjected to non-denaturing polyacrylamide gel electrophoresis, and genotyping and trait judgment were performed based on the generated electrophoresis bands:

[0018] The grain weight and fat content of soybean materials with PCR amplification products of 211 bp were higher than those with PCR amplification products of 238 bp.

[0019] The isoflavone content of the soybean material with a PCR amplification product of 211 bp was lower than that of the soybean material with a PCR amplification product of 238 bp.

[0020] The present invention discloses the following technical effects:

[0021] The present invention found through whole genome association analysis that there are 16bp and 11bp insertion / deletion variations in specific regions of soybean chromosome 13 (28,305,360bp and 28,305,305bp, reference genome Wm82.a2.v1), and based on this, provides an InDel molecular marker related to soybean grain weight, fat content and isoflavone content. Utilizing this InDel molecular marker, the genotype of the target site can be detected quickly and accurately, and soybean materials of different genetic backgrounds can be distinguished, thereby effectively assisting in the screening of soybean varieties with excellent grain weight, fat and isoflavone content traits. Specifically, the size difference of PCR amplification products (such as 211bp and 238bp) can reflect the significant differences in grain weight, fat and isoflavone content of soybean materials, thereby achieving efficient pre-selection of target traits. The present invention significantly improves the accuracy and efficiency of breeding selection, and provides a powerful tool for accelerating the soybean genetic improvement process. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 Polyacrylamide gel electrophoresis diagram of 47 soybean materials with different genetic backgrounds verified using InDel molecular markers. DETAILED DESCRIPTION

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0026] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0027] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0029] Example 1

[0030] During long-term research, the present invention discovered an InDel molecular marker associated with soybean grain weight, fat content, and isoflavone content through genome-wide association analysis of 100-grain weight, fat content, and isoflavone content. Compared to the soybean reference genome (Wm82.a2.v1), the present invention found deletion mutations of 16 bp (SEQ ID NO. 1) and 11 bp (SEQ ID NO. 2) in the 5'UTR region of the GmFDH gene, located at positions 28,305,360 bp and 28,305,305 bp on soybean chromosome 13.

[0031] InDel molecular marker detection primer pairs were designed using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), as shown in Table 1. These InDel molecular marker detection primers can amplify fragments with marker lengths of 238 bp and 211 bp, respectively. The nucleotide sequence of the 238 bp fragment is shown in SEQ ID NO. 3, and the nucleotide sequence of the 211 bp fragment is shown in SEQ ID NO. 4.

[0032] SEQ ID NO.1: aattttgtttcagtga.

[0033] SEQ ID NO.2: tttgtgtataa.

[0034] SEQ ID NO.3: atcctttcccaagccagccaagcgaggcatgctctcaattttgtactcttccgtctcccaatattttcttcttcttcttcttattatcatttttgtgtataaacctcaccttaatta ctctactcttctctctaattacagttttcaattttgtttcagtgaaattacttgcatagatagagcatggccatgatgaaacgtgctgcttcctcttcggttcgctcgctactttcct.

[0035] SEQ ID NO.4: atcctttcccaagccagccaagcgaggcatgctctcaattttgtactcttccgtctcccaatattttcttcttcttcttcttattatcattacctcaccttaa ttactctactcttctctctaattacagttttcaattacttgcatagatagagcatcatggccatgatgaaacgtgctgcttcctcttcggttcgctcgctactttcct.

[0036] Table 1 Primer pairs for InDel molecular marker detection

[0037] Primers Nucleotide sequence (5'-3') Sequence number Upstream primer F atcctttcccaagccagcc SEQ ID NO.5 Downstream primer R aggaaagtagcgagcgaacc SEQ ID NO.6

[0038] Example 2

[0039] The correlation between the InDel molecular markers screened in Example 1 and soybean grain weight, fat content, and isoflavone content was verified using 47 soybean materials with known 100-grain weight, fat content, and isoflavone content (Table 2) as follows:

[0040] (1) PCR amplification of the soybean material DNA to be tested was performed using the InDel molecular marker detection primers designed in Table 1 of Example 1 to obtain a PCR amplification product;

[0041] The reaction program of PCR amplification was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 30 seconds, 35 cycles; incubation at 72°C for 5 minutes, and storage at 4°C.

[0042] The PCR amplification reaction system was 10 μL, including: 2 μL of 50 ng / μL DNA template, 0.25 μL of 10 μmol / L upstream and downstream primers, 5 μL of 2× Taq Mix, and 2.5 μL of double-distilled water.

[0043] (2) The PCR amplification products were subjected to non-denaturing polyacrylamide gel electrophoresis, and genotyping was performed based on the resulting electrophoretic bands (211 bp or 238 bp). The gel electrophoresis voltage was 180 V, the current was 60 mA, and the time was 60 min.

[0044] The genotyping results of 47 soybean materials are shown in Table 2. Figure 1 The electrophoresis pattern of genotyping 47 soybean materials using InDel markers. Figure 1 As shown in Table 2, among the 47 soybean materials, 20 had an InDel marker length of 238 bp, with average values ​​of 15.56 g, 20.17 wt%, and 2,575,841.81 (relative content) for 100-grain weight, fat content, and isoflavone (daidzin) content. Twenty of the 27 soybean materials had an InDel marker length of 211 bp, with average values ​​of 27.55 g, 21.70 wt%, and 1,238,844.15 (relative content). The 100-grain weight and fat content of the soybean materials with an InDel marker length of 211 bp were significantly higher than those of the soybean materials with an InD marker length of 238 bp, while the isoflavone content of the soybean materials with an InD marker length of 211 bp was significantly lower than that of the soybean materials with an InD marker length of 238 bp (P < 0.001).

[0045] Table 2 Verification results of 47 soybean materials

[0046]

[0047]

[0048]

[0049] Note: NA indicates that the relevant data of the variety is missing.

[0050] From the above, it can be seen that the Indel molecular markers and primer pairs provided by the present invention can effectively screen soybean varieties with different grain weights, fat contents and isoflavone contents, and the screening results are accurate and reliable.

[0051] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. An InDel molecular marker related to soybean grain weight, fat content and isoflavone content, characterized in that: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.

4.

2. Use of the InDel molecular marker according to claim 1 in identifying soybean grain weight, fat content and / or isoflavone content.

3. A primer pair for detecting the InDel molecular marker according to claim 1, characterized in that: It includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

6.

4. Use of the primer pair according to claim 3 in preparing a product for identifying soybean grain weight, fat content and / or isoflavone content.

5. The use according to claim 4, characterized in that The product is a test kit.

6. A product for identifying soybean weight, fat content and / or isoflavone content, characterized in that: Comprising the primer pair according to claim 3.

7. The product according to claim 6, characterized in that The product is a test kit.

8. Use of the primer pair according to claim 3 in identifying soybean grain weight, fat content and / or isoflavone content.

9. Use of the product according to claim 6 or 7 in identifying soybean grain weight, fat content and / or isoflavone content.

10. A method for identifying soybean grain weight, fat content and / or isoflavone content, characterized in that: The following steps are involved: Using the primers described in claim 3 to perform PCR amplification on the soybean material DNA to be tested to obtain a PCR amplification product; The PCR amplification products were subjected to non-denaturing polyacrylamide gel electrophoresis, and genotyping and trait judgment were performed based on the generated electrophoresis bands: The grain weight and fat content of soybean materials with PCR amplification products of 211 bp were higher than those with PCR amplification products of 238 bp. The isoflavone content of the soybean material with a PCR amplification product of 211 bp was lower than that of the soybean material with a PCR amplification product of 238 bp.

Images