Porcine bacterial polysaccharide-viral protein conjugate vaccine as well as preparation method and application thereof

By efficiently coupling porcine bacterial polysaccharides and viral proteins through the biotin-avidin system, the problems of narrow protection spectrum and low coupling efficiency of existing vaccines are solved, broad-spectrum and long-lasting immune protection and coordinated prevention and control of multiple pathogens are achieved, and breeding costs and antibiotic use are reduced.

CN120605324APending Publication Date: 2025-09-09CHENGDU YISIKANG PHARM TECH CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510894341.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-30
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing pig-derived bacterial and viral vaccines have a narrow protection spectrum and short-lived immune effects when facing complex multi-pathogen infections, and are unable to achieve broad-spectrum and long-lasting immune protection. In addition, traditional polysaccharide conjugate vaccines have low coupling efficiency and poor product consistency, and are unable to effectively activate T cell-mediated long-term immune memory responses.

Method used

The biotin-avidin system was used to efficiently couple porcine bacterial polysaccharides with viral proteins. The polysaccharide was activated by CDAP and reacted with the biotinylation reagent. The viral protein was purified using a nickel affinity chromatography column. The bacterial fermentation process was optimized to improve the purity of the polysaccharide. The viral protein was expressed using Escherichia coli codon preference optimization technology to achieve efficient binding of the polysaccharide and viral protein.

Benefits of technology

It significantly improves the breadth and duration of the vaccine's immune protection, achieves cross-protection against heterologous pathogens, reduces breeding costs and the risk of pathogen transmission, and reduces the frequency of antibiotic use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120605324A_ABST
    Figure CN120605324A_ABST
Patent Text Reader

Abstract

The invention relates to a porcine bacterial polysaccharide-viral protein conjugate vaccine as well as a preparation method and application thereof, and belongs to the technical field of animal vaccines. The vaccine takes porcine bacterial polysaccharide and virus protein as raw materials, and a polysaccharide-virus protein conjugate is formed through coupling of a biotin-avidin system; wherein the virus protein is selected from one of classical swine fever virus E2 protein, porcine circovirus type 2 Cap protein, porcine pseudorabies virus gD protein and the like, and the porcine bacterial polysaccharide is selected from one of streptococcus suis capsular polysaccharide, porcine pasteurella multocida capsular polysaccharide and the like. The vaccine can simultaneously induce an organism to generate a high-level IgG antibody aiming at porcine bacterium capsular polysaccharide and virus protein, so that synergistic immune protection on porcine bacterium and virus infection is realized, and a broad-spectrum cross immune effect is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a porcine-derived bacterial polysaccharide-viral protein combined vaccine and a preparation method and application thereof, belonging to the technical field of vaccine preparation. Background Art

[0002] Pig-borne bacterial infections such as Streptococcus suis, Pasteurella multocida, porcine pleuropneumonia, and Haemophilus parasuis, as well as viral infections such as classical swine fever virus, porcine circovirus type 2, and pseudorabies virus, are showing a clear and increasing trend in prevalence. These pathogens not only infect pigs individually, causing significant economic losses, but some are also zoonotic, posing a serious threat to human health and becoming a hot topic of concern in the global livestock and animal husbandry industry and public health.

[0003] At present, traditional vaccine technologies for the above-mentioned swine bacterial diseases are mainly inactivated vaccines, live attenuated vaccines and subunit vaccines. Although these vaccines have achieved certain results in clinical applications, they all have obvious shortcomings. Inactivated vaccines can usually only provide protection against specific homologous strains, and lack cross-protection against heterotypic or variant strains, resulting in a narrow spectrum of protection; although live attenuated vaccines have better immune effects, they have safety risks, such as the risk of vaccine strain reversion or immunosuppression, and are difficult to meet the high standards of breeding safety; and subunit vaccines have a short duration of immune protection due to their single antigen and limited immunogenicity. In addition, the above vaccines are unable to effectively activate T cell-mediated long-term immune memory responses, making it difficult to achieve potent, long-lasting and broad-spectrum protection.

[0004] Capsular polysaccharides (CPS) are widely present on the cell surfaces of swine pathogens. They are important virulence factors that trigger infection and pathogenicity in swine bacteria and are also important vaccine targets. However, pure capsular polysaccharides are T-cell-independent antigens (TI antigens), which can only induce a transient IgM antibody response, are difficult to activate T-cell immunity, and lack long-term immune protection. Therefore, to improve the immune efficacy and duration of protection of polysaccharide vaccines, polysaccharide-protein conjugate vaccine technology has emerged. By coupling polysaccharide antigens with carrier proteins, the T-cell-independent antigen is converted into a T-cell-dependent antigen (TD antigen), thereby inducing the body to produce more potent and long-lasting immune protection.

[0005] Existing veterinary polysaccharide conjugate vaccines typically use traditional carrier proteins, such as tetanus toxoid, diphtheria toxoid, or their variants, as conjugation carriers. These carrier proteins themselves have no direct anti-pathogen protective effects and only serve as immunopotentiators. Therefore, in the face of complex multi-pathogen infections, they cannot provide direct protection against other pathogens such as viruses. Furthermore, traditional conjugation processes suffer from low conjugation efficiency, difficulty in ensuring product purity, and harsh reaction conditions, which seriously restrict the industrial development and practical application of veterinary polysaccharide conjugate vaccines.

[0006] Furthermore, swine-borne viral infections pose a significant threat to the pig industry. Classical Chinese Fever Virus (CSFV) infection can cause highly lethal infections in pigs, while Porcine Circovirus Type 2 (PCV2) infection can trigger immunosuppression and a wasting syndrome. Pseudorabies Virus (PRV) infection can cause reproductive failure and high neonatal mortality. While vaccines against these viruses are commercially available, they are typically administered as single-pathogen vaccines, failing to achieve synergistic control in combination with bacterial vaccines. This increases production costs and complicates immunization procedures.

[0007] Therefore, the development of a new vaccine that can effectively prevent and control infections caused by pig-derived bacterial pathogens and viral pathogens at the same time, especially the effective combination of pig-derived capsular polysaccharides and viral proteins to obtain broader-spectrum and longer-lasting immune protection, has become a technical problem that needs to be urgently solved in the current field of veterinary vaccines, and has significant practical needs and market application value. Summary of the Invention

[0008] To address the above technical issues, the present invention aims to provide a porcine bacterial polysaccharide-viral protein conjugate vaccine, its preparation method, and its application. Based on the covalent interaction between biotin and avidin, a candidate porcine bacterial protein is used as a carrier to link the polysaccharide to form the vaccine antigen. The vaccine's immune efficacy was evaluated in a mouse immune protection assay, providing new insights into the development of porcine polysaccharide-protein conjugate vaccines.

[0009] A porcine-derived bacterial polysaccharide-viral protein conjugate vaccine, comprising an NH polysaccharide-viral protein conjugate formed by coupling a porcine-derived polysaccharide with a viral protein; The viral protein is selected from one of the group consisting of classical swine fever virus E2 protein, porcine circovirus type 2 Cap protein, pseudorabies virus gD protein, porcine epidemic diarrhea virus S protein, porcine reproductive and respiratory syndrome virus GP5 protein, and porcine rotavirus VP7 protein; The porcine-derived bacterial polysaccharide is selected from one of the following: Streptococcus suis capsular polysaccharide, Pasteurella multocida capsular polysaccharide, Actinobacillus pleuropneumoniae capsular polysaccharide, Haemophilus parasuis capsular polysaccharide, Escherichia coli capsular polysaccharide and Salmonella capsular polysaccharide.

[0010] Furthermore, the pig-derived polysaccharide is Streptococcus suis type 2 capsular polysaccharide, which is derived from a strain deposited in the China Center for Type Culture Collection on December 6, 2024, with a collection number of CCTCC NO: M20242747 and a classification name of Streptococcus suis type 2 (Streptococcus suis S068).

[0011] Furthermore, the viral protein is specifically selected from one of the amino acid sequence at positions 35-349 of the E2 protein of classical swine fever virus, the full-length amino acid sequence of the Cap protein of porcine circovirus type 2, or the amino acid sequence at positions 63-181 of the gD protein of pseudorabies virus.

[0012] Furthermore, the polysaccharide-viral protein conjugate is formed by coupling with a biotin-avidin system, wherein the porcine polysaccharide is activated by CDAP and reacted with a biotinylation reagent Biotin-PEG3-NH2 to obtain a biotinylated polysaccharide.

[0013] A method for preparing a porcine-derived bacterial polysaccharide-viral protein conjugate vaccine comprises the following steps: S1: Extraction and purification of porcine bacterial polysaccharides; S2: Expression and purification of viral proteins; 1) Avidin-E2 fusion protein, Avidin-Cap fusion protein, and Avidin-gD fusion protein were constructed, respectively. The fusion proteins were composed of the amino acid sequence 45-179 of Avidin and viral antigen proteins connected by a connecting peptide. The viral antigen proteins were: The amino acid sequence at positions 35-349 of the E2 protein of classical swine fever virus, the full-length amino acid sequence of the Cap protein of porcine circovirus type 2, and the amino acid sequence at positions 63-181 of the gD protein of pseudorabies virus; The above gene sequence was codon-optimized for E. coli and inserted into the pET-28a expression vector; (2) transforming the expression vector into Escherichia coli BL21 (DE3) competent cells and inducing the expression of the fusion protein by isopropyl-β-D-thiogalactopyranoside (IPTG); (3) collecting the induced bacteria, disrupting them by ultrasonication and centrifuging them to separate and obtain the fusion protein; (4) Using the N-terminal histidine tag of the fusion protein, the target fusion protein was purified by nickel affinity chromatography; S3: binding of polysaccharide to viral proteins; S4: Vaccine preparation.

[0014] Furthermore, the viral protein is obtained by connecting the nucleotide sequence shown in SEQ ID NO.2 to the 3' end of the nucleotide sequence shown in SEQ ID NO.1 with a linker and one of the nucleotide sequences shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5 to obtain the target gene, and then performing plasmid transformation, protein expression and protein purification.

[0015] Furthermore, in step S2, the induction conditions are: For Avidin-E2 fusion protein, the induction temperature was 37°C and the induction time was 4 h; For Avidin-Cap fusion protein and Avidin-gD fusion protein, the induction temperature was 16°C and the induction time was 16 h; Furthermore, the adjuvant of the vaccine is selected from one or more of oil-water emulsion, aqueous adjuvant, and aluminum salt adjuvant.

[0016] A porcine polysaccharide-viral protein conjugate vaccine is used in the preparation of a vaccine for preventing porcine bacterial diseases and zoonotic bacterial infections.

[0017] The beneficial effects of the present invention are: This invention creatively proposes a porcine bacterial polysaccharide-viral protein conjugate vaccine, its preparation method, and application. This vaccine breaks through the limitation of existing veterinary polysaccharide conjugate vaccines that only use traditional protein carriers as immunopotentiators. It innovatively achieves efficient coupling of porcine bacterial polysaccharide antigens with viral protein antigens that have immune protective functions, significantly enhancing the vaccine's broad spectrum of immune protection. In this invention, important porcine bacterial polysaccharides, such as Streptococcus suis type 2 capsular polysaccharides and Pasteurella multocida capsular polysaccharides, are selected as basic antigens and effectively coupled with viral proteins such as classical swine fever virus E2 protein, porcine circovirus type 2 Cap protein, or pseudorabies virus gD protein, respectively, to construct a novel composite vaccine that combines bacterial and viral immune protection.

[0018] Specifically, the present invention achieves efficient binding of polysaccharides and viral proteins under mild conditions by introducing a biotin-avidin coupling system, wherein the porcine bacterial polysaccharide is first activated by a CDAP reagent and then reacted with a biotinylation reagent Biotin-PEG3-NH2 to prepare a biotinylated polysaccharide; the viral protein is expressed through the Avidin fusion technology to prepare Avidin-E2, Avidin-Cap or Avidin-gD fusion proteins with high affinity and good immunogenicity, thereby achieving directional and efficient binding of polysaccharides to proteins, overcoming technical bottlenecks such as harsh reaction conditions, low coupling efficiency, and poor product consistency of traditional chemical coupling methods, and effectively ensuring the quality stability of vaccine preparations and the feasibility of large-scale production.

[0019] Furthermore, during the extraction and purification of porcine bacterial polysaccharides, this invention optimizes the bacterial fermentation process, clarifies the fermentation conditions and culture medium composition, and employs branched polyethyleneimine (PEI) to efficiently remove nucleic acid impurities and phenol to remove protein impurities. This significantly improves the purity and structural integrity of the capsular polysaccharide, ensuring the effective retention of key antigenic epitopes and further enhancing the vaccine's immunogenicity. For the viral protein component, high-proportion soluble expression is achieved through Escherichia coli codon preference optimization technology and a low-temperature, slow-induction expression strategy. This significantly increases the purity and yield of the target protein, providing a reliable guarantee for the efficient preparation of vaccine formulations.

[0020] Animal immunization experiments have shown that the porcine bacterial polysaccharide-viral protein conjugate vaccine prepared by the present invention can rapidly induce the production of high levels of specific IgG antibodies in animals after immunization, including dual-specific immune responses to capsular polysaccharides and viral proteins. This significantly prolongs the duration of immunity, overcoming the short-term, inefficient immune protection afforded by traditional single-polysaccharide vaccines. Furthermore, the vaccine can produce a broad spectrum of cross-immune protection, with significant cross-protection against heterologous pathogens. This achieves coordinated prevention and control of multiple pathogens, effectively reducing the risk of pathogen transmission within pig herds and reducing morbidity and mortality.

[0021] Furthermore, this vaccine effectively reduces the livestock industry's reliance on antibiotics, significantly reducing the frequency and dosage of antibiotic use during the farming process. The coupling technology and vaccine preparation methods developed in this invention are highly operational and have broad prospects for industrialization and promotion. They not only fill the gap in the research and application of veterinary porcine bacterial polysaccharide-viral protein conjugate vaccines, but also provide an innovative solution for the comprehensive prevention and control of porcine bacterial and viral diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a one-dimensional hydrogen spectrum of Streptococcus suis type 2 capsular polysaccharide. A: Spectrum of Streptococcus suis type 2 polysaccharide reported in the literature; B: Spectrum of Streptococcus suis type 2 polysaccharide purified in our laboratory. HOD: deuterium signal in water; Neu5Ac3e: equatorial proton signal at the third carbon position in the N-acetylneuraminic acid structure; Neu5AcMe: methyl proton signal on the acetyl group in the N-acetylneuraminic acid structure; Neu5Ac3a: axial proton signal at the third carbon position in the N-acetylneuraminic acid structure.

[0023] Figure 2 This is a linear curve of the logarithm of the relative molecular mass of standard dextran and retention time.

[0024] Figure 3The expression of Avidin-E2 fusion protein. Marker: protein molecular weight standard; W: Whole; S: Supernate; P: Precipitate.

[0025] Figure 4 The expression of Avidin-Cap fusion protein. Marker: protein molecular weight standard; W: Whole; S: Supernate; P: Precipitate.

[0026] Figure 5 The expression of Avidin-gD fusion protein. Marker: protein molecular weight standard; W: Whole; S: Supernate; P: Precipitate.

[0027] Figure 6 Comparison of the one-dimensional proton spectra of Streptococcus suis type 2 capsular polysaccharide before and after activation. A: Spectrum of Streptococcus suis type 2 polysaccharide before activation; B: Spectrum of biotin (Biotin-PEG3-NH2); C: Spectrum of biotinylated Streptococcus suis type 2 polysaccharide.

[0028] Figure 7 This is a graph showing the levels of polysaccharide IgG antibodies in mice immunized with the CPS2-E2 vaccine measured by indirect ELISA.

[0029] Figure 8 This is a graph showing the levels of polysaccharide IgG antibodies in mice immunized with the CPS2-Cap vaccine measured by indirect ELISA.

[0030] Figure 9 This is a graph showing the levels of polysaccharide IgG antibodies in mice immunized with the CPS2-gD vaccine measured by indirect ELISA.

[0031] Figure 10 This is a graph showing the IgG antibody levels of mice immunized with the CPS2-E2 vaccine measured by indirect ELISA.

[0032] Figure 11 This is a graph showing the IgG antibody levels of CPS2-Cap vaccine-immunized mice measured by indirect ELISA.

[0033] Figure 12 This is a graph showing the IgG antibody levels of mice immunized with CPS2-gD vaccine protein measured by indirect ELISA. DETAILED DESCRIPTION

[0034] Example 1

[0035] This embodiment discloses a method for preparing a porcine-derived bacterial polysaccharide-viral protein conjugate vaccine, comprising the following steps:

[0036] 1.1 Bacterial fermentation The capsular polysaccharide high-producing strain S031 (CCTCC NO: M20242085), which was screened out from 46 clinical isolates of Streptococcus suis type 2 in our laboratory, was taken out from the -80℃ freezer and inoculated into 5 mL of TSB medium containing 5% newborn calf serum. It was cultured at 37℃±1℃ for 16 hours. The bacterial liquid was transferred to 150 mL of fresh TSB medium containing 5% newborn calf serum and cultured at 37℃±1℃ for 8 hours until the exponential growth phase. The culture was stopped, the cells were packaged and freeze-dried, and stored at 4℃ as the main seeds.

[0037] Inoculate the bacteria in the main seed freeze-dried tube into 5 mL of TSB medium containing 5% newborn calf serum, and culture it at 37℃±1℃ for 16 hours. Transfer the bacterial liquid to 150 mL of fresh TSB medium containing 5% newborn calf serum, and culture it at 37℃±1℃ for 8 hours until the exponential growth phase. Stop the culture, package and freeze-dry, and store at 4℃ as working seeds.

[0038] Remove the working seed bacteria from the working seed bank and inoculate them into 5 mL of TSB medium containing 5% newborn calf serum. Incubate at 37°C ± 1°C until the mid-logarithmic growth phase. Transfer the bacterial liquid to 400 mL of fresh TSB medium containing 5% newborn calf serum and incubate at 37°C ± 1°C for 8 hours until the exponential growth phase. Inoculate 200 mL of fermentation seed liquid into 4 L of liquid culture medium at a 5% inoculum size for fermentation. After 10 hours of incubation, when the bacteria enter the mid-to-late logarithmic growth phase, terminate the fermentation and harvest the bacterial liquid.

[0039] 1.2 Extraction and purification of capsular polysaccharides (1) Centrifugal collection of bacteria: The fermented bacterial liquid was centrifuged at 4000 rpm for 30 min, washed three times with 10 mM PBS, and concentrated to 1 / 10 volume with 10 mM PBS.

[0040] (2) Bacterial cell lysis and polysaccharide crude extraction: add lysozyme to a final concentration of 1 mg / mL, react at 37°C, 180 rpm for 12 hours, then centrifuge at 10,000 rpm for 20 minutes, and collect the supernatant; (3) Removal of nucleic acids: Add a branched polyethyleneimine (PEI) aqueous solution with a final concentration of 350 mg / L to the supernatant, adjust the pH to 8.0 ± 0.2, shake at 25°C for 30 min, centrifuge at 10,000 rpm for 20 min, remove the precipitate, and collect the supernatant; (4) Add phenol to a final concentration of 5% to the protein-depleted supernatant, shake at room temperature for 4 hours, centrifuge at 10,000 rpm for 30 minutes, and collect the supernatant; (5) Ultrafiltration and Concentration: The supernatant was ultrafiltered eight times with an equal volume of pure water to remove impurities. The obtained pure polysaccharide solution was freeze-dried and stored.

[0041] 1.3 Polysaccharide characterization and analysis 1.3.1 Polysaccharide Assays The nucleic acid, protein, and polysaccharide contents of freeze-dried capsular polysaccharides were assayed to assess their purity and yield. The results of three batches of polysaccharide fermented and purified using the above procedure are shown in Table 1.

[0042] Table 1: Characterization data of three batches of freeze-dried polysaccharide from Streptococcus suis type 2 / Polysaccharide content Nucleic acid content Protein content Batch 1 77% 0.14% 0.64% Batch 2 85% 0.09% 0.53% Batch 3 79% 0.17% 0.71% 1.3.1 Chemical structure of polysaccharides The polysaccharides were fully dissolved in heavy water and their H NMR spectra were determined. 1 The spectrum was compared with the reported Streptococcus suis serotype 2 capsular polysaccharide in the literature Van Calsteren MR, Gagnon F, Lacouture S, et al. Structure determination of Streptococcus suis serotype 2 capsular polysaccharide.[J]. Biochemistry and Cell Biology, 2010. (Chinese translation: Van Calsteren MR, Gagnon F., Lacouture S. et al. Structural analysis of Streptococcus suis type 2 capsular polysaccharide[J]. Biochemistry and Cell Biology, 2010.), such as Figure 1 As shown in the figure, the capsular polysaccharide extracted by our laboratory is consistent with the spectrum reported in the literature. Figure 1 The points are normal.

[0043] 1.3.2 Detection of polysaccharide molecular size distribution Gel chromatography was used to determine the molecular weight of polysaccharides. The external water volume V0 and internal water volume Vt of the chromatography column (1.6× 90 cm) were calibrated with blue dextran (Bluedextran 2000kd) and vitamin B12, and the polysaccharide was dissolved to 5 mg / mL and loaded. The loading conditions were 0.9% NaCl (pH 7.0) as eluent, a flow rate of 0.8 mL / min, and a fraction collection of 3 mL / tube. The detection signal was a differential refractometer, 254 nm, and 280 nm wavelength signals. Record the volume Ve of the highest peak of the polysaccharide on the chromatography column, and calculate the Kd value according to the formula Kd = (Ve -V0) / (Vt -V0). Alternatively, different molecular weight dextran can be used as a standard to draw a standard curve of molecular weight and retention time, and the molecular weight of the target polysaccharide can be calculated according to its retention time. For example Figure 2As shown, the molecular weight of Streptococcus suis type 2 capsular polysaccharide should be 300-400KDa.

[0044] 2.1 Viral protein screening 2.1.1 Classical Swine Fever Virus (CSFV) E2 Protein The E2 protein, the primary glycoprotein on the surface of the CSFV envelope, can induce the production of high-titer neutralizing antibodies and is a core target for current vaccine development. Current research has confirmed that this protein can be efficiently expressed in a variety of systems, including Escherichia coli, Pichia pastoris, and adenovirus vectors, and that mature purification processes exist, making it suitable for large-scale production.

[0045] 2.1.2 Porcine circovirus type 2 (PCV2) Cap protein The Cap protein, a major structural protein of porcine circovirus type 2, can induce high-titer neutralizing antibodies. Previous studies have shown that it exhibits 100% protection in animal models, triggering significant humoral and cellular immune responses in both mice and pigs. It is a core target for porcine circovirus type 2 subunit vaccine development. Furthermore, the Cap protein can be easily, rapidly, and efficiently induced and purified using a prokaryotic Escherichia coli expression system.

[0046] 2.1.3 Pseudorabies virus gD protein The gD protein is the primary structural protein of pseudorabies virus (PRV), playing a crucial role in viral attachment and invasion of host cells. It is also a key neutralizing antigen and the primary target of protective antibodies. It can induce a robust protective response against virulent PRV strains and elicit significant humoral and cellular immune responses, making it the preferred protein for research on specific PRV antigens.

[0047] 2.2 Construction of protein expression vector 2.2.1 Target gene synthesis and recombinant plasmid construction The optimized core avidin, Avidin, was selected from the amino acid sequence 45-179 of rhizavidin. The nucleotide sequence encoding the Avidin protein was optimized according to the Escherichia coli preferred codon table (SEQ ID NO. 1), and a flexible linker (SEQ ID NO. 2) was added to the 3' end. Protein antigens were selected from the amino acid sequences 35-349 of the Classical Swine Fever Virus E2 protein, the full-length amino acid sequence of the Porcine Circovirus Type 2 Cap protein, and the amino acid sequences 63-181 of the Pseudorabies Virus gD protein. The nucleotide sequences were also optimized according to the E. coli preferred codon table (SEQ ID NOs. 3-5) and ligated to the linker. To facilitate subsequent plasmid construction, a BamHI restriction site was added to the N-terminus and an XhoI restriction site to the C-terminus. The optimized nucleotide sequence was synthesized by Suzhou GeneWeiZhi Biotechnology Co., Ltd., and the synthesized recombinant gene fragment was inserted into the pET-28a plasmid to construct the recombinant vector.

[0048] SEQ ID NO.1: TTTGATGCGAGTAACTTTAAAGATTTCAGCTCTATTGCGAGCGCCAGTAGCTCTTGGCAGAATCAGAGTGGCAGCACCATGATTATCCAGGTGGATTCTTTCGGCAACGTTAGTGGCCAGTATGTTAATCGTGCGCAGGGCACGGGTTGCCAGAACTCTCCGTACCCGCTGACCGGCCGCGTGAATGGCACGTTTATCGCCT TCAGCGTTGGCTGGAACAATTCTACCGAAAACTGTAATAGTGCAACCGGCTGGACGGGTTATGCGCAGGTGAACGGTAACAATACCGAAATTGTTACGAGCTGGAATCTGGCCTATGAAGGCGGTTCTGGCCCGGCAATCGAACAGGGTCAGGATACCTTTCAGTACGTTCCGACCACGGAAAACAAAAGCCTGCTGAAAGAT SEQ ID NO.2: GGAGGCGGAGGTTCGAGCTCC SEQ ID NO.3: TGCTATGAAGACGCCGCGTATACCTGCCTGGATGGCTCTTGCACCGTGCCGCAGGAAGTGGTAGTGAAACCGGGCGCGAGCGTGCAGGTTTGCGTTAAAAACGGCGAATGTTGGATTCCGTGTCCGACCACCAACGGCAAATGTCAGCTGGTGTGTCCGGCGGGTAGCTATGGCCCGGTCTATTGCAAACTGGTGTGCCCGGTGGGCAGCGTGGAACTGGTGTGCAACAGCACCGCGGGCACGTACCTGTGTAAACCGAACTGCAGCTCACAGCCGCAAGTGAAACTGCTGAAAGTGGCCCAGGTTAATGGCGCGCCGTGCCAGGTGCCGGTGGCACCGAACCAGAAAATTTATATTCAGGCGGGCCGCACCATTACCGGCGATAACACCACCCTGACCTGTCGTCTGCCGGGCAACAGCCCGGTGCTGAAAGATGGCTTTCTGGTGGAAGCGCAGTACAAAGCGCGTACCACCTTCCTGGGCACCACCTACGCCGTGACCTATAAAGTGGTGCCGACCGTTGATGGCGTGGTGATGACCACTGTTAGCGGCGATGGCTTTGTGATTTATGGCGTGGGCGCAGTGAGCCAGGTGAACCGCTATTTTCAGCCGGGCAGCAGCGTGGCCAAAAGCGAACCGTTCACCAACCTGCGCAAACACCCGCATCTGCGCTGCGATAGCAGCACGGCGTACAGCAGCACCACCGCGATTACCGTGCACCACCCGCATGAGCTGGCGAAAGTGGTGCAGAAAGTGTATTCAGTGCAGGATCTGCAGCCGGTTATGAAAACCACCACGAGCGGCAGCGATCTGGTGTGCGAAGTGGGTGGCACGATTCAGGCGTGCAAAGTGGCGGAACTGGAAGGCGTGACCTACGTGTGCACCGTGGGCGCGCCGGGTACCGCCTACGTGAAATGCAGCGCGACGGGCCTGTGCCGCCTGCAGTAA SEQ ID NO.4: AACGGCATTTTCAACACCCGTCTGAGCCGTACCTTTGGTTATACCGTGAAGAAAACCACCGTTCGTACCCCGAGCTGGAAGGTGGACATGATGCGTTTCAACATCAACGATTTTCTGCCGCCGGGTGGCGGTAGCAACCCGCTGAGCGTTCCGTTCGAGTACTATCGTATCCGTAAGGTGAAAGTTGAATTTTGGCCGTGCAGCCCGATTACCCAAGGTGACCGTGGCGTGGGTAGCAGCGCGGTTATCCTGGACGATAACTTCGTGACCAAAGCGACCGCGCTGACCTACGATCCGTATGTTAACTACAGCAGCCGTCACACCATTACCCAGCCGTTCAGCTATCACAGCCGTTACTTTACCCCGAAGCCGGTGCTGGACAGCACCATCGATTATTTCCAACCGAACAACAAACGTAACCAGCTGTGGCTGCGTCTGCAAACCACCGGCAACGTGGACCACGTTGGCCTGGGCACCGCGTTTGAGAACAGCATCTATGATCAGGAATACAACATTCGTGTGACCATGTACGTTCAATTCCGTGAGTTTAACCTGAAGGACCCGCCGCTGAACCCGAAA SEQ ID NO.5: GAAGACCCGTGTGGCGTTGTAGCGCTGATTAGCGATCCGCAGGTGGATCGTCTGCTGAACGAAGCCGTGGCGCATCGTCGCCCGACCTATCGCGCCCATGTGGCGTGGTATCGCATCGCGGATGGCTGCGCGCATCTGCTGTATTTTATTGAATATGCGGATTGCGATCCGCGCCAGATTTTTGGCCGCTGCCGCCGCCGTACCACCCCGATGTGGTGGACCCCGAGCGCGGATTACATGTTTCCGACCGAAGATGAACTGGGCCTGCTGATGGTGGCGCCGGGCCGCTTTAATGAAGGCCAGTATCGCCGTCTGGTGAGCGTGGATGGCGTCAATATTCTGACCGATTTTATGGTGTAA 2.2.2 Plasmid transformation The recombinant plasmid was transferred into competent cells BL21 (DE3) by heat stress method, and single clones that could grow on kanamycin-resistant plates were picked out. The results of PCR and double enzyme digestion were positive, indicating that the construction of the prokaryotic expression vector was completed.

[0049] 2.3 Protein expression 2.3.1 Expression of Avidin-E2 Protein (1) Take the preserved prokaryotic expression strain and shake culture overnight to revive it.

[0050] (2) Transfer the cells to a conical flask containing kanamycin-resistant LB medium at a ratio of 1:100 and culture at 37°C with shaking at 220 rpm.

[0051] (3) When the bacteria reached the logarithmic growth phase, 0.5 mM inducer IPTG was added and induced at 37°C and 220 rpm for 4 hours.

[0052] (4) Collect the induced bacterial solution, centrifuge it at 6000 rpm for 15 minutes, and collect the bacterial precipitate.

[0053] (5) Resuspend the bacterial pellet with PBS at 1 / 10 the volume of the original bacterial solution, place it in an ice-water bath and crush it in an ultrasonic crusher. When the transparency of the bacterial solution changes significantly, stop ultrasonication.

[0054] (6) Place the broken bacterial solution in a centrifuge tube and centrifuge at 12000 rpm for 30 minutes. A clear precipitate will be visible at the bottom. Take the supernatant and precipitate samples to detect the expression of the target protein. Figure 3 As shown, the target protein is mainly present in the precipitate and expressed in the form of inclusion body protein.

[0055] 2.3.2 Expression of Avidin-cap Protein (1) Take the preserved prokaryotic expression strain and shake culture overnight to revive it.

[0056] (2) Transfer the cells to a conical flask containing kanamycin-resistant LB medium at a ratio of 1:100 and culture at 37°C with shaking at 220 rpm.

[0057] (3) When the bacteria reached the logarithmic growth phase, 0.5 mM inducer IPTG was added and induced at 16°C and 120 rpm for 16 hours.

[0058] (4) Collect the induced bacterial solution, centrifuge it at 6000 rpm for 15 minutes, and collect the bacterial precipitate.

[0059] (5) Resuspend the bacterial pellet with PBS at 1 / 10 the volume of the original bacterial solution, place it in an ice-water bath and crush it in an ultrasonic crusher. When the transparency of the bacterial solution changes significantly, stop ultrasonication.

[0060] (6) Place the broken bacterial solution in a centrifuge tube and centrifuge at 12000 rpm for 30 minutes. A clear precipitate will be visible at the bottom. Take the supernatant and precipitate samples to detect the expression of the target protein. Figure 4 As shown, the target protein is mainly present in the supernatant and expressed in the form of soluble protein.

[0061] 2.3.3 Expression of Avidin-gE Protein (1) Take the preserved prokaryotic expression strain and shake culture overnight to revive it.

[0062] (2) Transfer the cells to a conical flask containing kanamycin-resistant LB medium at a ratio of 1:100 and culture at 37°C with shaking at 220 rpm.

[0063] (3) When the bacteria reached the logarithmic growth phase, 0.5 mM inducer IPTG was added and induced at 16°C and 120 rpm for 16 hours.

[0064] (4) Collect the induced bacterial solution, centrifuge it at 6000 rpm for 15 minutes, and collect the bacterial precipitate.

[0065] (5) Resuspend the bacterial pellet with PBS at 1 / 10 the volume of the original bacterial solution, place it in an ice-water bath and crush it in an ultrasonic crusher. When the transparency of the bacterial solution changes significantly, stop ultrasonication.

[0066] (6) Place the broken bacterial solution in a centrifuge tube and centrifuge at 12000 rpm for 30 minutes. A clear precipitate will be visible at the bottom. Take the supernatant and precipitate samples to detect the expression of the target protein. Figure 5 As shown, the target protein is expressed in both the supernatant and the precipitate. The soluble protein in the supernatant can be further purified for subsequent coupling.

[0067] 2.4 Protein purification To facilitate the purification of the target protein, we retained the histidine tag at the N-terminus of the plasmid during design, allowing the plasmid to express a continuous histidine sequence. The imidazole ring in the histidine can bind to the nickel ions in the purification column. Since different proteins carry different numbers of imidazole rings and have different affinities with the nickel column, when the concentration of imidazole in the mobile phase is increased, the protein will gradually be eluted, thereby achieving the purpose of separating different proteins. Finally, the target protein is eluted from the nickel column using a high concentration of imidazole buffer. The specific steps are as follows: (1) Nickel column binding: Take a well-preserved nickel column, drain the liquid from the column, rinse thoroughly with deionized water, then add his buffer A containing 25 mM imidazole to equilibrate and drain the liquid. Add the filtered ultrasonic supernatant (E2 protein is the supernatant after renaturation), shake on ice for more than 2 hours, and drain the flow-through from the column.

[0068] (2) Washing: Wash three times with his buffer A containing 25 mM imidazole (5-10 column volumes each time), each time for 5-10 minutes, and place in an ice bath on a shaker to remove impurities.

[0069] (3) Elution: Elute twice with his buffer B containing 250 mM imidazole, 10 minutes each time, and place in a shaker ice bath to elute the target protein.

[0070] (5) SDS-PAGE detection: Take 40 μL of sample, add 10 μL of 5× Loading Buffer, and boil in a boiling water bath for 10 minutes to complete the sample preparation. SDS-PAGE run was used to identify the protein purification status.

[0071] (6) Dialysis: Based on the SDS-PAGE results, the eluate containing the target protein was placed in a 3.5 kDa dialysis bag and dialyzed overnight in 1× PBS to remove imidazole.

[0072] (7) BCA quantitative storage: Concentrate to a concentration of about 1 mg / mL using an ultrafiltration tube, and store in aliquots at -80°C.

[0073] 3.1 Polysaccharide activation CDAP is used to activate polysaccharides with hydroxyl groups to form cyanate, which reacts with the amino groups carried by biotin (Biotin-PEG3-NH2) to generate biotinylated polysaccharides. Figure 6 As shown in the figure, a series of new peaks appeared after activation of the polysaccharide. For example, the peak at 2.19 ppm corresponds to the CH2 NMR signal connected to the carbonyl group of biotin, proving that CDAP activation and modification were successful.

[0074] 3.2 Preparation of polysaccharide-protein conjugates The materials were added in a mass ratio of 1:1, and the freeze-dried biotinylated polysaccharide was dissolved in a 150 mM NaCl aqueous solution and directly dissolved and mixed with the purified recombinant proteins. The mixture was placed on a rotary shaker and reacted at 4°C overnight.

[0075] 3.3 Characterization and analysis of polysaccharide-protein conjugates 3.3.1 Determination of total polysaccharide content The total polysaccharide content in the sample was determined by the phenol-sulfuric acid method.

[0076] 3.3.2 Determination of free polysaccharide content Add 5% (V / V) 1M HCL solution to the test solution, mix while adding, and let it stand for 15 minutes to precipitate the free carrier protein and bound carrier protein in the solution to obtain free sugars. Then use the phenol-sulfuric acid method to detect the free polysaccharide content. The free polysaccharide content should not be higher than 20% of the total polysaccharide content, that is, the coupling rate of the polysaccharide should be greater than 80%.

[0077] 3.3.3 Determination of total protein content Detect the total protein content of the sample according to the BCA method 3.3.4 Determination of free protein content The free protein content was determined by high performance liquid chromatography, and the free protein content should not be higher than 20% of the total protein content.

[0078] Dilute the following antigens in pre-chilled PBS according to the desired ratio. Weigh the aqueous and oily biphasic adjuvant M903 (aqueous:oil = 45:55 volume ratio) separately and place them in a 250mL glass beaker. Slowly add the aqueous phase to the adjuvant (over 3 seconds, 5-10 L / min) while stirring at 500-700 rpm and maintaining a temperature of 32-33°C. Stir for 5-10 minutes. After stirring, store the prepared emulsion at a low temperature (<15°C) for 24 hours, avoiding movement and agitation. Vaccine preparation is complete. The vaccine components and concentrations are shown in Table 2.

[0079] Table 2: Vaccine preparation record Group Polysaccharide content in vaccines Target protein content in the vaccine Total preparation volume CPS2 group 20 μg / mL 0 μg / mL 5mL E2 protein group 0 μg / mL 27 μg / mL 5mL Cap protein group 0 μg / mL 25 μg / mL 5mL gE protein group 0 μg / mL 22 μg / mL 5mL CPS2-E2 Group 20 μg / mL 27 μg / mL 5mL CPS2-Cap Group 20 μg / mL 25 μg / mL 5mL CPS2-gE group 20 μg / mL 22 μg / mL 5mL The following tests were performed on the vaccine preparations prepared above: 1. Vaccine preparation for immunization of mice and antibody level detection

[0080] 1.1 Experimental grouping and immunization Eighty female BALB / c mice aged 5-6 weeks were randomly divided into eight groups of 10 mice each. Each group was immunized with the vaccines prepared above (see Table 3). Each experimental group was injected subcutaneously at multiple sites on the back with 0.1 mL of the corresponding vaccine. Two weeks after the initial immunization, a second booster immunization was administered using the same route and dose. Following immunization, mice were housed normally, and their mental state, food and water intake, and changes in the injection site were observed daily and recorded.

[0081] Table 3: Grouping of mouse immunization test

[0082] 1.2 Detection of polysaccharide antibody levels in serum Blood was collected from mice in each group 2 weeks, 4 weeks and 6 weeks after the first immunization. After standing at room temperature for 2 hours, the blood was centrifuged at 3000 rpm for 10 minutes to separate the serum, and the levels of IgG antibodies against polysaccharides in the serum were detected.

[0083] The steps of Elisa test are as follows: (1) Coating: Dilute the freeze-dried CPS2 to 0.01 mg / mL with 1× PBS, coat the plate at a volume of 50 μL per well, and incubate in a 4°C refrigerator overnight.

[0084] (2) Washing: After coating, wash three times with 1×PBST at 250 μL / well.

[0085] (3) Blocking: After washing, add 200 μL of protein blocking solution to each well and incubate at room temperature for 2 hours. Then discard the protein blocking solution to complete the blocking process.

[0086] (4) Sample addition: 100 μL of the mouse serum sample to be tested and the positive and negative controls diluted 1:40 were added to the prepared ELISA plate and incubated at 37°C for 30 min.

[0087] (5) Washing: Discard the solution in the ELISA plate, add 300 μL of washing solution to each well and wash repeatedly 5 times.

[0088] (6) Secondary antibody incubation: After washing, add 100 μL of HRP-labeled goat anti-mouse IgG enzyme-labeled secondary antibody diluted 1:20,000 to each well and incubate at 37°C for 30 minutes.

[0089] (7) Washing: The washing method is the same as (5).

[0090] (8) Color development: Add 100 μL of color development solution to each well and incubate at room temperature in the dark for 10 minutes.

[0091] (9) Termination: Add 50 μL of stop solution to terminate the color development reaction.

[0092] (10) Detection: Set the wavelength of the microplate reader to 450 nm and measure the OD of each well within 10 minutes. 450nm value.

[0093] Test results such as Figures 7 to 9 As shown, the three different viral proteins expressed in our laboratory were conjugated to Streptococcus suis type 2 polysaccharide and combined with adjuvants to make vaccines that produced high levels of IgG antibodies 14 days after immunization in mice. However, immunization with Streptococcus suis type 2 polysaccharide alone did not significantly increase IgG antibody levels 6 weeks after the first immunization, which is significantly different from the three protein-conjugated vaccines.

[0094] 1.3 Detection of serum viral protein antibody levels The purified E2, Cap, and gE proteins were diluted to 0.01 mg / mL with 1× PBS, and coated in ELISA plates at a volume of 50 μL per well. The plates were incubated overnight at 4°C to prepare three protein-coated plates. The Elisa assay was performed in the same manner as in 5.2. Figures 10 to 12 As shown in the results, the classical swine fever virus E2 protein and porcine circovirus type 2 Cap protein expressed in our laboratory, coupled to Streptococcus suis type 2 polysaccharide, and adjuvanted vaccines produced high levels of IgG antibodies in mice 14 days after immunization, consistent with the immune protein group, with antibody levels slightly lower than those in the protein group. The pseudorabies virus gD protein expressed in our laboratory, coupled to Streptococcus suis type 2 polysaccharide, produced low antibody levels in mice 14 days after immunization, but produced high levels of IgG antibodies 28 days later, consistent with the immune protein group, possibly related to the immunogenicity of the protein itself.

[0095] In an optional embodiment, the suis Streptococcus polysaccharide-virus protein conjugate vaccine of the present invention can also be selected from one of porcine epidemic diarrhea virus S protein, porcine reproductive and respiratory syndrome virus GP5 protein and porcine rotavirus VP7 protein as the source of virus to protein, and can also be selected from one of Streptococcus suis capsular polysaccharide (type 4, type 7, type 9), porcine Pasteurella multocida capsular polysaccharide (type A, type B, type D), porcine Actinobacillus pleuropneumoniae capsular polysaccharide (type 1, type 5, type 15), Haemophilus parasuis capsular polysaccharide (type 4, type 5), Escherichia coli capsular polysaccharide, and Salmonella polysaccharide as the source of polysaccharide.

[0096] Purified capsular polysaccharides of Pasteurella multocida type D and Actinobacillus pleuropneumoniae type 15 were conjugated to purified E2, Cap, and gE proteins, respectively, and then used to immunize mice. Two weeks after the initial immunization, a second booster immunization was administered using the same route and dosage. Blood was collected from each group of mice at two, four, and six weeks after the initial immunization to measure serum IgG antibody levels against each bacterial polysaccharide and viral protein. The results showed that while no antibodies were produced in the control group, the immunized group produced antibodies against both bacterial capsular polysaccharides and viral proteins two weeks after the initial immunization, and antibody levels continued to increase by the sixth week. This indicates that immunization with this vaccine effectively stimulates an immune response in mice and provides a degree of immune protection.

[0097] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A porcine bacterial polysaccharide-viral protein conjugate vaccine, characterized in that: The vaccine comprises a polysaccharide-viral protein conjugate formed by coupling a porcine polysaccharide with a viral protein; The viral protein is selected from one of the group consisting of classical swine fever virus E2 protein, porcine circovirus type 2 Cap protein, pseudorabies virus gD protein, porcine epidemic diarrhea virus S protein, porcine reproductive and respiratory syndrome virus GP5 protein, and porcine rotavirus VP7 protein; The porcine-derived bacterial polysaccharide is selected from one of the following: Streptococcus suis capsular polysaccharide, Pasteurella multocida capsular polysaccharide, Actinobacillus pleuropneumoniae capsular polysaccharide, Haemophilus parasuis capsular polysaccharide, Escherichia coli capsular polysaccharide and Salmonella capsular polysaccharide.

2. A porcine bacterial polysaccharide-viral protein conjugate vaccine according to claim 1, characterized in that: The pig-derived bacterial polysaccharide is Streptococcus suis type 2 capsular polysaccharide, which is derived from a strain deposited in the China Center for Type Culture Collection on December 6, 2024, with a collection number of CCTCC NO: M20242747 and a classification name of Streptococcus suis type 2.

3. A porcine bacterial polysaccharide-viral protein conjugate vaccine according to claim 1, characterized in that: The viral protein is specifically selected from one of the amino acid sequence at positions 35-349 of the E2 protein of classical swine fever virus, the full-length amino acid sequence of the Cap protein of porcine circovirus type 2, or the amino acid sequence at positions 63-181 of the gD protein of pseudorabies virus.

4. A porcine bacterial polysaccharide-viral protein conjugate vaccine according to claim 1, characterized in that: The polysaccharide-virus protein conjugate is formed by coupling with a biotin-avidin system, wherein the porcine bacterial polysaccharide is activated by CDAP and then reacts with a biotinylation reagent Biotin-PEG3-NH2 to obtain a biotinylated polysaccharide.

5. A method for preparing the porcine bacterial polysaccharide-viral protein conjugate vaccine according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1: Extraction and purification of porcine bacterial polysaccharides; S2: Expression and purification of viral proteins: Avidin-E2 fusion protein, Avidin-Cap fusion protein, and Avidin-gD fusion protein were constructed, and their coding sequences were optimized for E. coli-preferred codons. The proteins were then expressed in E. coli BL21 (DE3) competent cells and purified. The fusion proteins were composed of the amino acid sequence 45-179 of avidin linked to viral antigen proteins via a connecting peptide. The viral antigen proteins are: The amino acid sequence at positions 35-349 of the E2 protein of classical swine fever virus, the full-length amino acid sequence of the Cap protein of porcine circovirus type 2, and the amino acid sequence at positions 63-181 of the gD protein of pseudorabies virus; S3: binding of polysaccharide to viral proteins; S4: Vaccine preparation.

6. The method for preparing the porcine bacterial polysaccharide-viral protein conjugate vaccine according to claim 5, characterized in that: The viral protein is obtained by connecting the nucleotide sequence shown in SEQ ID NO.1 to a nucleotide sequence shown in SEQ ID NO.2 with a linker added to the 3' end and one of the nucleotide sequences shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5 to obtain the target gene, and then performing plasmid transformation, protein expression and protein purification.

7. A method for preparing the porcine bacterial polysaccharide-viral protein conjugate vaccine according to claim 5, characterized in that: During the extraction and purification of porcine bacterial polysaccharides in step S1, the bacterial solution obtained from the strain culture is washed, concentrated, and reacted with lysozyme, and then purified using a branched polyethyleneimine flocculant and phenol.

8. A method for preparing the porcine bacterial polysaccharide-viral protein conjugate vaccine according to claim 5, characterized in that: In the step S2, the induction conditions are: For Avidin-E2 fusion protein, the induction temperature was 37°C and the induction time was 4 h; For Avidin-Cap fusion protein and Avidin-gD fusion protein, the induction temperature was 16°C and the induction time was 16 hours.

9. The method for preparing the porcine bacterial polysaccharide-viral protein conjugate vaccine according to any one of claims 6 to 8, characterized in that: The adjuvant of the vaccine is selected from one or more of oil-water emulsion, aqueous adjuvant and aluminum salt adjuvant.

10. Use of the vaccine according to any one of claims 1 to 9 in the preparation of a vaccine for preventing swine-borne bacterial diseases and zoonotic bacterial infections.