SiRNA for targeted inhibition of IMPAD1 expression and application thereof
By targeting siRNA to inhibit chicken IMPAD1 expression, the problem of insufficient IMPAD1 gene regulation in poultry breeding was solved, efficient regulation of chicken muscle development was achieved, and molecular markers were provided for genetic selection of high-quality broilers.
Patent Information
- Application Number
- CN202510757687.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-09-09
AI Technical Summary
In poultry breeding, existing technologies have not yet effectively regulated the role of the IMPAD1 gene in muscle development, affecting the molecular mechanism of muscle development and the progress of molecular breeding.
We designed and applied siRNA targeting the inhibition of chicken IMPAD1 expression, and transferred it into chicken primary myoblasts to achieve highly efficient inhibition of the IMPAD1 gene, with an inhibition efficiency of over 50%.
By efficiently inhibiting IMPAD1 gene expression and promoting chicken muscle development, it provides a molecular marker for the genetic selection of high-quality broiler breast muscles, which has significant economic and scientific research value.
Smart Images
Figure CN120608061A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of poultry breeding, and in particular to a targeted siRNA for inhibiting IMPAD1 expression and an application thereof. Background Art
[0002] The protein encoded by IMPAD1 (Inositol Monophosphatase Domain-Containing Protein 1) is an enzyme located in the Golgi apparatus that converts adenosine phosphate to adenylate (AMP), a process crucial for energy metabolism and signal transduction. Pathogenic variants in IMPAD1, resulting in GPAPP protein deficiency, can lead to symptoms such as short stature and chondrodysplasia in humans. In mice, inactivation of IMPAD1 also leads to chondrodysplasia, abnormal joint formation, and impaired proteoglycan sulfation. This suggests that IMPAD1 plays an essential role in cartilage development in both humans and mice.
[0003] In poultry, the role of the IMPAD1 gene in muscle development has not been reported. Studying the regulatory role of the IMPAD1 gene in chicken muscle development is of great significance for revealing the molecular mechanism of poultry muscle development and molecular breeding. Summary of the Invention
[0004] In view of the shortcomings of the existing technology, the present invention provides a targeted siRNA for inhibiting IMPAD1 expression and its application. After being transferred into chicken primary myoblasts, it can effectively reduce the expression of chicken IMPAD1 gene with an inhibition efficiency of more than 50%, and the knockdown efficiency is very high.
[0005] To achieve the above objectives, the present invention is implemented through the following technical solutions:
[0006] The present invention provides an siRNA that targets and inhibits the expression of chicken IMPAD1. The siRNA is:
[0007] Justice chain: GCAGAAAGTGTTACTGTCTTT,
[0008] Antisense strand: AGACAGTAACACTTTCTGCTT.
[0009] The present invention also provides the use of the siRNA targeted to inhibit chicken IMPAD1 expression in the genetic breeding of high-quality broiler breast muscle development.
[0010] The present invention has the following beneficial effects:
[0011] The present invention provides a siRNA that can target and inhibit the expression of the chicken IMPAD1 gene. When transferred into primary chicken myoblasts, it effectively reduces IMPAD1 gene expression, achieving an inhibition efficiency exceeding 50%, a high knockdown efficiency. The siRNA of the present invention specifically knocks down IMPAD1 gene expression in vitro to identify gene function. It can be used as a molecular marker in the genetic selection and breeding of high-quality broiler breast muscle development, possessing significant economic and scientific value. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 The expression of IMPAD1 in breast muscle tissue of different chicken strains (different letters indicate significant differences (P < 0.05), the same letters indicate no significant differences (P > 0.05); ** indicates significant differences (P < 0.01)); S3, H, and F analyses represent S3, H, and F chicken strains;
[0013] Figure 2 is the expression of IMPAD1 in chicken myoblasts (different letters indicate significant differences (P < 0.05));
[0014] Figure 3 The expression changes of IMPAD1 gene after exogenous transfection of IMPAD1 siRNA (different letters represent significant differences (P < 0.05), and the same letters represent no significant differences (P > 0.05));
[0015] Figure 4 Expression changes of myoblast differentiation marker genes after exogenous transfection of IMPAD1 siRNA. DETAILED DESCRIPTION
[0016] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0017] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0018] Example 1 Detection of IMPAD1 expression in pectoral muscle tissue and myoblasts by fluorescence quantitative PCR
[0019] 1.1 RNA extraction and cDNA preparation
[0020] Breast and leg muscle tissues were collected from six hens per strain at 0, 2, 5, 10, and 15 weeks of age and stored at -80°C. Total RNA was extracted from breast muscle tissue using the RNA isolater Total RNA Extraction Reagent kit (Nanjing Novozymes Biotechnology Co., Ltd.). RNA concentration was determined using a nucleic acid quantifier. cDNA synthesis was performed according to the instructions for the reverse transcription kit from Shanghai Sangon Biotechnology Co., Ltd.
[0021] 1.2 Detection of IMPAD1 expression in muscle tissue using QPCR technology
[0022] The expression of IMPAD1 in pectoral muscle tissue of different strains at different developmental stages was detected by QPCR. Figure 1 As shown in the results, there were significant breed and developmental differences in the expression of IMPAD1 in breast muscle tissue of different strains at different developmental stages (P<0.05), indicating that IMPAD1 is involved in the process of chicken muscle development.
[0023] Real-time fluorescence quantitative PCR (qPCR) was performed using Hi Script III RT SuperMix for qPCR (with g DNAwiper) reagents from Nanjing Novozymes Biotechnology Co., Ltd. SYBR Green I was used. The Q-PCR reaction protocol for IMPAD1 gene expression was as follows: 95°C for 15 min, followed by 40 cycles (94°C for 15 s, 55°C for 30 s, and 70°C for 30 s).
[0024] The nucleic acid sequences of the quantitative primers for the IMPAD1 gene are as follows:
[0025] Upstream primer: 5'-CTGTGATAATCCCCGCTGGT-3'
[0026] Downstream primer: 5'-ATAAGTCCTCCCTCATTGCCAT-3'
[0027] The primer nucleic acid sequences for internal reference GAPDH gene expression are as follows:
[0028] Upstream primer: 5'-AGAAGGCTGGGGCTCATCT-3'
[0029] Downstream primer: 5'-CAATGCCAAAGTTGTCATG-3'
[0030] 1.2 IMPAD1 expression in myoblasts
[0031] The expression of IMPAD1 gene in myoblast proliferation and differentiation stages was detected by QPCR technology. Figure 2As shown in the results, the expression of IMPAD1 gene was significantly higher in the proliferation stage of myoblasts than in the differentiation stage (P<0.05); there was no significant difference between the 1st, 3rd, 5th and 7th day of differentiation (P>0.05).
[0032] Example 2 Screening of siRNA sequences targeting the chicken IMPAD1 gene
[0033] 2.1 IMPAD1 siRNA Design
[0034] The chicken IMPAD1 gene mRNA sequence was obtained from the NCBI online database (accession number: XM_040664747.2). siRNAs targeting the CDS region of the chicken IMPAD1 gene were designed using siCatch™ siRNA design software. The siRNA sequences were supplemented with a TT overhang. The designed siRNAs were synthesized by Suzhou Jima Biotechnology Co., Ltd. After synthesis, 125 μL of DEPC water was added to each 1 OD of siRNA to a final concentration of 20 μM / μL and stored at -20°C until use. The siRNA sequences are shown in Table 1.
[0035] Table 13 pairs of siRNA sequences
[0036]
[0037] 2.2siRNA transfection of primary chicken myoblasts
[0038] Chicken myoblasts isolated from breast muscle tissue of 13-embryonic-age chickens were used as transfected cells. These primary chicken myoblasts were seeded into 12-well culture plates. When the cells reached a density of 70%, the culture medium was aspirated and replaced with fresh medium. Using the transfection reagent Lipofectamine 3000, siRNA targeting the chicken IMPAD1 gene and a negative control siRNA (NC) were transfected into the chicken myoblasts, respectively. Three replicate wells were set up for each group.
[0039] The specific transfection system is as follows: experimental group: 150 μL opti-MEM medium + 5 μL siRNA with a final concentration of 20 μM + 8 μL Hiperfect transfection; control group: 100 μL opti-MEM medium + 5 μL Negative with a final concentration of 20 μM + 8 μL Hiperfect transfection, incubate for 8 minutes to form a transfection complex, and transfect into the culture medium.
[0040] 2.3 RNA extraction and cDNA preparation
[0041] 24 hours after transfection, each well was washed three times with PBS. 0.8 ml of TROZL was added to the culture dish to collect the cells. Total RNA was extracted from the IMPAD1 siRNA-transfected and control groups using the RNA isolater Total RNA Extraction Reagent kit (Nanjing Novozymes Biotechnology Co., Ltd.). RNA concentration was determined using a nucleic acid quantifier. cDNA synthesis was performed according to the instructions for the reverse transcription kit (Shanghai Sangon Biotechnology Co., Ltd.).
[0042] 2.4 Real-time fluorescence quantitative PCR detection of siRNA interference efficiency
[0043] Real-time quantitative PCR (qPCR) was performed using the SYBR Green I assay using Hi Script III RT SuperMix for qPCR (with gDNAwiper) reagent from Nanjing Novozymes Biotechnology Co., Ltd. The efficiency of siRNA-specific knockdown of chicken IMPAD1 gene expression was determined using three replicates per sample. The Q-PCR reaction protocol was as follows: 95°C for 15 minutes followed by 40 cycles (94°C for 15 seconds, 55°C for 30 seconds, and 70°C for 30 seconds).
[0044] The efficiency of siRNA-specific knockdown of chicken IMPAD1 gene expression is as follows Figure 3 As shown. Figure 3 It can be seen that compared with the control group, the expression of IMPAD1 gene in the IMPAD1 siRNA group was significantly decreased (P<0.05), and the inhibition efficiency was more than 50%.
[0045] IMPAD1-siRNA positive strand: GCAGAAAGTGTTACTGTCTTT,
[0046] Antisense strand: AGACAGTAACACTTTCTGCTT.
[0047] 2.5 Effect of IMPAD1 gene knockdown on the expression of myoblast differentiation marker genes
[0048] After 15 days of IMPAD1-siRNA treatment, the expression of myoblast differentiation marker genes MyoD and MyoG decreased significantly compared with the control group (P < 0.01). Figure 4 As shown, the experiment proved that the IMPAD1 gene has the effect of inhibiting the differentiation of chicken myoblasts.
[0049] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A siRNA targeting and inhibiting the expression of chicken IMPAD1, characterized in that: The siRNA is IMPAD1-591, and the nucleotide sequence of IMPAD1-591 is: Justice chain: GCAGAAAGTGTTACTGTCTTT, Antisense strand: AGACAGTAACACTTTCTGCTT.
2. Use of the siRNA targeting and inhibiting chicken IMPAD1 expression according to claim 1 in the genetic breeding of high-quality broiler breast muscle development.